[llvm-commits] [test-suite] r105213 [1/3] - in /test-suite/trunk: External/HMMER/ External/Nurbs/ External/Povray/ External/SPEC/CFP2000/177.mesa/ External/SPEC/CFP2000/179.art/ External/SPEC/CFP2000/183.equake/ External/SPEC/CFP2000/188.ammp/ External/SPEC/CFP2006/433.milc/ External/SPEC/CFP2006/444.namd/ External/SPEC/CFP2006/447.dealII/ External/SPEC/CFP2006/450.soplex/ External/SPEC/CFP2006/470.lbm/ External/SPEC/CINT2000/164.gzip/ External/SPEC/CINT2000/175.vpr/ External/SPEC/CINT2000/176.gcc/ External/SPEC/CINT20...
Daniel Dunbar
daniel at zuster.org
Mon May 31 01:17:10 PDT 2010
Author: ddunbar
Date: Mon May 31 03:17:08 2010
New Revision: 105213
URL: http://llvm.org/viewvc/llvm-project?rev=105213&view=rev
Log:
Add a bunch of reference outputs, for normal and SMALL_PROBLEM_SIZE=1 modes.
Added:
test-suite/trunk/External/HMMER/hmmcalibrate.reference_output
test-suite/trunk/External/Nurbs/nurbs.reference_output
test-suite/trunk/External/Povray/povray.reference_output
test-suite/trunk/External/SPEC/CFP2000/177.mesa/177.mesa.reference_output
test-suite/trunk/External/SPEC/CFP2000/177.mesa/177.mesa.reference_output.small
test-suite/trunk/External/SPEC/CFP2000/179.art/179.art.reference_output
test-suite/trunk/External/SPEC/CFP2000/183.equake/183.equake.reference_output
test-suite/trunk/External/SPEC/CFP2000/183.equake/183.equake.reference_output.small
test-suite/trunk/External/SPEC/CFP2000/188.ammp/188.ammp.reference_output
test-suite/trunk/External/SPEC/CFP2000/188.ammp/188.ammp.reference_output.small
test-suite/trunk/External/SPEC/CFP2006/433.milc/433.milc.reference_output
test-suite/trunk/External/SPEC/CFP2006/444.namd/444.namd.reference_output
test-suite/trunk/External/SPEC/CFP2006/447.dealII/447.dealII.reference_output
test-suite/trunk/External/SPEC/CFP2006/447.dealII/447.dealII.reference_output.small
test-suite/trunk/External/SPEC/CFP2006/450.soplex/450.soplex.reference_output
test-suite/trunk/External/SPEC/CFP2006/470.lbm/470.lbm.reference_output
test-suite/trunk/External/SPEC/CINT2000/164.gzip/164.gzip.reference_output
test-suite/trunk/External/SPEC/CINT2000/164.gzip/164.gzip.reference_output.small
test-suite/trunk/External/SPEC/CINT2000/175.vpr/175.vpr.reference_output
test-suite/trunk/External/SPEC/CINT2000/175.vpr/175.vpr.reference_output.small
test-suite/trunk/External/SPEC/CINT2000/176.gcc/176.gcc.reference_output
test-suite/trunk/External/SPEC/CINT2000/176.gcc/176.gcc.reference_output.small
test-suite/trunk/External/SPEC/CINT2000/181.mcf/181.mcf.reference_output
test-suite/trunk/External/SPEC/CINT2000/181.mcf/181.mcf.reference_output.small
test-suite/trunk/External/SPEC/CINT2000/186.crafty/186.crafty.reference_output
test-suite/trunk/External/SPEC/CINT2000/186.crafty/186.crafty.reference_output.small
test-suite/trunk/External/SPEC/CINT2000/197.parser/197.parser.reference_output
test-suite/trunk/External/SPEC/CINT2000/197.parser/197.parser.reference_output.small
test-suite/trunk/External/SPEC/CINT2000/252.eon/252.eon.reference_output
test-suite/trunk/External/SPEC/CINT2000/252.eon/252.eon.reference_output.small
test-suite/trunk/External/SPEC/CINT2000/253.perlbmk/253.perlbmk.reference_output
test-suite/trunk/External/SPEC/CINT2000/253.perlbmk/253.perlbmk.reference_output.small
test-suite/trunk/External/SPEC/CINT2000/254.gap/254.gap.reference_output
test-suite/trunk/External/SPEC/CINT2000/254.gap/254.gap.reference_output.small
test-suite/trunk/External/SPEC/CINT2000/255.vortex/255.vortex.reference_output
test-suite/trunk/External/SPEC/CINT2000/255.vortex/255.vortex.reference_output.small
test-suite/trunk/External/SPEC/CINT2000/256.bzip2/256.bzip2.reference_output
test-suite/trunk/External/SPEC/CINT2000/256.bzip2/256.bzip2.reference_output.small
test-suite/trunk/External/SPEC/CINT2000/300.twolf/300.twolf.reference_output
test-suite/trunk/External/SPEC/CINT2000/300.twolf/300.twolf.reference_output.small
test-suite/trunk/External/SPEC/CINT2006/400.perlbench/400.perlbench.reference_output
test-suite/trunk/External/SPEC/CINT2006/401.bzip2/401.bzip2.reference_output
test-suite/trunk/External/SPEC/CINT2006/403.gcc/403.gcc.reference_output
test-suite/trunk/External/SPEC/CINT2006/429.mcf/429.mcf.reference_output
test-suite/trunk/External/SPEC/CINT2006/445.gobmk/445.gobmk.reference_output
test-suite/trunk/External/SPEC/CINT2006/456.hmmer/456.hmmer.reference_output
test-suite/trunk/External/SPEC/CINT2006/458.sjeng/458.sjeng.reference_output
test-suite/trunk/External/SPEC/CINT2006/462.libquantum/462.libquantum.reference_output
test-suite/trunk/External/SPEC/CINT2006/464.h264ref/464.h264ref.reference_output
test-suite/trunk/External/SPEC/CINT2006/471.omnetpp/471.omnetpp.reference_output
test-suite/trunk/External/SPEC/CINT2006/473.astar/473.astar.reference_output
test-suite/trunk/External/SPEC/CINT2006/483.xalancbmk/483.xalancbmk.reference_output
test-suite/trunk/External/SPEC/CINT2006/483.xalancbmk/483.xalancbmk.reference_output.small
test-suite/trunk/External/SPEC/CINT95/099.go/099.go.reference_output
test-suite/trunk/External/SPEC/CINT95/099.go/099.go.reference_output.small
test-suite/trunk/External/SPEC/CINT95/124.m88ksim/124.m88ksim.reference_output
test-suite/trunk/External/SPEC/CINT95/124.m88ksim/124.m88ksim.reference_output.small
test-suite/trunk/External/SPEC/CINT95/126.gcc/126.gcc.reference_output
test-suite/trunk/External/SPEC/CINT95/126.gcc/126.gcc.reference_output.small
test-suite/trunk/External/SPEC/CINT95/129.compress/129.compress.reference_output
test-suite/trunk/External/SPEC/CINT95/129.compress/129.compress.reference_output.small
test-suite/trunk/External/SPEC/CINT95/130.li/130.li.reference_output
test-suite/trunk/External/SPEC/CINT95/130.li/130.li.reference_output.small
test-suite/trunk/External/SPEC/CINT95/132.ijpeg/132.ijpeg.reference_output
test-suite/trunk/External/SPEC/CINT95/132.ijpeg/132.ijpeg.reference_output.small
test-suite/trunk/External/SPEC/CINT95/134.perl/134.perl.reference_output
test-suite/trunk/External/SPEC/CINT95/147.vortex/147.vortex.reference_output
test-suite/trunk/External/SPEC/CINT95/147.vortex/147.vortex.reference_output.small
test-suite/trunk/MultiSource/Applications/Burg/burg.reference_output
test-suite/trunk/MultiSource/Applications/ClamAV/clamscan.reference_output
test-suite/trunk/MultiSource/Applications/JM/ldecod/ldecod.reference_output
test-suite/trunk/MultiSource/Applications/JM/lencod/lencod.reference_output
test-suite/trunk/MultiSource/Applications/JM/lencod/lencod.reference_output.small
test-suite/trunk/MultiSource/Applications/SIBsim4/SIBsim4.reference_output
test-suite/trunk/MultiSource/Applications/SIBsim4/SIBsim4.reference_output.small
test-suite/trunk/MultiSource/Applications/SPASS/SPASS.reference_output
test-suite/trunk/MultiSource/Applications/SPASS/SPASS.reference_output.small
test-suite/trunk/MultiSource/Applications/aha/aha.reference_output
test-suite/trunk/MultiSource/Applications/d/make_dparser.reference_output
test-suite/trunk/MultiSource/Applications/hbd/hbd.reference_output
test-suite/trunk/MultiSource/Applications/hexxagon/hexxagon.reference_output
test-suite/trunk/MultiSource/Applications/hexxagon/hexxagon.reference_output.small
test-suite/trunk/MultiSource/Applications/kimwitu++/kc.reference_output
test-suite/trunk/MultiSource/Applications/lambda-0.1.3/lambda.reference_output
test-suite/trunk/MultiSource/Applications/lemon/lemon.reference_output
test-suite/trunk/MultiSource/Applications/lua/lua.reference_output
test-suite/trunk/MultiSource/Applications/minisat/minisat.reference_output
test-suite/trunk/MultiSource/Applications/minisat/minisat.reference_output.small
test-suite/trunk/MultiSource/Applications/oggenc/oggenc.reference_output
test-suite/trunk/MultiSource/Applications/sgefa/sgefa.reference_output
test-suite/trunk/MultiSource/Applications/siod/siod.reference_output
test-suite/trunk/MultiSource/Applications/spiff/spiff.reference_output
test-suite/trunk/MultiSource/Applications/sqlite3/sqlite3.reference_output
test-suite/trunk/MultiSource/Applications/sqlite3/sqlite3.reference_output.small
test-suite/trunk/MultiSource/Applications/treecc/treecc.reference_output
test-suite/trunk/MultiSource/Applications/viterbi/viterbi.reference_output
test-suite/trunk/MultiSource/Applications/viterbi/viterbi.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/ASCI_Purple/SMG2000/smg2000.reference_output
test-suite/trunk/MultiSource/Benchmarks/ASCI_Purple/SMG2000/smg2000.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/ASC_Sequoia/AMGmk/AMGmk.reference_output
test-suite/trunk/MultiSource/Benchmarks/ASC_Sequoia/CrystalMk/CrystalMk.reference_output
test-suite/trunk/MultiSource/Benchmarks/ASC_Sequoia/IRSmk/IRSmk.reference_output
test-suite/trunk/MultiSource/Benchmarks/BitBench/drop3/drop3.reference_output
test-suite/trunk/MultiSource/Benchmarks/BitBench/five11/five11.reference_output
test-suite/trunk/MultiSource/Benchmarks/BitBench/uudecode/uudecode.reference_output
test-suite/trunk/MultiSource/Benchmarks/BitBench/uuencode/uuencode.reference_output
test-suite/trunk/MultiSource/Benchmarks/Bullet/bullet.reference_output
test-suite/trunk/MultiSource/Benchmarks/Fhourstones-3.1/fhourstones3.1.reference_output
test-suite/trunk/MultiSource/Benchmarks/Fhourstones/fhourstones.reference_output
test-suite/trunk/MultiSource/Benchmarks/FreeBench/analyzer/analyzer.reference_output
test-suite/trunk/MultiSource/Benchmarks/FreeBench/distray/distray.reference_output
test-suite/trunk/MultiSource/Benchmarks/FreeBench/fourinarow/fourinarow.reference_output
test-suite/trunk/MultiSource/Benchmarks/FreeBench/mason/mason.reference_output
test-suite/trunk/MultiSource/Benchmarks/FreeBench/neural/neural.reference_output
test-suite/trunk/MultiSource/Benchmarks/FreeBench/pcompress2/pcompress2.reference_output
test-suite/trunk/MultiSource/Benchmarks/FreeBench/pifft/pifft.reference_output
test-suite/trunk/MultiSource/Benchmarks/MallocBench/cfrac/cfrac.reference_output
test-suite/trunk/MultiSource/Benchmarks/MallocBench/espresso/espresso.reference_output
test-suite/trunk/MultiSource/Benchmarks/MallocBench/gs/gs.reference_output
test-suite/trunk/MultiSource/Benchmarks/McCat/01-qbsort/qbsort.reference_output
test-suite/trunk/MultiSource/Benchmarks/McCat/03-testtrie/testtrie.reference_output
test-suite/trunk/MultiSource/Benchmarks/McCat/04-bisect/bisect.reference_output
test-suite/trunk/MultiSource/Benchmarks/McCat/05-eks/eks.reference_output
test-suite/trunk/MultiSource/Benchmarks/McCat/08-main/main.reference_output
test-suite/trunk/MultiSource/Benchmarks/McCat/09-vor/vor.reference_output
test-suite/trunk/MultiSource/Benchmarks/McCat/12-IOtest/iotest.reference_output
test-suite/trunk/MultiSource/Benchmarks/McCat/15-trie/trie.reference_output
test-suite/trunk/MultiSource/Benchmarks/McCat/17-bintr/bintr.reference_output
test-suite/trunk/MultiSource/Benchmarks/McCat/18-imp/imp.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/automotive-basicmath/automotive-basicmath.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/automotive-bitcount/automotive-bitcount.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/automotive-susan/automotive-susan.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/consumer-jpeg/consumer-jpeg.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/consumer-lame/consumer-lame.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/consumer-typeset/consumer-typeset.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/network-dijkstra/network-dijkstra.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/network-patricia/network-patricia.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/office-ispell/office-ispell.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/office-stringsearch/office-stringsearch.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/security-blowfish/security-blowfish.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/security-rijndael/security-rijndael.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/security-sha/security-sha.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/telecomm-CRC32/telecomm-CRC32.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/telecomm-FFT/telecomm-fft.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/telecomm-adpcm/telecomm-adpcm.reference_output
test-suite/trunk/MultiSource/Benchmarks/MiBench/telecomm-gsm/telecomm-gsm.reference_output
test-suite/trunk/MultiSource/Benchmarks/NPB-serial/is/is.reference_output
test-suite/trunk/MultiSource/Benchmarks/NPB-serial/is/is.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/Olden/bh/bh.reference_output
test-suite/trunk/MultiSource/Benchmarks/Olden/bh/bh.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/Olden/bisort/bisort.reference_output
test-suite/trunk/MultiSource/Benchmarks/Olden/em3d/em3d.reference_output
test-suite/trunk/MultiSource/Benchmarks/Olden/em3d/em3d.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/Olden/health/health.reference_output
test-suite/trunk/MultiSource/Benchmarks/Olden/health/health.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/Olden/mst/mst.reference_output
test-suite/trunk/MultiSource/Benchmarks/Olden/perimeter/perimeter.reference_output
test-suite/trunk/MultiSource/Benchmarks/Olden/perimeter/perimeter.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/Olden/power/power.reference_output
test-suite/trunk/MultiSource/Benchmarks/Olden/power/power.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/Olden/treeadd/treeadd.reference_output
test-suite/trunk/MultiSource/Benchmarks/Olden/treeadd/treeadd.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/Olden/tsp/tsp.reference_output
test-suite/trunk/MultiSource/Benchmarks/Olden/tsp/tsp.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/Olden/voronoi/voronoi.reference_output
test-suite/trunk/MultiSource/Benchmarks/Olden/voronoi/voronoi.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/PAQ8p/paq8p.reference_output
test-suite/trunk/MultiSource/Benchmarks/PAQ8p/paq8p.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/NP/np.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/city/city.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/deriv1/deriv1.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/deriv2/deriv2.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/employ/employ.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/family/family.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/fsm/fsm.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/garage/garage.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/life/life.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/objects/objects.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/ocean/ocean.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/office/office.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/primes/primes.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/shapes/shapes.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/simul/simul.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/trees/trees.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C++/vcirc/vcirc.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C/TimberWolfMC/timberwolfmc.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C/agrep/agrep.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C/allroots/allroots.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C/assembler/assembler.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C/bison/mybison.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C/cdecl/cdecl.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C/compiler/compiler.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C/fixoutput/fixoutput.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C/football/football.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C/gnugo/gnugo.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C/loader/loader.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C/simulator/simulator.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C/unix-smail/unix-smail.reference_output
test-suite/trunk/MultiSource/Benchmarks/Prolangs-C/unix-tbl/unix-tbl.reference_output
test-suite/trunk/MultiSource/Benchmarks/Ptrdist/anagram/anagram.reference_output
test-suite/trunk/MultiSource/Benchmarks/Ptrdist/bc/bc.reference_output
test-suite/trunk/MultiSource/Benchmarks/Ptrdist/ft/ft.reference_output
test-suite/trunk/MultiSource/Benchmarks/Ptrdist/ks/ks.reference_output
test-suite/trunk/MultiSource/Benchmarks/Ptrdist/yacr2/yacr2.reference_output
test-suite/trunk/MultiSource/Benchmarks/SciMark2-C/scimark2.reference_output
test-suite/trunk/MultiSource/Benchmarks/Trimaran/enc-3des/enc-3des.reference_output
test-suite/trunk/MultiSource/Benchmarks/Trimaran/enc-md5/enc-md5.reference_output
test-suite/trunk/MultiSource/Benchmarks/Trimaran/enc-md5/enc-md5.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/Trimaran/enc-pc1/enc-pc1.reference_output
test-suite/trunk/MultiSource/Benchmarks/Trimaran/enc-pc1/enc-pc1.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/Trimaran/enc-rc4/enc-rc4.reference_output
test-suite/trunk/MultiSource/Benchmarks/Trimaran/netbench-crc/netbench-crc.reference_output
test-suite/trunk/MultiSource/Benchmarks/Trimaran/netbench-crc/netbench-crc.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/Trimaran/netbench-url/netbench-url.reference_output
test-suite/trunk/MultiSource/Benchmarks/Trimaran/netbench-url/netbench-url.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/VersaBench/8b10b/8b10b.reference_output
test-suite/trunk/MultiSource/Benchmarks/VersaBench/8b10b/8b10b.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/VersaBench/beamformer/beamformer.reference_output
test-suite/trunk/MultiSource/Benchmarks/VersaBench/beamformer/beamformer.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/VersaBench/bmm/bmm.reference_output
test-suite/trunk/MultiSource/Benchmarks/VersaBench/bmm/bmm.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/VersaBench/dbms/dbms.reference_output
test-suite/trunk/MultiSource/Benchmarks/VersaBench/dbms/dbms.reference_output.small
test-suite/trunk/MultiSource/Benchmarks/VersaBench/ecbdes/ecbdes.reference_output
test-suite/trunk/MultiSource/Benchmarks/llubenchmark/llu.reference_output
test-suite/trunk/MultiSource/Benchmarks/mafft/pairlocalalign.reference_output
test-suite/trunk/MultiSource/Benchmarks/mediabench/adpcm/rawcaudio/rawcaudio.reference_output
test-suite/trunk/MultiSource/Benchmarks/mediabench/adpcm/rawdaudio/rawdaudio.reference_output
test-suite/trunk/MultiSource/Benchmarks/mediabench/g721/g721encode/encode.reference_output
test-suite/trunk/MultiSource/Benchmarks/mediabench/gsm/toast/toast.reference_output
test-suite/trunk/MultiSource/Benchmarks/mediabench/jpeg/jpeg-6a/cjpeg.reference_output
test-suite/trunk/MultiSource/Benchmarks/mediabench/mpeg2/mpeg2dec/mpeg2decode.reference_output
test-suite/trunk/MultiSource/Benchmarks/sim/sim.reference_output
test-suite/trunk/MultiSource/Benchmarks/tramp3d-v4/tramp3d-v4.reference_output
test-suite/trunk/MultiSource/Benchmarks/tramp3d-v4/tramp3d-v4.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Adobe-C++/functionobjects.reference_output
test-suite/trunk/SingleSource/Benchmarks/Adobe-C++/loop_unroll.reference_output
test-suite/trunk/SingleSource/Benchmarks/Adobe-C++/simple_types_constant_folding.reference_output
test-suite/trunk/SingleSource/Benchmarks/Adobe-C++/simple_types_loop_invariant.reference_output
test-suite/trunk/SingleSource/Benchmarks/Adobe-C++/stepanov_abstraction.reference_output
test-suite/trunk/SingleSource/Benchmarks/Adobe-C++/stepanov_vector.reference_output
test-suite/trunk/SingleSource/Benchmarks/BenchmarkGame/Large/fasta.reference_output
test-suite/trunk/SingleSource/Benchmarks/BenchmarkGame/fannkuch.reference_output
test-suite/trunk/SingleSource/Benchmarks/BenchmarkGame/n-body.reference_output
test-suite/trunk/SingleSource/Benchmarks/BenchmarkGame/nsieve-bits.reference_output
test-suite/trunk/SingleSource/Benchmarks/BenchmarkGame/partialsums.reference_output
test-suite/trunk/SingleSource/Benchmarks/BenchmarkGame/puzzle.reference_output
test-suite/trunk/SingleSource/Benchmarks/BenchmarkGame/recursive.reference_output
test-suite/trunk/SingleSource/Benchmarks/BenchmarkGame/spectral-norm.reference_output
test-suite/trunk/SingleSource/Benchmarks/CoyoteBench/almabench.reference_output
test-suite/trunk/SingleSource/Benchmarks/CoyoteBench/almabench.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/CoyoteBench/fftbench.reference_output
test-suite/trunk/SingleSource/Benchmarks/CoyoteBench/huffbench.reference_output
test-suite/trunk/SingleSource/Benchmarks/CoyoteBench/lpbench.reference_output
test-suite/trunk/SingleSource/Benchmarks/Dhrystone/dry.reference_output
test-suite/trunk/SingleSource/Benchmarks/Dhrystone/fldry.reference_output
test-suite/trunk/SingleSource/Benchmarks/McGill/chomp.reference_output
test-suite/trunk/SingleSource/Benchmarks/McGill/chomp.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/McGill/exptree.reference_output
test-suite/trunk/SingleSource/Benchmarks/McGill/misr.reference_output
test-suite/trunk/SingleSource/Benchmarks/McGill/misr.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/McGill/queens.reference_output
test-suite/trunk/SingleSource/Benchmarks/McGill/queens.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Misc-C++-EH/spirit.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc-C++/Large/ray.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc-C++/Large/ray.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Misc-C++/Large/sphereflake.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc-C++/Large/sphereflake.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Misc-C++/bigfib.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc-C++/bigfib.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Misc-C++/mandel-text.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc-C++/oopack_v1p8.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc-C++/stepanov_container.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc-C++/stepanov_v1p2.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/ReedSolomon.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/dt.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/fbench.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/ffbench.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/flops-1.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/flops-1.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Misc/flops-2.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/flops-3.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/flops-4.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/flops-5.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/flops-6.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/flops-7.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/flops-8.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/flops.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/flops.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Misc/fp-convert.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/fp-convert.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Misc/himenobmtxpa.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/lowercase.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/mandel-2.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/mandel.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/mandel.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Misc/oourafft.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/perlin.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/pi.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/pi.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Misc/richards_benchmark.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/richards_benchmark.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Misc/salsa20.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/whetstone.reference_output
test-suite/trunk/SingleSource/Benchmarks/Misc/whetstone.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/ackermann.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/ackermann.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/ary.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/ary.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/ary2.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/ary2.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/ary3.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/ary3.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/except.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/except.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/fibo.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/fibo.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/hash.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/hash.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/hash2.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/hash2.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/heapsort.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/hello.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/lists.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/lists.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/lists1.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/lists1.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/matrix.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/methcall.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/moments.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/moments.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/nestedloop.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/nestedloop.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/objinst.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/random.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/random.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/reversefile.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/sieve.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/spellcheck.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/strcat.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/strcat.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/sumcol.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/wc.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout-C++/wordfreq.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout/ackermann.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout/ary3.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout/ary3.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout/fib2.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout/fib2.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout/hash.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout/hash.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout/heapsort.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout/hello.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout/lists.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout/matrix.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout/methcall.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout/nestedloop.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout/nestedloop.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout/objinst.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout/random.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout/random.reference_output.small
test-suite/trunk/SingleSource/Benchmarks/Shootout/sieve.reference_output
test-suite/trunk/SingleSource/Benchmarks/Shootout/strcat.reference_output
test-suite/trunk/SingleSource/Benchmarks/Stanford/Bubblesort.reference_output
test-suite/trunk/SingleSource/Benchmarks/Stanford/IntMM.reference_output
test-suite/trunk/SingleSource/Benchmarks/Stanford/Oscar.reference_output
test-suite/trunk/SingleSource/Benchmarks/Stanford/Perm.reference_output
test-suite/trunk/SingleSource/Benchmarks/Stanford/Puzzle.reference_output
test-suite/trunk/SingleSource/Benchmarks/Stanford/Queens.reference_output
test-suite/trunk/SingleSource/Benchmarks/Stanford/Quicksort.reference_output
test-suite/trunk/SingleSource/Benchmarks/Stanford/RealMM.reference_output
test-suite/trunk/SingleSource/Benchmarks/Stanford/Towers.reference_output
test-suite/trunk/SingleSource/Benchmarks/Stanford/Treesort.reference_output
test-suite/trunk/SingleSource/Regression/C++/2003-05-14-array-init.reference_output
test-suite/trunk/SingleSource/Regression/C++/2003-05-14-expr_stmt.reference_output
test-suite/trunk/SingleSource/Regression/C++/2003-06-08-BaseType.reference_output
test-suite/trunk/SingleSource/Regression/C++/2003-06-08-VirtualFunctions.reference_output
test-suite/trunk/SingleSource/Regression/C++/2003-06-13-Crasher.reference_output
test-suite/trunk/SingleSource/Regression/C++/2003-08-20-EnumSizeProblem.reference_output
test-suite/trunk/SingleSource/Regression/C++/2003-09-29-NonPODsByValue.reference_output
test-suite/trunk/SingleSource/Regression/C++/2008-01-29-ParamAliasesReturn.reference_output
test-suite/trunk/SingleSource/Regression/C++/BuiltinTypeInfo.reference_output
test-suite/trunk/SingleSource/Regression/C++/EH/ConditionalExpr.reference_output
test-suite/trunk/SingleSource/Regression/C++/EH/ctor_dtor_count-2.reference_output
test-suite/trunk/SingleSource/Regression/C++/EH/ctor_dtor_count.reference_output
test-suite/trunk/SingleSource/Regression/C++/EH/dead_try_block.reference_output
test-suite/trunk/SingleSource/Regression/C++/EH/exception_spec_test.reference_output
test-suite/trunk/SingleSource/Regression/C++/EH/function_try_block.reference_output
test-suite/trunk/SingleSource/Regression/C++/EH/simple_rethrow.reference_output
test-suite/trunk/SingleSource/Regression/C++/EH/simple_throw.reference_output
test-suite/trunk/SingleSource/Regression/C++/EH/throw_rethrow_test.reference_output
test-suite/trunk/SingleSource/Regression/C++/global_ctor.reference_output
test-suite/trunk/SingleSource/Regression/C++/global_type.reference_output
test-suite/trunk/SingleSource/Regression/C++/ofstream_ctor.reference_output
test-suite/trunk/SingleSource/Regression/C++/pointer_member.reference_output
test-suite/trunk/SingleSource/Regression/C++/pointer_method.reference_output
test-suite/trunk/SingleSource/Regression/C++/short_circuit_dtor.reference_output
test-suite/trunk/SingleSource/Regression/C/2003-05-14-initialize-string.reference_output
test-suite/trunk/SingleSource/Regression/C/2003-05-21-BitfieldHandling.reference_output
test-suite/trunk/SingleSource/Regression/C/2003-05-21-UnionBitfields.reference_output
test-suite/trunk/SingleSource/Regression/C/2003-05-21-UnionTest.reference_output
test-suite/trunk/SingleSource/Regression/C/2003-05-22-LocalTypeTest.reference_output
test-suite/trunk/SingleSource/Regression/C/2003-05-22-VarSizeArray.reference_output
test-suite/trunk/SingleSource/Regression/C/2003-05-23-TransparentUnion.reference_output
test-suite/trunk/SingleSource/Regression/C/2003-06-16-InvalidInitializer.reference_output
test-suite/trunk/SingleSource/Regression/C/2003-06-16-VolatileError.reference_output
test-suite/trunk/SingleSource/Regression/C/2003-10-12-GlobalVarInitializers.reference_output
test-suite/trunk/SingleSource/Regression/C/2004-02-03-AggregateCopy.reference_output
test-suite/trunk/SingleSource/Regression/C/2004-03-15-IndirectGoto.reference_output
test-suite/trunk/SingleSource/Regression/C/2004-08-12-InlinerAndAllocas.reference_output
test-suite/trunk/SingleSource/Regression/C/2005-05-06-LongLongSignedShift.reference_output
test-suite/trunk/SingleSource/Regression/C/2008-01-07-LongDouble.reference_output
test-suite/trunk/SingleSource/Regression/C/ConstructorDestructorAttributes.reference_output
test-suite/trunk/SingleSource/Regression/C/DuffsDevice.reference_output
test-suite/trunk/SingleSource/Regression/C/PR1386.reference_output
test-suite/trunk/SingleSource/Regression/C/PR491.reference_output
test-suite/trunk/SingleSource/Regression/C/PR640.reference_output
test-suite/trunk/SingleSource/Regression/C/badidx.reference_output
test-suite/trunk/SingleSource/Regression/C/bigstack.reference_output
test-suite/trunk/SingleSource/Regression/C/callargs.reference_output
test-suite/trunk/SingleSource/Regression/C/casts.reference_output
test-suite/trunk/SingleSource/Regression/C/globalrefs.reference_output
test-suite/trunk/SingleSource/Regression/C/matrixTranspose.reference_output
test-suite/trunk/SingleSource/Regression/C/pointer_arithmetic.reference_output
test-suite/trunk/SingleSource/Regression/C/sumarray.reference_output
test-suite/trunk/SingleSource/Regression/C/sumarray2d.reference_output
test-suite/trunk/SingleSource/Regression/C/sumarraymalloc.reference_output
test-suite/trunk/SingleSource/Regression/C/test_indvars.reference_output
test-suite/trunk/SingleSource/Regression/C/testtrace.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-04-17-PrintfChar.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-05-02-ArgumentTest.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-05-02-CastTest.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-05-02-CastTest1.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-05-02-CastTest2.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-05-02-CastTest3.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-05-02-ManyArguments.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-05-03-NotTest.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-05-19-DivTest.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-08-02-CastTest.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-08-02-CastTest2.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-08-19-CodegenBug.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-10-09-ArrayResolution.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-10-12-StructureArgs.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-10-12-StructureArgsSimple.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-10-13-BadLoad.reference_output
test-suite/trunk/SingleSource/UnitTests/2002-12-13-MishaTest.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-04-22-Switch.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-05-02-DependentPHI.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-05-07-VarArgs.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-05-12-MinIntProblem.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-05-14-AtExit.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-05-26-Shorts.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-05-31-CastToBool.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-05-31-LongShifts.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-07-06-IntOverflow.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-07-08-BitOpsTest.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-07-09-LoadShorts.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-07-09-SignedArgs.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-07-10-SignConversions.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-08-05-CastFPToUint.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-08-11-VaListArg.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-08-20-FoldBug.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-09-18-BitFieldTest.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-10-13-SwitchTest.reference_output
test-suite/trunk/SingleSource/UnitTests/2003-10-29-ScalarReplBug.reference_output
test-suite/trunk/SingleSource/UnitTests/2004-02-02-NegativeZero.reference_output
test-suite/trunk/SingleSource/UnitTests/2004-06-20-StaticBitfieldInit.reference_output
test-suite/trunk/SingleSource/UnitTests/2004-11-28-GlobalBoolLayout.reference_output
test-suite/trunk/SingleSource/UnitTests/2005-05-11-Popcount-ffs-fls.reference_output
test-suite/trunk/SingleSource/UnitTests/2005-05-12-Int64ToFP.reference_output
test-suite/trunk/SingleSource/UnitTests/2005-05-13-SDivTwo.reference_output
test-suite/trunk/SingleSource/UnitTests/2005-07-15-Bitfield-ABI.reference_output
test-suite/trunk/SingleSource/UnitTests/2005-07-17-INT-To-FP.reference_output
test-suite/trunk/SingleSource/UnitTests/2005-11-29-LongSwitch.reference_output
test-suite/trunk/SingleSource/UnitTests/2006-01-23-UnionInit.reference_output
test-suite/trunk/SingleSource/UnitTests/2006-01-29-SimpleIndirectCall.reference_output
test-suite/trunk/SingleSource/UnitTests/2006-02-04-DivRem.reference_output
test-suite/trunk/SingleSource/UnitTests/2006-12-01-float_varg.reference_output
test-suite/trunk/SingleSource/UnitTests/2006-12-04-DynAllocAndRestore.reference_output
test-suite/trunk/SingleSource/UnitTests/2006-12-07-Compare64BitConstant.reference_output
test-suite/trunk/SingleSource/UnitTests/2006-12-11-LoadConstants.reference_output
test-suite/trunk/SingleSource/UnitTests/2007-01-04-KNR-Args.reference_output
test-suite/trunk/SingleSource/UnitTests/2007-03-02-VaCopy.reference_output
test-suite/trunk/SingleSource/UnitTests/2007-04-10-BitfieldTest.reference_output
test-suite/trunk/SingleSource/UnitTests/2008-04-18-LoopBug.reference_output
test-suite/trunk/SingleSource/UnitTests/2008-04-20-LoopBug2.reference_output
test-suite/trunk/SingleSource/UnitTests/2008-07-13-InlineSetjmp.reference_output
test-suite/trunk/SingleSource/UnitTests/2009-04-16-BitfieldInitialization.reference_output
test-suite/trunk/SingleSource/UnitTests/2009-12-07-StructReturn.reference_output
test-suite/trunk/SingleSource/UnitTests/2010-05-24-BitfieldTest.reference_output
test-suite/trunk/SingleSource/UnitTests/AtomicOps.reference_output
test-suite/trunk/SingleSource/UnitTests/FloatPrecision.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC++/Hello.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/constant-strings.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/dot-syntax-1.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/dot-syntax-2.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/dot-syntax.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/exceptions-2.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/exceptions-3.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/exceptions.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/for-in.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/messages-2.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/messages.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/parameter-passing.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/predefined-expr-in-method.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/print-class-info.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/property.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/protocols.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/synchronized.reference_output
test-suite/trunk/SingleSource/UnitTests/ObjC/trivial-interface.reference_output
test-suite/trunk/SingleSource/UnitTests/SignlessTypes/Large/cast.reference_output
test-suite/trunk/SingleSource/UnitTests/SignlessTypes/cast-bug.reference_output
test-suite/trunk/SingleSource/UnitTests/SignlessTypes/cast2.reference_output
test-suite/trunk/SingleSource/UnitTests/SignlessTypes/ccc.reference_output
test-suite/trunk/SingleSource/UnitTests/SignlessTypes/div.reference_output
test-suite/trunk/SingleSource/UnitTests/SignlessTypes/factor.reference_output
test-suite/trunk/SingleSource/UnitTests/SignlessTypes/rem.reference_output
test-suite/trunk/SingleSource/UnitTests/SignlessTypes/shr.reference_output
test-suite/trunk/SingleSource/UnitTests/StructModifyTest.reference_output
test-suite/trunk/SingleSource/UnitTests/TestLoop.reference_output
test-suite/trunk/SingleSource/UnitTests/Vector/SSE/sse.expandfft.reference_output
test-suite/trunk/SingleSource/UnitTests/Vector/SSE/sse.isamax.reference_output
test-suite/trunk/SingleSource/UnitTests/Vector/SSE/sse.shift.reference_output
test-suite/trunk/SingleSource/UnitTests/Vector/SSE/sse.stepfft.reference_output
test-suite/trunk/SingleSource/UnitTests/Vector/build.reference_output
test-suite/trunk/SingleSource/UnitTests/Vector/build2.reference_output
test-suite/trunk/SingleSource/UnitTests/Vector/divides.reference_output
test-suite/trunk/SingleSource/UnitTests/Vector/multiplies.reference_output
test-suite/trunk/SingleSource/UnitTests/Vector/simple.reference_output
test-suite/trunk/SingleSource/UnitTests/Vector/sumarray-dbl.reference_output
test-suite/trunk/SingleSource/UnitTests/Vector/sumarray.reference_output
test-suite/trunk/SingleSource/UnitTests/byval-alignment.reference_output
test-suite/trunk/SingleSource/UnitTests/printargs.reference_output
Added: test-suite/trunk/External/HMMER/hmmcalibrate.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/HMMER/hmmcalibrate.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/HMMER/hmmcalibrate.reference_output (added)
+++ test-suite/trunk/External/HMMER/hmmcalibrate.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,19 @@
+hmmcalibrate -- calibrate HMM search statistics
+HMMER 2.3.2 (Oct 2003)
+Copyright (C) 1992-2003 HHMI/Washington University School of Medicine
+Freely distributed under the GNU General Public License (GPL)
+- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+HMM file: /Users/ddunbar/llvm/projects/test-suite-externals/hmmer/globin.hmm
+Length fixed to: 400
+Number of samples: 80000
+random seed: 1158818515
+histogram(s) saved to: [not saved]
+POSIX threads: 1
+- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+
+HMM : globins50
+mu : -38.927090
+lambda : 0.246185
+max : -6.928000
+//
+exit 0
Added: test-suite/trunk/External/Nurbs/nurbs.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/Nurbs/nurbs.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/Nurbs/nurbs.reference_output (added)
+++ test-suite/trunk/External/Nurbs/nurbs.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,4 @@
+/Users/ddunbar/llvm-test-suite/TimedExec.sh: line 28: /Volumes/Data/Users/ddunbar/llvm-test-suite/External/Nurbs/Output/nurbs.native: No such file or directory
+/Users/ddunbar/llvm-test-suite/TimedExec.sh: line 28: exec: /Volumes/Data/Users/ddunbar/llvm-test-suite/External/Nurbs/Output/nurbs.native: cannot execute: No such file or directory
+exit 126
+RunSafely.sh detected a failure with these command-line arguments: 500 0 /dev/null Output/nurbs.out-nat Output/nurbs.native /k all timed /t 500 /vsteps 192 /usteps 192 /vcp 20 /ucp 20
Added: test-suite/trunk/External/Povray/povray.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/Povray/povray.reference_output?rev=105213&view=auto
==============================================================================
Binary files test-suite/trunk/External/Povray/povray.reference_output (added) and test-suite/trunk/External/Povray/povray.reference_output Mon May 31 03:17:08 2010 differ
Added: test-suite/trunk/External/SPEC/CFP2000/177.mesa/177.mesa.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CFP2000/177.mesa/177.mesa.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CFP2000/177.mesa/177.mesa.reference_output (added)
+++ test-suite/trunk/External/SPEC/CFP2000/177.mesa/177.mesa.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1 @@
+f48239bfae79c05393861cf13084ea74
Added: test-suite/trunk/External/SPEC/CFP2000/177.mesa/177.mesa.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CFP2000/177.mesa/177.mesa.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CFP2000/177.mesa/177.mesa.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CFP2000/177.mesa/177.mesa.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1 @@
+d0f51fec0efe893031e43cba7341c4e1
Added: test-suite/trunk/External/SPEC/CFP2000/179.art/179.art.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CFP2000/179.art/179.art.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CFP2000/179.art/179.art.reference_output (added)
+++ test-suite/trunk/External/SPEC/CFP2000/179.art/179.art.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,360 @@
+Scan file: c756hel.in
+trainfile1: a10.img
+stride: 2
+startx: 134
+starty: 220
+endx: 154
+endy: 230
+objects: 3
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.2469433
+ j = 2 Y= 96.2469433
+ j = 3 Y= 96.2469433
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.2142474
+ j = 2 Y= 96.2142474
+ j = 3 Y= 96.2142474
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1773039
+ j = 2 Y= 96.1773039
+ j = 3 Y= 96.1773039
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.2391320
+ j = 2 Y= 96.2391320
+ j = 3 Y= 96.2391320
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1879410
+ j = 2 Y= 96.1879410
+ j = 3 Y= 96.1879410
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.2456276
+ j = 2 Y= 96.2456276
+ j = 3 Y= 96.2456276
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1992889
+ j = 2 Y= 96.1992889
+ j = 3 Y= 96.1992889
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.2276747
+ j = 2 Y= 96.2276747
+ j = 3 Y= 96.2276747
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1714993
+ j = 2 Y= 96.1714993
+ j = 3 Y= 96.1714993
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.2140716
+ j = 2 Y= 96.2140716
+ j = 3 Y= 96.2140716
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.2073270
+ j = 2 Y= 96.2073270
+ j = 3 Y= 96.2073270
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1768537
+ j = 2 Y= 96.1768537
+ j = 3 Y= 96.1768537
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1421366
+ j = 2 Y= 96.1421366
+ j = 3 Y= 96.1421366
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.2177986
+ j = 2 Y= 96.2177986
+ j = 3 Y= 96.2177986
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1704646
+ j = 2 Y= 96.1704646
+ j = 3 Y= 96.1704646
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1300389
+ j = 2 Y= 96.1300389
+ j = 3 Y= 96.1300389
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1978244
+ j = 2 Y= 96.1978244
+ j = 3 Y= 96.1978244
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1463203
+ j = 2 Y= 96.1463203
+ j = 3 Y= 96.1463203
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1844534
+ j = 2 Y= 96.1844534
+ j = 3 Y= 96.1844534
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1231318
+ j = 2 Y= 96.1231318
+ j = 3 Y= 96.1231318
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1004345
+ j = 2 Y= 96.1004345
+ j = 3 Y= 96.1004345
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1537888
+ j = 2 Y= 96.1537888
+ j = 3 Y= 96.1537888
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1213978
+ j = 2 Y= 96.1213978
+ j = 3 Y= 96.1213978
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.0871805
+ j = 2 Y= 96.0871805
+ j = 3 Y= 96.0871805
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1666560
+ j = 2 Y= 96.1666560
+ j = 3 Y= 96.1666560
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1278443
+ j = 2 Y= 96.1278443
+ j = 3 Y= 96.1278443
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.0831286
+ j = 2 Y= 96.0831286
+ j = 3 Y= 96.0831286
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1617749
+ j = 2 Y= 96.1617749
+ j = 3 Y= 96.1617749
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1115432
+ j = 2 Y= 96.1115432
+ j = 3 Y= 96.1115432
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1483822
+ j = 2 Y= 96.1483822
+ j = 3 Y= 96.1483822
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.0981895
+ j = 2 Y= 96.0981895
+ j = 3 Y= 96.0981895
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.0713086
+ j = 2 Y= 96.0713086
+ j = 3 Y= 96.0713086
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1264713
+ j = 2 Y= 96.1264713
+ j = 3 Y= 96.1264713
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.0939346
+ j = 2 Y= 96.0939346
+ j = 3 Y= 96.0939346
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.0522305
+ j = 2 Y= 96.0522305
+ j = 3 Y= 96.0522305
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1482711
+ j = 2 Y= 96.1482711
+ j = 3 Y= 96.1482711
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1037380
+ j = 2 Y= 96.1037380
+ j = 3 Y= 96.1037380
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.0580394
+ j = 2 Y= 96.0580394
+ j = 3 Y= 96.0580394
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1537962
+ j = 2 Y= 96.1537962
+ j = 3 Y= 96.1537962
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.0938819
+ j = 2 Y= 96.0938819
+ j = 3 Y= 96.0938819
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1074875
+ j = 2 Y= 96.1074875
+ j = 3 Y= 96.1074875
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.0822981
+ j = 2 Y= 96.0822981
+ j = 3 Y= 96.0822981
+F2 neuron 0 passes vigilance with a value of 0.7100
+
+
+ j = 0 Y= 98.7946178
+ j = 1 Y= 61.0710013
+ j = 2 Y= 61.0710013
+ j = 3 Y= 61.0710013
+F2 neuron 0 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 99.9999856
+ j = 1 Y= 61.1303783
+ j = 2 Y= 61.1303783
+ j = 3 Y= 61.1303783
+F2 neuron 0 passes vigilance with a value of 0.7055
+
+
+ j = 0 Y= 98.7772918
+ j = 1 Y= 61.0904317
+ j = 2 Y= 61.0904317
+ j = 3 Y= 61.0904317
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.0402660
+ j = 2 Y= 96.0402660
+ j = 3 Y= 96.0402660
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1341077
+ j = 2 Y= 96.1341077
+ j = 3 Y= 96.1341077
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.0918864
+ j = 2 Y= 96.0918864
+ j = 3 Y= 96.0918864
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.0501056
+ j = 2 Y= 96.0501056
+ j = 3 Y= 96.0501056
+F2 neuron 1 passes vigilance with a value of 1.0000
+
+
+ j = 0 Y= 0.0000000
+ j = 1 Y= 96.1428547
+ j = 2 Y= 96.1428547
+ j = 3 Y= 96.1428547
+Highest vigilance for 1 = 1.0000 for object at X = 140, Y = 228
+exit 0
Added: test-suite/trunk/External/SPEC/CFP2000/183.equake/183.equake.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CFP2000/183.equake/183.equake.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CFP2000/183.equake/183.equake.reference_output (added)
+++ test-suite/trunk/External/SPEC/CFP2000/183.equake/183.equake.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,294 @@
+equake: Reading nodes.
+equake: Reading elements.
+equake: Reading sparse matrix structure.
+equake: Beginning simulation.
+
+CASE SUMMARY
+Fault information
+ Orientation: strike: 1.937315
+ dip: 0.767945
+ rake: 1.221730
+ dislocation: 29.640788 cm
+Hypocenter: (32.264153, 23.814432, -11.250000) Km
+Excitation characteristics
+ Time step: 0.002400 sec
+ Duration: 6.500000 sec
+ Rise time: 0.600000 sec
+
+The source is node 978 at (32.250000 24.364300 -11.200000)
+The epicenter is node 3394 at (32.250000 23.687500 0.000000)
+
+Time step 30
+978: 8.01e-03 7.19e-03 8.41e-03
+3394: -3.69e-21 1.57e-20 -5.20e-20
+Time step 60
+978: 4.70e-02 4.08e-02 4.55e-02
+3394: -1.07e-16 4.36e-16 -1.43e-15
+Time step 90
+978: 1.05e-01 8.39e-02 9.63e-02
+3394: -4.59e-14 1.76e-13 -5.73e-13
+Time step 120
+978: 1.34e-01 8.04e-02 1.25e-01
+3394: -3.44e-12 1.24e-11 -3.97e-11
+Time step 150
+978: 7.75e-02 -3.38e-02 1.07e-01
+3394: -9.72e-11 3.30e-10 -1.04e-09
+Time step 180
+978: -9.38e-02 -2.93e-01 4.76e-02
+3394: -1.45e-09 4.69e-09 -1.45e-08
+Time step 210
+978: -3.58e-01 -6.75e-01 -1.20e-02
+3394: -1.38e-08 4.28e-08 -1.31e-07
+Time step 240
+978: -6.49e-01 -1.10e+00 -1.98e-02
+3394: -9.35e-08 2.80e-07 -8.45e-07
+Time step 270
+978: -8.84e-01 -1.49e+00 5.75e-02
+3394: -4.81e-07 1.41e-06 -4.22e-06
+Time step 300
+978: -1.03e+00 -1.77e+00 1.97e-01
+3394: -1.98e-06 5.79e-06 -1.71e-05
+Time step 330
+978: -1.07e+00 -1.93e+00 3.61e-01
+3394: -6.76e-06 1.99e-05 -5.83e-05
+Time step 360
+978: -1.02e+00 -1.98e+00 5.22e-01
+3394: -1.96e-05 5.92e-05 -1.72e-04
+Time step 390
+978: -8.91e-01 -1.91e+00 6.67e-01
+3394: -4.96e-05 1.55e-04 -4.46e-04
+Time step 420
+978: -7.09e-01 -1.77e+00 7.90e-01
+3394: -1.11e-04 3.67e-04 -1.04e-03
+Time step 450
+978: -5.01e-01 -1.58e+00 8.92e-01
+3394: -2.21e-04 7.89e-04 -2.21e-03
+Time step 480
+978: -2.93e-01 -1.38e+00 9.78e-01
+3394: -4.00e-04 1.56e-03 -4.32e-03
+Time step 510
+978: -1.05e-01 -1.20e+00 1.05e+00
+3394: -6.59e-04 2.89e-03 -7.86e-03
+Time step 540
+978: 4.61e-02 -1.06e+00 1.12e+00
+3394: -9.97e-04 4.99e-03 -1.34e-02
+Time step 570
+978: 1.52e-01 -9.65e-01 1.19e+00
+3394: -1.39e-03 8.15e-03 -2.17e-02
+Time step 600
+978: 2.12e-01 -9.28e-01 1.26e+00
+3394: -1.77e-03 1.26e-02 -3.33e-02
+Time step 630
+978: 2.30e-01 -9.39e-01 1.32e+00
+3394: -2.06e-03 1.86e-02 -4.90e-02
+Time step 660
+978: 2.16e-01 -9.87e-01 1.38e+00
+3394: -2.10e-03 2.61e-02 -6.93e-02
+Time step 690
+978: 1.82e-01 -1.06e+00 1.43e+00
+3394: -1.74e-03 3.51e-02 -9.47e-02
+Time step 720
+978: 1.37e-01 -1.13e+00 1.48e+00
+3394: -7.59e-04 4.54e-02 -1.25e-01
+Time step 750
+978: 9.26e-02 -1.20e+00 1.51e+00
+3394: 1.07e-03 5.64e-02 -1.61e-01
+Time step 780
+978: 5.54e-02 -1.25e+00 1.54e+00
+3394: 3.97e-03 6.74e-02 -2.02e-01
+Time step 810
+978: 2.98e-02 -1.27e+00 1.55e+00
+3394: 8.13e-03 7.78e-02 -2.48e-01
+Time step 840
+978: 1.68e-02 -1.28e+00 1.56e+00
+3394: 1.37e-02 8.66e-02 -2.97e-01
+Time step 870
+978: 1.53e-02 -1.26e+00 1.57e+00
+3394: 2.06e-02 9.31e-02 -3.49e-01
+Time step 900
+978: 2.24e-02 -1.23e+00 1.57e+00
+3394: 2.88e-02 9.67e-02 -4.02e-01
+Time step 930
+978: 3.45e-02 -1.19e+00 1.58e+00
+3394: 3.80e-02 9.69e-02 -4.55e-01
+Time step 960
+978: 4.78e-02 -1.15e+00 1.59e+00
+3394: 4.77e-02 9.38e-02 -5.08e-01
+Time step 990
+978: 5.95e-02 -1.12e+00 1.60e+00
+3394: 5.73e-02 8.76e-02 -5.59e-01
+Time step 1020
+978: 6.75e-02 -1.10e+00 1.61e+00
+3394: 6.61e-02 7.90e-02 -6.07e-01
+Time step 1050
+978: 7.12e-02 -1.09e+00 1.62e+00
+3394: 7.34e-02 6.89e-02 -6.50e-01
+Time step 1080
+978: 7.07e-02 -1.09e+00 1.62e+00
+3394: 7.83e-02 5.86e-02 -6.90e-01
+Time step 1110
+978: 6.71e-02 -1.10e+00 1.62e+00
+3394: 8.02e-02 4.92e-02 -7.24e-01
+Time step 1140
+978: 6.19e-02 -1.11e+00 1.61e+00
+3394: 7.85e-02 4.20e-02 -7.52e-01
+Time step 1170
+978: 5.67e-02 -1.12e+00 1.60e+00
+3394: 7.28e-02 3.79e-02 -7.75e-01
+Time step 1200
+978: 5.29e-02 -1.14e+00 1.58e+00
+3394: 6.31e-02 3.76e-02 -7.91e-01
+Time step 1230
+978: 5.16e-02 -1.15e+00 1.56e+00
+3394: 4.95e-02 4.11e-02 -8.02e-01
+Time step 1260
+978: 5.33e-02 -1.16e+00 1.54e+00
+3394: 3.25e-02 4.84e-02 -8.06e-01
+Time step 1290
+978: 5.82e-02 -1.16e+00 1.53e+00
+3394: 1.28e-02 5.86e-02 -8.05e-01
+Time step 1320
+978: 6.59e-02 -1.17e+00 1.51e+00
+3394: -8.83e-03 7.08e-02 -7.98e-01
+Time step 1350
+978: 7.60e-02 -1.17e+00 1.50e+00
+3394: -3.15e-02 8.38e-02 -7.87e-01
+Time step 1380
+978: 8.76e-02 -1.17e+00 1.50e+00
+3394: -5.45e-02 9.63e-02 -7.73e-01
+Time step 1410
+978: 1.00e-01 -1.17e+00 1.50e+00
+3394: -7.69e-02 1.07e-01 -7.55e-01
+Time step 1440
+978: 1.12e-01 -1.17e+00 1.51e+00
+3394: -9.81e-02 1.15e-01 -7.37e-01
+Time step 1470
+978: 1.24e-01 -1.17e+00 1.53e+00
+3394: -1.18e-01 1.21e-01 -7.18e-01
+Time step 1500
+978: 1.35e-01 -1.17e+00 1.55e+00
+3394: -1.34e-01 1.23e-01 -6.99e-01
+Time step 1530
+978: 1.44e-01 -1.18e+00 1.57e+00
+3394: -1.48e-01 1.23e-01 -6.82e-01
+Time step 1560
+978: 1.52e-01 -1.18e+00 1.58e+00
+3394: -1.59e-01 1.20e-01 -6.68e-01
+Time step 1590
+978: 1.57e-01 -1.19e+00 1.59e+00
+3394: -1.66e-01 1.16e-01 -6.55e-01
+Time step 1620
+978: 1.60e-01 -1.19e+00 1.60e+00
+3394: -1.68e-01 1.12e-01 -6.45e-01
+Time step 1650
+978: 1.61e-01 -1.18e+00 1.60e+00
+3394: -1.66e-01 1.09e-01 -6.37e-01
+Time step 1680
+978: 1.60e-01 -1.18e+00 1.59e+00
+3394: -1.60e-01 1.06e-01 -6.30e-01
+Time step 1710
+978: 1.56e-01 -1.17e+00 1.57e+00
+3394: -1.51e-01 1.04e-01 -6.23e-01
+Time step 1740
+978: 1.50e-01 -1.16e+00 1.54e+00
+3394: -1.40e-01 1.03e-01 -6.16e-01
+Time step 1770
+978: 1.42e-01 -1.15e+00 1.51e+00
+3394: -1.27e-01 1.03e-01 -6.09e-01
+Time step 1800
+978: 1.32e-01 -1.13e+00 1.48e+00
+3394: -1.13e-01 1.03e-01 -6.02e-01
+Time step 1830
+978: 1.20e-01 -1.12e+00 1.44e+00
+3394: -9.95e-02 1.03e-01 -5.94e-01
+Time step 1860
+978: 1.08e-01 -1.12e+00 1.41e+00
+3394: -8.72e-02 1.02e-01 -5.85e-01
+Time step 1890
+978: 9.61e-02 -1.12e+00 1.38e+00
+3394: -7.64e-02 1.01e-01 -5.77e-01
+Time step 1920
+978: 8.47e-02 -1.12e+00 1.36e+00
+3394: -6.73e-02 9.97e-02 -5.70e-01
+Time step 1950
+978: 7.47e-02 -1.12e+00 1.34e+00
+3394: -5.99e-02 9.71e-02 -5.64e-01
+Time step 1980
+978: 6.68e-02 -1.13e+00 1.33e+00
+3394: -5.40e-02 9.35e-02 -5.59e-01
+Time step 2010
+978: 6.17e-02 -1.14e+00 1.32e+00
+3394: -4.91e-02 8.87e-02 -5.57e-01
+Time step 2040
+978: 5.98e-02 -1.15e+00 1.32e+00
+3394: -4.48e-02 8.26e-02 -5.57e-01
+Time step 2070
+978: 6.13e-02 -1.16e+00 1.33e+00
+3394: -4.06e-02 7.50e-02 -5.59e-01
+Time step 2100
+978: 6.63e-02 -1.17e+00 1.34e+00
+3394: -3.62e-02 6.61e-02 -5.63e-01
+Time step 2130
+978: 7.45e-02 -1.18e+00 1.36e+00
+3394: -3.13e-02 5.58e-02 -5.69e-01
+Time step 2160
+978: 8.55e-02 -1.18e+00 1.37e+00
+3394: -2.60e-02 4.46e-02 -5.77e-01
+Time step 2190
+978: 9.86e-02 -1.18e+00 1.39e+00
+3394: -2.06e-02 3.29e-02 -5.85e-01
+Time step 2220
+978: 1.13e-01 -1.18e+00 1.40e+00
+3394: -1.55e-02 2.15e-02 -5.94e-01
+Time step 2250
+978: 1.28e-01 -1.17e+00 1.42e+00
+3394: -1.13e-02 1.12e-02 -6.02e-01
+Time step 2280
+978: 1.42e-01 -1.16e+00 1.42e+00
+3394: -8.76e-03 2.84e-03 -6.09e-01
+Time step 2310
+978: 1.54e-01 -1.15e+00 1.43e+00
+3394: -8.40e-03 -2.71e-03 -6.14e-01
+Time step 2340
+978: 1.65e-01 -1.14e+00 1.43e+00
+3394: -1.06e-02 -4.92e-03 -6.17e-01
+Time step 2370
+978: 1.72e-01 -1.13e+00 1.43e+00
+3394: -1.55e-02 -3.49e-03 -6.19e-01
+Time step 2400
+978: 1.77e-01 -1.12e+00 1.43e+00
+3394: -2.28e-02 1.52e-03 -6.18e-01
+Time step 2430
+978: 1.78e-01 -1.11e+00 1.43e+00
+3394: -3.20e-02 9.67e-03 -6.16e-01
+Time step 2460
+978: 1.77e-01 -1.11e+00 1.42e+00
+3394: -4.23e-02 2.02e-02 -6.14e-01
+Time step 2490
+978: 1.73e-01 -1.11e+00 1.42e+00
+3394: -5.26e-02 3.23e-02 -6.12e-01
+Time step 2520
+978: 1.67e-01 -1.12e+00 1.41e+00
+3394: -6.19e-02 4.48e-02 -6.10e-01
+Time step 2550
+978: 1.60e-01 -1.12e+00 1.40e+00
+3394: -6.94e-02 5.68e-02 -6.09e-01
+Time step 2580
+978: 1.52e-01 -1.13e+00 1.39e+00
+3394: -7.45e-02 6.73e-02 -6.08e-01
+Time step 2610
+978: 1.45e-01 -1.14e+00 1.39e+00
+3394: -7.67e-02 7.59e-02 -6.07e-01
+Time step 2640
+978: 1.39e-01 -1.15e+00 1.38e+00
+3394: -7.62e-02 8.21e-02 -6.06e-01
+Time step 2670
+978: 1.34e-01 -1.15e+00 1.38e+00
+3394: -7.33e-02 8.59e-02 -6.04e-01
+Time step 2700
+978: 1.31e-01 -1.16e+00 1.38e+00
+3394: -6.85e-02 8.73e-02 -6.01e-01
+equake: 7294 nodes 35025 elems 2709 timesteps
+
+equake: Done. Terminating the simulation.
+exit 0
Added: test-suite/trunk/External/SPEC/CFP2000/183.equake/183.equake.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CFP2000/183.equake/183.equake.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CFP2000/183.equake/183.equake.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CFP2000/183.equake/183.equake.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,27 @@
+equake: Reading nodes.
+equake: Reading elements.
+equake: Reading sparse matrix structure.
+equake: Beginning simulation.
+
+CASE SUMMARY
+Fault information
+ Orientation: strike: 1.937315
+ dip: 0.767945
+ rake: 1.221730
+ dislocation: 29.640788 cm
+Hypocenter: (32.264153, 23.814432, -11.250000) Km
+Excitation characteristics
+ Time step: 0.002400 sec
+ Duration: 0.080000 sec
+ Rise time: 0.600000 sec
+
+The source is node 978 at (32.250000 24.364300 -11.200000)
+The epicenter is node 3394 at (32.250000 23.687500 0.000000)
+
+Time step 30
+978: 8.01e-03 7.19e-03 8.41e-03
+3394: -3.69e-21 1.57e-20 -5.20e-20
+equake: 7294 nodes 35025 elems 34 timesteps
+
+equake: Done. Terminating the simulation.
+exit 0
Added: test-suite/trunk/External/SPEC/CFP2000/188.ammp/188.ammp.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CFP2000/188.ammp/188.ammp.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CFP2000/188.ammp/188.ammp.reference_output (added)
+++ test-suite/trunk/External/SPEC/CFP2000/188.ammp/188.ammp.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,39 @@
+ echo off;
+ setf mxdq 0.75;
+ setf mmbox 10.;
+ setf temp 300;
+ seti numstp 125;
+ setf bbox 35.;
+ use none box bond angle hybrid torsion nonbon;
+ monitor;
+ 0.000000 unknown potential type
+ 1150.111683 bond energy
+ 2124.783269 angle energy
+ 61.513191 hybrid energy
+ 530.429281 torsion energy
+ -15696.510865 non-bonded energy
+ -11829.673440 total potential energy
+ 8575.179102 total kinetic energy
+ -3254.494338 total energy
+ 20404.852543 total action
+ echo off;
+ tpac numstp .00001 temp;
+ monitor;
+ 0.000000 unknown potential type
+ 1164.950258 bond energy
+ 2210.622502 angle energy
+ 69.050574 hybrid energy
+ 550.053375 torsion energy
+ -15837.193293 non-bonded energy
+ -11842.516585 total potential energy
+ 8578.818323 total kinetic energy
+ -3263.698262 total energy
+ 20421.334907 total action
+ use none tether;
+ analyze 0 1000000000;
+ RMSD 0.749207 Maximum Deviation 2.795623
+ RMSD after superposition 0.748811
+ 5378.481231 tether restraint energy
+ 5378.481231 total potential energy
+ exit;
+exit 0
Added: test-suite/trunk/External/SPEC/CFP2000/188.ammp/188.ammp.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CFP2000/188.ammp/188.ammp.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CFP2000/188.ammp/188.ammp.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CFP2000/188.ammp/188.ammp.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,40 @@
+echo off;
+ setf mxdq 0.75;
+ setf mmbox 10.;
+ setf temp 300;
+ seti numstp 10;
+ setf bbox 35.;
+ use none box bond angle hybrid torsion nonbon;
+ monitor;
+ 0.000000 unknown potential type
+ 1181.693079 bond energy
+ 2056.767980 angle energy
+ 61.501074 hybrid energy
+ 533.960821 torsion energy
+ -15410.005122 non-bonded energy
+ -11576.082168 total potential energy
+ 8584.512662 total kinetic energy
+ -2991.569506 total energy
+ 20160.594829 total action
+ echo off;
+ tpac numstp .00001 temp;
+ monitor;
+ 0.000000 unknown potential type
+ 1184.181101 bond energy
+ 2142.294444 angle energy
+ 58.175584 hybrid energy
+ 528.275613 torsion energy
+ -15510.199509 non-bonded energy
+ -11597.272767 total potential energy
+ 8562.611532 total kinetic energy
+ -3034.661236 total energy
+ 20159.884299 total action
+ echo off;
+ use none tether;
+ analyze 0 1000000000;
+ RMSD 0.000003 Maximum Deviation 0.000015
+ RMSD after superposition 0.000003
+ 0.000000 tether restraint energy
+ 0.000000 total potential energy
+ exit;
+exit 0
Added: test-suite/trunk/External/SPEC/CFP2006/433.milc/433.milc.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CFP2006/433.milc/433.milc.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CFP2006/433.milc/433.milc.reference_output (added)
+++ test-suite/trunk/External/SPEC/CFP2006/433.milc/433.milc.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,168 @@
+SU3 with improved KS action
+Microcanonical simulation with refreshing
+MIMD version 6
+Machine = Scalar processor, with 1 nodes
+R algorithm
+type 0 for no prompts or 1 for prompts
+nflavors 2
+nx 10
+ny 10
+nz 10
+nt 2
+iseed 1234
+LAYOUT = Hypercubes, options = EVENFIRST,
+Made lattice
+Made nn gathers
+Made 3nn gathers
+Finished setup
+
+
+warms 0
+trajecs 1
+traj_between_meas 1
+beta 5.6
+mass 0.125
+u0 1
+microcanonical_time_step 0.2
+steps_per_trajectory 5
+max_cg_iterations 100
+error_per_site 0.125
+error_for_propagator 0.125
+fresh
+forget
+unit gauge configuration loaded
+CHECK PLAQ: 3.000000e+00 3.000000e+00
+Unitarity checked. Max deviation 0.00e+00
+Symanzik 1x1 + 1x2 + 1x1x1 action
+loop coefficients: nloop rep loop_coeff multiplicity
+ 0 0 1.000000e+00 6
+ 1 0 -5.000000e-02 12
+ 2 0 0.000000e+00 16
+"O(a^2): couplings(pi)=0, Naik term, No O(a^2) errors, tadpole weights"
+path coefficients: npath path_coeff multiplicity
+ 0 6.250000e-01 8
+ 1 -4.166667e-02 8
+ 2 -6.250000e-02 48
+ 3 1.562500e-02 192
+ 4 -2.604167e-03 384
+ 5 -6.250000e-02 48
+WARMUPS COMPLETED
+PLAQ: 2.435823 2.546403
+P_LOOP: 2.332956e+00 -1.789245e-03
+G_LOOP: 0 0 4 2.435635e+00 ( 0 1 7 6 )
+G_LOOP: 0 1 4 2.446423e+00 ( 0 2 7 5 )
+G_LOOP: 0 2 4 2.548911e+00 ( 0 3 7 4 )
+G_LOOP: 0 3 4 2.425411e+00 ( 1 2 6 5 )
+G_LOOP: 0 4 4 2.540922e+00 ( 1 3 6 4 )
+G_LOOP: 0 5 4 2.549375e+00 ( 2 3 5 4 )
+G_LOOP: 1 0 6 1.967782e+00 ( 0 0 1 7 7 6 )
+G_LOOP: 1 1 6 1.995715e+00 ( 0 0 2 7 7 5 )
+G_LOOP: 1 2 6 2.265034e+00 ( 0 0 3 7 7 4 )
+G_LOOP: 1 3 6 1.961159e+00 ( 1 1 0 6 6 7 )
+G_LOOP: 1 4 6 1.933866e+00 ( 1 1 2 6 6 5 )
+G_LOOP: 1 5 6 2.263276e+00 ( 1 1 3 6 6 4 )
+G_LOOP: 1 6 6 1.978331e+00 ( 2 2 0 5 5 7 )
+G_LOOP: 1 7 6 1.944970e+00 ( 2 2 1 5 5 6 )
+G_LOOP: 1 8 6 2.269692e+00 ( 2 2 3 5 5 4 )
+G_LOOP: 1 9 6 2.319656e+00 ( 3 3 0 4 4 7 )
+G_LOOP: 1 10 6 2.312999e+00 ( 3 3 1 4 4 6 )
+G_LOOP: 1 11 6 2.320580e+00 ( 3 3 2 4 4 5 )
+G_LOOP: 2 0 6 1.994213e+00 ( 0 1 2 7 6 5 )
+G_LOOP: 2 1 6 1.969558e+00 ( 0 1 5 7 6 2 )
+G_LOOP: 2 2 6 2.007915e+00 ( 0 6 2 7 1 5 )
+G_LOOP: 2 3 6 1.979381e+00 ( 0 6 5 7 1 2 )
+G_LOOP: 2 4 6 2.147546e+00 ( 0 1 3 7 6 4 )
+G_LOOP: 2 5 6 2.119511e+00 ( 0 1 4 7 6 3 )
+G_LOOP: 2 6 6 2.123694e+00 ( 0 6 3 7 1 4 )
+G_LOOP: 2 7 6 2.129539e+00 ( 0 6 4 7 1 3 )
+G_LOOP: 2 8 6 2.133251e+00 ( 0 2 3 7 5 4 )
+G_LOOP: 2 9 6 2.129517e+00 ( 0 2 4 7 5 3 )
+G_LOOP: 2 10 6 2.140019e+00 ( 0 5 3 7 2 4 )
+G_LOOP: 2 11 6 2.138052e+00 ( 0 5 4 7 2 3 )
+G_LOOP: 2 12 6 2.118916e+00 ( 1 2 3 6 5 4 )
+G_LOOP: 2 13 6 2.123393e+00 ( 1 2 4 6 5 3 )
+G_LOOP: 2 14 6 2.130550e+00 ( 1 5 3 6 2 4 )
+G_LOOP: 2 15 6 2.116293e+00 ( 1 5 4 6 2 3 )
+GACTION: 2.529976e+00
+PBP: mass 1.250000e-01 5.751269e-02 1.293620e-01 ( 1 of 1 )
+FACTION: mass = 1.250000e-01, 1.496396e+00 ( 1 of 1 )
+RUNNING COMPLETED
+average cg iters for step= 3.000000e+00
+total_iters = 22
+
+
+warms 0
+trajecs 1
+traj_between_meas 1
+beta 5.6
+mass 0.0125
+u0 1
+microcanonical_time_step 0.01
+steps_per_trajectory 5
+max_cg_iterations 300
+error_per_site 1e-05
+error_for_propagator 1e-05
+continue
+forget
+CHECK PLAQ: 2.435823e+00 2.546403e+00
+Unitarity checked. Max deviation 4.44e-16
+Symanzik 1x1 + 1x2 + 1x1x1 action
+loop coefficients: nloop rep loop_coeff multiplicity
+ 0 0 1.000000e+00 6
+ 1 0 -5.000000e-02 12
+ 2 0 0.000000e+00 16
+"O(a^2): couplings(pi)=0, Naik term, No O(a^2) errors, tadpole weights"
+path coefficients: npath path_coeff multiplicity
+ 0 6.250000e-01 8
+ 1 -4.166667e-02 8
+ 2 -6.250000e-02 48
+ 3 1.562500e-02 192
+ 4 -2.604167e-03 384
+ 5 -6.250000e-02 48
+WARMUPS COMPLETED
+PLAQ: 2.413381 2.525394
+P_LOOP: 2.325341e+00 -2.229707e-03
+G_LOOP: 0 0 4 2.412537e+00 ( 0 1 7 6 )
+G_LOOP: 0 1 4 2.422399e+00 ( 0 2 7 5 )
+G_LOOP: 0 2 4 2.526935e+00 ( 0 3 7 4 )
+G_LOOP: 0 3 4 2.405207e+00 ( 1 2 6 5 )
+G_LOOP: 0 4 4 2.520967e+00 ( 1 3 6 4 )
+G_LOOP: 0 5 4 2.528278e+00 ( 2 3 5 4 )
+G_LOOP: 1 0 6 1.939992e+00 ( 0 0 1 7 7 6 )
+G_LOOP: 1 1 6 1.963163e+00 ( 0 0 2 7 7 5 )
+G_LOOP: 1 2 6 2.235391e+00 ( 0 0 3 7 7 4 )
+G_LOOP: 1 3 6 1.934454e+00 ( 1 1 0 6 6 7 )
+G_LOOP: 1 4 6 1.908238e+00 ( 1 1 2 6 6 5 )
+G_LOOP: 1 5 6 2.236067e+00 ( 1 1 3 6 6 4 )
+G_LOOP: 1 6 6 1.948923e+00 ( 2 2 0 5 5 7 )
+G_LOOP: 1 7 6 1.922172e+00 ( 2 2 1 5 5 6 )
+G_LOOP: 1 8 6 2.244963e+00 ( 2 2 3 5 5 4 )
+G_LOOP: 1 9 6 2.298324e+00 ( 3 3 0 4 4 7 )
+G_LOOP: 1 10 6 2.292208e+00 ( 3 3 1 4 4 6 )
+G_LOOP: 1 11 6 2.300443e+00 ( 3 3 2 4 4 5 )
+G_LOOP: 2 0 6 1.968372e+00 ( 0 1 2 7 6 5 )
+G_LOOP: 2 1 6 1.941478e+00 ( 0 1 5 7 6 2 )
+G_LOOP: 2 2 6 1.982965e+00 ( 0 6 2 7 1 5 )
+G_LOOP: 2 3 6 1.951153e+00 ( 0 6 5 7 1 2 )
+G_LOOP: 2 4 6 2.118013e+00 ( 0 1 3 7 6 4 )
+G_LOOP: 2 5 6 2.090952e+00 ( 0 1 4 7 6 3 )
+G_LOOP: 2 6 6 2.093512e+00 ( 0 6 3 7 1 4 )
+G_LOOP: 2 7 6 2.100660e+00 ( 0 6 4 7 1 3 )
+G_LOOP: 2 8 6 2.105093e+00 ( 0 2 3 7 5 4 )
+G_LOOP: 2 9 6 2.100326e+00 ( 0 2 4 7 5 3 )
+G_LOOP: 2 10 6 2.108553e+00 ( 0 5 3 7 2 4 )
+G_LOOP: 2 11 6 2.113047e+00 ( 0 5 4 7 2 3 )
+G_LOOP: 2 12 6 2.094016e+00 ( 1 2 3 6 5 4 )
+G_LOOP: 2 13 6 2.094695e+00 ( 1 2 4 6 5 3 )
+G_LOOP: 2 14 6 2.101503e+00 ( 1 5 3 6 2 4 )
+G_LOOP: 2 15 6 2.088289e+00 ( 1 5 4 6 2 3 )
+GACTION: 2.644893e+00
+PBP: mass 1.250000e-02 1.512271e-02 1.014454e-03 ( 1 of 1 )
+FACTION: mass = 1.250000e-02, 1.505881e+00 ( 1 of 1 )
+RUNNING COMPLETED
+average cg iters for step= 1.300000e+01
+total_iters = 100
+
+
+get_i: EOF on STDIN while expecting warms.
+exit 0
Added: test-suite/trunk/External/SPEC/CFP2006/444.namd/444.namd.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CFP2006/444.namd/444.namd.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CFP2006/444.namd/444.namd.reference_output (added)
+++ test-suite/trunk/External/SPEC/CFP2006/444.namd/444.namd.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,79 @@
+RESULTSET_BEGIN
+92224 1 0 0
+-355359.705797 0.000000 24229.348329
+229430.745102 5781.466932 -2454.694382
+5781.466932 226184.623759 -7867.535225
+-2454.694382 -7867.535225 252281.168869
+0.000000 0.000000 0.000000
+0.000000 0.000000 0.000000
+0.000000 0.000000 0.000000
+0.000000 -0.000000 0.000000 24.034240
+0.000000 0.000000 0.000000 0.000000
+0.000000 -0.000000 0.000000 24.034240
+RESULTSET_END
+RESULTSET_BEGIN
+92224 1 1 0
+-355359.705797 1175488.426964 24229.348329
+229430.745102 5781.466932 -2454.694382
+5781.466932 226184.623759 -7867.535225
+-2454.694382 -7867.535225 252281.168869
+5180.324284 277.843622 -1135.837232
+277.843622 2960.457709 -681.816292
+-1135.837232 -681.816292 4515.105462
+0.000000 -0.000000 0.000000 24.034240
+-0.000000 -0.000000 -0.000000 0.654402
+0.000000 -0.000000 0.000000 24.079992
+RESULTSET_END
+RESULTSET_BEGIN
+92224 1 1 1
+0.000000 820128.721167 24229.348329
+0.000000 0.000000 0.000000
+0.000000 0.000000 0.000000
+0.000000 0.000000 0.000000
+234611.069385 6059.310554 -3590.531615
+6059.310554 229145.081468 -8549.351518
+-3590.531615 -8549.351518 256796.274331
+0.000000 0.000000 0.000000 0.000000
+0.000000 -0.000000 0.000000 24.079992
+0.000000 -0.000000 0.000000 24.079992
+RESULTSET_END
+RESULTSET_BEGIN
+92224 0 0 0
+0.000000 0.000000 0.000000
+229430.745102 5781.466932 -2454.694382
+5781.466932 226184.623759 -7867.535225
+-2454.694382 -7867.535225 252281.168869
+0.000000 0.000000 0.000000
+0.000000 0.000000 0.000000
+0.000000 0.000000 0.000000
+0.000000 -0.000000 0.000000 24.034240
+0.000000 0.000000 0.000000 0.000000
+0.000000 -0.000000 0.000000 24.034240
+RESULTSET_END
+RESULTSET_BEGIN
+92224 0 1 0
+0.000000 0.000000 0.000000
+229430.745102 5781.466932 -2454.694382
+5781.466932 226184.623759 -7867.535225
+-2454.694382 -7867.535225 252281.168869
+5180.324284 277.843622 -1135.837232
+277.843622 2960.457709 -681.816292
+-1135.837232 -681.816292 4515.105462
+0.000000 -0.000000 0.000000 24.034240
+-0.000000 -0.000000 -0.000000 0.654402
+0.000000 -0.000000 0.000000 24.079992
+RESULTSET_END
+RESULTSET_BEGIN
+92224 0 1 1
+0.000000 0.000000 0.000000
+0.000000 0.000000 0.000000
+0.000000 0.000000 0.000000
+0.000000 0.000000 0.000000
+234611.069385 6059.310554 -3590.531615
+6059.310554 229145.081468 -8549.351518
+-3590.531615 -8549.351518 256796.274331
+0.000000 0.000000 0.000000 0.000000
+0.000000 -0.000000 0.000000 24.079992
+0.000000 -0.000000 0.000000 24.079992
+RESULTSET_END
+exit 0
Added: test-suite/trunk/External/SPEC/CFP2006/447.dealII/447.dealII.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CFP2006/447.dealII/447.dealII.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CFP2006/447.dealII/447.dealII.reference_output (added)
+++ test-suite/trunk/External/SPEC/CFP2006/447.dealII/447.dealII.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,38 @@
+Refinement cycle: 0
+ Number of degrees of freedom=79
+ Point value=0.111419
+ Estimated error=-0.0202358
+Refinement cycle: 1
+ Number of degrees of freedom=303
+ Point value=0.110124
+ Estimated error=-0.00791284
+Refinement cycle: 2
+ Number of degrees of freedom=457
+ Point value=0.1092
+ Estimated error=-0.00475766
+Refinement cycle: 3
+ Number of degrees of freedom=556
+ Point value=0.106639
+ Estimated error=-0.000775847
+Refinement cycle: 4
+ Number of degrees of freedom=713
+ Point value=0.107309
+ Estimated error=-0.0010652
+Refinement cycle: 5
+ Number of degrees of freedom=1119
+ Point value=0.107202
+ Estimated error=-0.000795717
+Refinement cycle: 6
+ Number of degrees of freedom=1580
+ Point value=0.106944
+ Estimated error=-0.000394584
+Refinement cycle: 7
+ Number of degrees of freedom=2262
+ Point value=0.106749
+ Estimated error=-0.000102753
+Refinement cycle: 8
+ Number of degrees of freedom=2820
+ Point value=0.106684
+ Estimated error=1.7076e-05
+
+exit 0
Added: test-suite/trunk/External/SPEC/CFP2006/447.dealII/447.dealII.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CFP2006/447.dealII/447.dealII.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CFP2006/447.dealII/447.dealII.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CFP2006/447.dealII/447.dealII.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,18 @@
+Refinement cycle: 0
+ Number of degrees of freedom=79
+ Point value=0.111419
+ Estimated error=-0.0202358
+Refinement cycle: 1
+ Number of degrees of freedom=303
+ Point value=0.110124
+ Estimated error=-0.00791284
+Refinement cycle: 2
+ Number of degrees of freedom=457
+ Point value=0.1092
+ Estimated error=-0.00475766
+Refinement cycle: 3
+ Number of degrees of freedom=556
+ Point value=0.106639
+ Estimated error=-0.000775847
+
+exit 0
Added: test-suite/trunk/External/SPEC/CFP2006/450.soplex/450.soplex.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CFP2006/450.soplex/450.soplex.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CFP2006/450.soplex/450.soplex.reference_output (added)
+++ test-suite/trunk/External/SPEC/CFP2006/450.soplex/450.soplex.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,46 @@
+Delta = 1.000000e-06
+Epsilon = 1.000000e-17
+Leaving algorithm
+Column representation
+Forest-Tomlin update
+Steep pricing
+Fast ratiotest
+No scaling
+General simplifier
+Weight starter
+loading LP file test.mps
+LP has 497 rows and
+ 614 columns
+solving LP
+SPxRem1SM: removed 23 row(s)
+SPxRem1SM: removed 65 column(s)
+SPxRem1SM: removed 33 row(s)
+SPxRem1SM: removed 8 column(s)
+SPxRem1SM: removed 8 row(s)
+SPxRem1SM: removed 4 column(s)
+SPxRem1SM: removed 2 row(s)
+SPxRem1SM: removed 2 column(s)
+SPxAggregateSM: removed 25 row(s) and column(s)
+SPxAggregateSM: delta = 7.914284e+03
+SPxRedundantSM: removed 3 column(s)
+SPxRedundantSM: removed 13 row(s)
+SPxRem1SM: removed 7 row(s)
+SPxRem1SM: removed 5 column(s)
+SPxAggregateSM: removed 1 row(s) and column(s)
+SPxAggregateSM: delta = 7.914284e+03
+SPxRedundantSM: removed 7 column(s)
+SPxRem1SM: removed 9 row(s)
+SPxRem1SM: removed 3 column(s)
+SPxAggregateSM: removed 1 row(s) and column(s)
+SPxAggregateSM: delta = 7.914284e+03
+SPxRedundantSM: removed 1 column(s)
+SPxRem1SM: removed 6 row(s)
+SPxRem1SM: removed 3 column(s)
+removed 128 rows
+removed 128 columns
+Finished solving (status=1Total iters=386; Iterations by algorithm type: leave=308, enter=78
+, objValue=1.464410e+05)
+Factorizations: 42
+solution value is: 1.4644102e+05
+
+exit 0
Added: test-suite/trunk/External/SPEC/CFP2006/470.lbm/470.lbm.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CFP2006/470.lbm/470.lbm.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CFP2006/470.lbm/470.lbm.reference_output (added)
+++ test-suite/trunk/External/SPEC/CFP2006/470.lbm/470.lbm.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,19 @@
+MAIN_printInfo:
+ grid size : 100 x 100 x 130 = 1.30 * 10^6 Cells
+ nTimeSteps : 20
+ result file : reference.dat
+ action : nothing
+ simulation type: channel flow
+ obstacle file : 100_100_130_cf_a.of
+
+LBM_showGridStatistics:
+ nObstacleCells: 498440 nAccelCells: 0 nFluidCells: 801560
+ minRho: 1.0000 maxRho: 1.0000 mass: 1.300000e+06
+ minU: 0.000000e+00 maxU: 0.000000e+00
+
+LBM_showGridStatistics:
+ nObstacleCells: 498440 nAccelCells: 0 nFluidCells: 801560
+ minRho: 1.0000 maxRho: 1.0431 mass: 1.300963e+06
+ minU: 0.000000e+00 maxU: 1.272361e-02
+
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2000/164.gzip/164.gzip.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/164.gzip/164.gzip.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/164.gzip/164.gzip.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2000/164.gzip/164.gzip.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,34 @@
+spec_init
+Loading Input Data
+Duplicating 3121844 bytes
+Duplicating 6243688 bytes
+Duplicating 12487376 bytes
+Duplicating 8579680 bytes
+Input data 33554432 bytes in length
+Compressing Input Data, level 1
+Compressed data 26375537 bytes in length
+Uncompressing Data
+Uncompressed data 33554432 bytes in length
+Uncompressed data compared correctly
+Compressing Input Data, level 3
+Compressed data 26140790 bytes in length
+Uncompressing Data
+Uncompressed data 33554432 bytes in length
+Uncompressed data compared correctly
+Compressing Input Data, level 5
+Compressed data 25828152 bytes in length
+Uncompressing Data
+Uncompressed data 33554432 bytes in length
+Uncompressed data compared correctly
+Compressing Input Data, level 7
+Compressed data 25782493 bytes in length
+Uncompressing Data
+Uncompressed data 33554432 bytes in length
+Uncompressed data compared correctly
+Compressing Input Data, level 9
+Compressed data 25773173 bytes in length
+Uncompressing Data
+Uncompressed data 33554432 bytes in length
+Uncompressed data compared correctly
+Tested 32MB buffer: OK!
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2000/164.gzip/164.gzip.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/164.gzip/164.gzip.reference_output.small?rev=105213&view=auto
==============================================================================
(empty)
Added: test-suite/trunk/External/SPEC/CINT2000/175.vpr/175.vpr.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/175.vpr/175.vpr.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/175.vpr/175.vpr.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2000/175.vpr/175.vpr.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,46 @@
+Initial placement cost = 786
+
+Cost recomputed from scratch is .
+Final Placement cost:
+
+
+VPR FPGA Placement and Routing Program Version 4.00-spec
+Source completed August 19, 1997.
+
+
+General Options:
+ The circuit will be placed but not routed.
+
+Placer Options:
+ User annealing schedule selected with:
+ Initial Temperature: 5
+ Exit (Final) Temperature: 0.005
+ Temperature Reduction factor (alpha_t): 0.9412
+ Number of moves in the inner loop is (num_blocks)^4/3 * 2
+ Placement cost type is linear congestion.
+ Placement will be performed once.
+ Placement channel width factor = 100.
+ Exponent used in placement cost: 1
+ Initial random seed: 1
+
+Reading the FPGA architectural description from arch.in.
+Successfully read arch.in.
+Pins per clb: 6. Pads per row/column: 2.
+Subblocks per clb: 1. Subblock LUT size: 4.
+Fc value is fraction of tracks in a channel.
+Fc_output: 1. Fc_input: 1. Fc_pad: 1.
+Switch block type: Subset.
+Distinct types of segments: 3.
+Distinct types of user-specified switches: 3.
+
+Reading the circuit netlist from net.in.
+Successfully read net.in.
+1826 blocks, 1791 nets, 0 global nets.
+1750 clbs, 41 inputs, 35 outputs.
+The circuit will be mapped into a 42 x 42 array of clbs.
+
+
+Completed placement consistency check successfully.
+
+Total moves attempted: 5131990.0
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2000/175.vpr/175.vpr.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/175.vpr/175.vpr.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/175.vpr/175.vpr.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CINT2000/175.vpr/175.vpr.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,46 @@
+Initial placement cost = 74
+
+Cost recomputed from scratch is .
+Final Placement cost:
+
+
+VPR FPGA Placement and Routing Program Version 4.00-spec
+Source completed August 19, 1997.
+
+
+General Options:
+ The circuit will be placed but not routed.
+
+Placer Options:
+ User annealing schedule selected with:
+ Initial Temperature: 5
+ Exit (Final) Temperature: 0.005
+ Temperature Reduction factor (alpha_t): 0.9412
+ Number of moves in the inner loop is (num_blocks)^4/3 * 2
+ Placement cost type is linear congestion.
+ Placement will be performed once.
+ Placement channel width factor = 100.
+ Exponent used in placement cost: 1
+ Initial random seed: 1
+
+Reading the FPGA architectural description from arch.in.
+Successfully read arch.in.
+Pins per clb: 6. Pads per row/column: 2.
+Subblocks per clb: 1. Subblock LUT size: 4.
+Fc value is fraction of tracks in a channel.
+Fc_output: 1. Fc_input: 1. Fc_pad: 1.
+Switch block type: Subset.
+Distinct types of segments: 3.
+Distinct types of user-specified switches: 3.
+
+Reading the circuit netlist from net.in.
+Successfully read net.in.
+404 blocks, 339 nets, 0 global nets.
+274 clbs, 65 inputs, 65 outputs.
+The circuit will be mapped into a 17 x 17 array of clbs.
+
+
+Completed placement consistency check successfully.
+
+Total moves attempted: 686665.0
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2000/176.gcc/176.gcc.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/176.gcc/176.gcc.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/176.gcc/176.gcc.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2000/176.gcc/176.gcc.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1 @@
+502a096bd760446b26060864989b7014
Added: test-suite/trunk/External/SPEC/CINT2000/176.gcc/176.gcc.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/176.gcc/176.gcc.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/176.gcc/176.gcc.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CINT2000/176.gcc/176.gcc.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1 @@
+0b8d5d7b009ccbc2cc0f97894c4e0f90
Added: test-suite/trunk/External/SPEC/CINT2000/181.mcf/181.mcf.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/181.mcf/181.mcf.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/181.mcf/181.mcf.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2000/181.mcf/181.mcf.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,7049 @@
+
+MCF SPEC version 1.6.I
+by Andreas Loebel
+Copyright (c) 1998,1999 ZIB Berlin
+All Rights Reserved.
+
+nodes : 5985
+active arcs : 102404
+simplex iterations : 62844
+flow value : 3180065918
+new implicit arcs : 300000
+active arcs : 402404
+simplex iterations : 65365
+flow value : 2220062533
+new implicit arcs : 300000
+active arcs : 702404
+simplex iterations : 84377
+flow value : 2060057267
+new implicit arcs : 300000
+active arcs : 1002404
+simplex iterations : 99840
+flow value : 2060055975
+new implicit arcs : 231551
+active arcs : 1233955
+simplex iterations : 104565
+flow value : 2060055866
+new implicit arcs : 88
+active arcs : 1234043
+simplex iterations : 104567
+flow value : 2060055866
+checksum : 25986180
+optimal
+exit 0
+()
+953
+1347
+1708
+2007
+2351
+2671
+3126
+3582
+4086
+4507
+4912
+5183
+5337
+5417
+5510
+5585
+5676
+5745
+()
+945
+1321
+1585
+1783
+2035
+2248
+2507
+2734
+3077
+3372
+3720
+4083
+4420
+4715
+4974
+5158
+5288
+5405
+5520
+5617
+5735
+5831
+5916
+()
+913
+1231
+***
+1967
+2041
+2151
+2223
+2340
+2411
+2535
+2610
+2729
+2820
+***
+3257
+3407
+3641
+3830
+4057
+4230
+4445
+4601
+()
+911
+1443
+1840
+2181
+2618
+2787
+3286
+3900
+4147
+4666
+4959
+5149
+5357
+5525
+()
+898
+***
+2740
+***
+3602
+3837
+4140
+4375
+4635
+4835
+5045
+5173
+5286
+5412
+5517
+5630
+5736
+5839
+5917
+()
+875
+1222
+1491
+1698
+1901
+2110
+2318
+2533
+2760
+3053
+3315
+***
+4239
+4442
+4618
+4778
+4930
+()
+873
+1088
+***
+1653
+1895
+2481
+2751
+***
+3419
+4001
+4550
+()
+851
+1395
+1760
+2093
+2448
+2835
+3328
+3836
+4339
+4790
+()
+837
+1061
+1527
+***
+3677
+3965
+***
+4452
+()
+833
+***
+2910
+3112
+3314
+3615
+3894
+4224
+()
+831
+1078
+1283
+1465
+1607
+1749
+1872
+2017
+2147
+2298
+2430
+2590
+2726
+2917
+3108
+3321
+3514
+3731
+3932
+4143
+4325
+4527
+4685
+4857
+4994
+5121
+5221
+5314
+5404
+5485
+5572
+5650
+***
+5877
+()
+807
+1239
+***
+4264
+4591
+4718
+4950
+5132
+5252
+5345
+***
+5827
+()
+796
+1174
+1479
+1715
+1941
+2168
+2405
+2652
+2936
+3269
+3619
+3961
+()
+791
+1181
+1576
+1806
+2120
+2360
+***
+2954
+***
+3757
+3948
+4164
+4344
+4544
+()
+781
+1166
+***
+3020
+***
+3672
+3893
+4091
+4291
+4467
+4659
+4777
+()
+780
+1128
+3024
+3194
+3426
+3611
+3835
+4026
+4240
+4410
+***
+4972
+***
+5620
+5769
+()
+775
+1134
+1456
+1673
+1816
+1997
+2188
+2370
+2655
+2929
+3277
+3610
+3943
+4249
+4580
+4817
+()
+774
+1043
+1357
+***
+1919
+2169
+2784
+3140
+3517
+3888
+4266
+4595
+5174
+5328
+5666
+5770
+5875
+()
+763
+1182
+***
+2733
+3173
+3668
+4133
+4581
+4945
+5233
+()
+759
+***
+4764
+5144
+5344
+5501
+5677
+5822
+()
+756
+1172
+1551
+1800
+2095
+2355
+2674
+3002
+3439
+3821
+4258
+()
+748
+978
+***
+1897
+1992
+2127
+2227
+2357
+2465
+2605
+2714
+2877
+3041
+3261
+3384
+3524
+3687
+3798
+***
+4415
+4658
+4923
+()
+737
+956
+***
+2531
+***
+2872
+3064
+3217
+3556
+3912
+4227
+4559
+4886
+5139
+5332
+5514
+5667
+5832
+()
+724
+***
+1352
+1629
+2197
+2450
+***
+3176
+3340
+3716
+4092
+4449
+4769
+5275
+5388
+()
+723
+1213
+1529
+1822
+2076
+2376
+2653
+3034
+3526
+3797
+4093
+4355
+4736
+()
+707
+1221
+1614
+1922
+2249
+2576
+2988
+3448
+3945
+4391
+4801
+5112
+()
+691
+1241
+1647
+1974
+2333
+2694
+3166
+3676
+4182
+()
+685
+798
+***
+1259
+1579
+1818
+2369
+2951
+3332
+4177
+4533
+5134
+5294
+5659
+5792
+5905
+()
+683
+926
+1202
+1410
+1643
+1839
+1998
+2211
+2368
+2592
+***
+3348
+3804
+4175
+4586
+4890
+5162
+***
+5544
+5648
+5710
+5805
+5863
+5926
+()
+681
+***
+1447
+1652
+1826
+***
+3516
+3858
+4226
+4462
+4771
+4995
+()
+679
+1163
+***
+3010
+3187
+3356
+3684
+4050
+4358
+4671
+()
+678
+1023
+1387
+()
+676
+941
+***
+3415
+3675
+4131
+4468
+4850
+5089
+5265
+5396
+()
+673
+***
+2908
+()
+670
+***
+1262
+***
+2962
+3268
+***
+3933
+4331
+***
+5014
+()
+666
+1092
+1857
+2116
+2761
+2968
+3564
+3775
+4367
+4562
+()
+665
+1050
+1515
+1820
+2165
+2478
+2859
+3298
+3803
+4251
+4697
+5035
+5199
+()
+655
+1281
+1763
+2146
+2602
+3101
+3742
+4306
+4871
+5231
+5456
+5634
+5828
+()
+654
+1018
+***
+2541
+3212
+3609
+4427
+4760
+()
+642
+1098
+1464
+1765
+2064
+2354
+2626
+2940
+3326
+3707
+4141
+4498
+4859
+()
+637
+893
+1158
+1390
+1569
+1730
+1933
+2088
+2299
+***
+3491
+3853
+4166
+4506
+4780
+5032
+5235
+5369
+5471
+5591
+5691
+5804
+5888
+()
+629
+***
+1279
+***
+2082
+2295
+***
+2987
+3145
+3322
+3485
+3696
+3868
+4082
+4234
+4432
+4575
+4759
+4880
+5002
+5097
+5197
+5278
+5368
+5426
+5505
+5562
+5645
+5701
+5774
+5830
+5894
+()
+628
+1016
+1739
+1980
+2580
+2868
+***
+3750
+4025
+4170
+***
+4922
+()
+623
+1154
+1557
+1877
+2200
+2539
+2904
+3383
+3863
+4335
+4744
+5084
+()
+618
+1169
+1601
+1935
+2286
+2644
+3099
+3606
+4110
+4590
+()
+617
+1015
+1448
+1713
+2001
+2258
+2569
+2865
+3296
+3682
+4123
+4541
+4820
+()
+614
+839
+1133
+1364
+1546
+1750
+1908
+2115
+2279
+2497
+***
+2927
+3299
+3782
+3984
+4191
+4374
+4563
+4837
+***
+5131
+5298
+5400
+5473
+5564
+5637
+5728
+5797
+()
+611
+861
+1233
+***
+2928
+3071
+3264
+3396
+3530
+3662
+***
+4218
+4409
+4542
+4799
+5022
+5146
+5285
+()
+610
+***
+1091
+1430
+1755
+1986
+2307
+2554
+***
+3260
+3495
+3673
+3908
+4084
+4371
+4530
+4727
+4867
+5024
+5159
+***
+5673
+5819
+()
+609
+1255
+1468
+1813
+2198
+2562
+3076
+3323
+3907
+***
+4592
+()
+605
+789
+1040
+1244
+***
+3318
+3565
+3871
+4111
+4393
+4610
+4856
+5025
+5186
+***
+5914
+()
+598
+754
+980
+1148
+1355
+1481
+1627
+1723
+1861
+1960
+2094
+2203
+2339
+2452
+2600
+2708
+2875
+3040
+3231
+3378
+3593
+3746
+3960
+4101
+4299
+4439
+4624
+4753
+4899
+()
+597
+***
+1072
+***
+1553
+1777
+***
+3873
+***
+4322
+()
+595
+1044
+1389
+1641
+1863
+2085
+2323
+2565
+2826
+3155
+3499
+3818
+4184
+4481
+4781
+()
+592
+797
+()
+591
+734
+904
+1073
+1252
+1380
+1499
+1609
+1734
+1836
+1962
+2059
+2192
+2292
+2424
+2536
+2673
+2795
+2976
+3114
+3302
+3452
+3612
+3766
+3919
+4073
+4223
+4363
+4509
+()
+590
+1025
+***
+2956
+***
+3834
+***
+5154
+5260
+5333
+5424
+5521
+5594
+5655
+5753
+5814
+5896
+()
+588
+929
+1267
+1573
+***
+2919
+***
+3561
+()
+586
+1052
+1422
+1733
+1981
+2282
+2551
+2895
+3267
+3709
+4225
+4623
+()
+583
+983
+1420
+1695
+1973
+2243
+2547
+2841
+3256
+3652
+4088
+4451
+4807
+5079
+***
+5801
+()
+579
+809
+1011
+1268
+1472
+1638
+1754
+1905
+2025
+2183
+2304
+2466
+2594
+2770
+2935
+3158
+3333
+3569
+3743
+3986
+4154
+***
+4743
+()
+578
+***
+1175
+1293
+***
+2863
+3021
+3225
+3422
+3647
+3839
+4060
+4243
+4441
+4611
+()
+577
+1139
+1577
+1914
+2256
+2622
+3070
+3571
+4085
+4555
+4966
+5269
+5460
+5609
+5785
+5909
+()
+573
+721
+***
+1382
+1671
+2226
+2503
+3350
+3740
+4552
+4870
+5323
+5467
+()
+570
+1069
+1513
+1829
+2155
+2482
+***
+3823
+***
+4360
+4626
+4883
+5081
+5207
+5299
+()
+569
+817
+1080
+1341
+1514
+***
+1913
+2097
+***
+2901
+***
+3466
+***
+4529
+4833
+5135
+()
+567
+694
+844
+***
+2777
+3028
+3290
+3570
+3838
+4112
+4369
+4615
+4839
+5029
+5185
+5317
+5419
+5532
+5638
+5746
+5861
+()
+562
+***
+1114
+1245
+1381
+1474
+1590
+1668
+1769
+1845
+1948
+2022
+2133
+2216
+2320
+2397
+2509
+2593
+2713
+2808
+***
+3273
+3623
+3998
+4293
+4625
+4889
+5109
+()
+561
+752
+1315
+***
+2566
+2802
+3031
+3248
+3502
+3735
+3989
+4209
+4435
+4647
+4838
+5049
+5178
+5318
+5410
+5487
+5579
+5654
+5739
+5812
+5887
+()
+560
+857
+1220
+1530
+1742
+1979
+2199
+2449
+2682
+3003
+3342
+3645
+3972
+4254
+4548
+4816
+5039
+()
+556
+939
+***
+3237
+3543
+3857
+4158
+4448
+4706
+4947
+5166
+5290
+5418
+5519
+5640
+5737
+5846
+()
+549
+***
+1066
+()
+548
+753
+916
+1149
+1313
+1477
+1594
+1725
+1827
+1963
+2060
+2204
+2311
+2453
+2558
+2707
+2837
+3035
+3177
+3375
+3544
+3748
+3899
+4109
+4255
+4443
+4571
+4752
+4878
+5013
+()
+547
+1093
+1547
+1881
+2238
+2599
+3038
+3538
+4049
+***
+4919
+***
+5363
+5469
+5639
+5738
+5849
+5919
+()
+546
+1248
+1691
+2121
+2526
+3072
+3634
+4286
+4789
+***
+5923
+()
+545
+778
+1048
+1294
+1498
+***
+2891
+3118
+3363
+3605
+3842
+4079
+4310
+4526
+()
+543
+718
+961
+1167
+1439
+***
+2856
+3153
+***
+3843
+3964
+4261
+***
+4768
+()
+542
+884
+***
+2944
+3121
+3291
+***
+4155
+4453
+()
+541
+887
+()
+540
+***
+970
+***
+2747
+3022
+***
+4124
+4318
+***
+4868
+5212
+5401
+5557
+5733
+5871
+()
+539
+949
+1386
+1682
+1949
+2224
+2519
+2818
+3214
+3616
+4034
+4423
+4784
+5064
+5274
+5458
+5615
+5784
+5920
+()
+538
+1003
+***
+2897
+3236
+3578
+()
+537
+795
+1079
+()
+536
+896
+1270
+***
+3263
+3522
+3917
+4329
+4710
+5001
+5209
+()
+529
+936
+1683
+1934
+2522
+2712
+3069
+3429
+3686
+3918
+4052
+4302
+4649
+4936
+5099
+5171
+()
+528
+686
+838
+1017
+1187
+1343
+1459
+1581
+***
+2572
+2825
+***
+3447
+3815
+4196
+4535
+4847
+5091
+()
+527
+***
+1144
+1299
+1418
+1519
+1616
+1709
+1798
+1882
+1975
+2067
+2161
+2254
+2350
+2442
+2540
+2643
+2743
+2860
+2997
+3221
+3346
+3496
+3617
+3722
+3874
+4041
+4162
+4269
+()
+526
+674
+825
+994
+1179
+1325
+1450
+1566
+***
+2281
+2436
+2570
+2732
+2893
+3119
+()
+525
+856
+1253
+1528
+1762
+1984
+2219
+2451
+2702
+3006
+3341
+***
+4063
+***
+4653
+4875
+()
+524
+910
+1312
+***
+3325
+3598
+3974
+4556
+4641
+5027
+5439
+5531
+5680
+5693
+5884
+()
+523
+925
+1377
+1702
+1982
+2239
+2505
+***
+3308
+3461
+3778
+4105
+4413
+4693
+4921
+()
+522
+***
+1024
+1108
+***
+2931
+3084
+3195
+3364
+3482
+3630
+3734
+3905
+***
+4395
+()
+520
+***
+1119
+***
+2947
+3120
+3275
+3464
+3628
+3832
+4006
+4208
+4368
+4558
+4689
+4832
+4952
+()
+516
+1053
+1517
+1867
+2215
+2573
+2998
+3508
+4024
+4493
+4913
+()
+515
+***
+1453
+1717
+2290
+2550
+***
+3238
+3614
+4002
+4349
+()
+514
+868
+1361
+1631
+1937
+2175
+2499
+2758
+3182
+3554
+4019
+4357
+4763
+5019
+()
+512
+624
+802
+996
+***
+2892
+3181
+3425
+3627
+()
+511
+747
+1002
+1274
+1463
+***
+2913
+3150
+***
+3683
+4098
+4508
+()
+510
+808
+()
+508
+776
+1087
+1362
+1570
+1744
+1931
+2111
+2297
+2487
+2691
+2915
+3192
+3446
+3728
+4003
+4272
+4512
+4754
+4953
+()
+506
+657
+862
+1031
+1265
+1396
+1549
+1661
+1789
+1890
+2033
+2129
+2270
+2378
+2524
+2633
+2796
+2937
+3135
+3274
+3488
+3644
+3848
+4013
+4201
+4354
+4538
+4663
+4830
+4940
+5075
+()
+504
+656
+800
+975
+1151
+1318
+1436
+1554
+1664
+1782
+1874
+2003
+2107
+2240
+2341
+2477
+2586
+2723
+2847
+3039
+3180
+3337
+3486
+3649
+3793
+3959
+4104
+4257
+4396
+4537
+()
+500
+701
+858
+1102
+1258
+1435
+1548
+1693
+1788
+1928
+2032
+2167
+2268
+2413
+2527
+2678
+2790
+2985
+3138
+3334
+3487
+3694
+3851
+4061
+4204
+4399
+4539
+4705
+4827
+4979
+()
+499
+740
+***
+3059
+()
+498
+782
+1077
+1365
+1561
+1748
+1925
+2114
+2293
+2498
+2688
+2921
+3186
+3462
+3715
+4007
+4259
+4518
+4747
+4956
+5116
+5241
+5331
+5422
+5503
+5588
+5668
+5751
+()
+497
+1045
+1571
+1906
+2325
+2484
+2885
+3465
+4039
+()
+495
+***
+1830
+2073
+2681
+3005
+()
+494
+855
+***
+3029
+3205
+3327
+()
+492
+760
+1055
+***
+2773
+3033
+3301
+3574
+3844
+4119
+4376
+4617
+4846
+5034
+5175
+5302
+5435
+5548
+5653
+5760
+5848
+()
+488
+746
+***
+2561
+***
+3068
+3408
+3878
+4228
+4643
+4924
+5196
+5364
+5493
+5642
+5764
+5893
+()
+486
+1010
+1501
+1842
+2190
+2545
+2974
+3471
+3983
+4472
+4896
+()
+484
+690
+885
+1109
+1291
+***
+2836
+3201
+3595
+3992
+4400
+4766
+5038
+()
+483
+705
+967
+1232
+***
+1987
+2083
+2220
+2322
+2456
+2564
+2705
+2828
+()
+479
+***
+1301
+1417
+1518
+1621
+1711
+1797
+1880
+1972
+2065
+2160
+2252
+2345
+2444
+2543
+2647
+2737
+2857
+2999
+3128
+3258
+3391
+3537
+3670
+3811
+3956
+4090
+4212
+4342
+4469
+4587
+4701
+4813
+4909
+5010
+5086
+5160
+5225
+5289
+***
+5910
+()
+475
+***
+1026
+1276
+1808
+1907
+2014
+2081
+2207
+2229
+2264
+2365
+2486
+2563
+***
+2883
+3189
+3557
+4179
+4387
+***
+5047
+5155
+5257
+5322
+5378
+5438
+5491
+()
+474
+880
+1338
+1597
+1810
+2044
+2276
+2518
+2765
+3089
+3412
+3770
+4099
+4433
+4728
+4991
+()
+472
+772
+***
+3285
+3589
+3753
+***
+4288
+4593
+()
+470
+788
+1191
+1476
+1697
+1910
+2092
+2278
+2583
+2821
+***
+3455
+3699
+4010
+4237
+4515
+4730
+4951
+5101
+()
+465
+***
+973
+1236
+***
+3056
+3352
+3618
+3810
+3971
+***
+4876
+()
+462
+***
+1117
+1280
+1428
+1587
+1719
+1852
+1953
+2077
+2179
+2313
+2420
+2556
+2663
+2814
+***
+4353
+4599
+4938
+5195
+5377
+5554
+5711
+5869
+***
+5961
+()
+460
+653
+806
+1034
+1208
+1394
+1508
+1662
+1764
+1891
+1990
+2134
+2242
+2375
+2490
+2634
+2750
+2939
+3083
+3279
+3438
+3642
+3787
+4009
+4156
+4352
+4483
+4665
+4793
+4937
+()
+459
+601
+804
+968
+1215
+1354
+1505
+1630
+1761
+1859
+1988
+2100
+2237
+2338
+2493
+2604
+2748
+2878
+3081
+3228
+3433
+3590
+3789
+3957
+4160
+4304
+4490
+4620
+4791
+4900
+5044
+()
+458
+895
+1316
+1645
+1893
+2194
+2454
+2780
+3139
+3579
+4037
+4350
+()
+457
+602
+757
+919
+1106
+1257
+1392
+1507
+***
+2842
+()
+456
+***
+1032
+1214
+1378
+***
+2823
+3055
+***
+3597
+()
+455
+842
+1317
+***
+3198
+3428
+***
+4194
+4392
+***
+4863
+5104
+5301
+()
+454
+773
+1171
+1460
+1591
+1746
+1856
+2013
+2132
+2291
+2409
+2581
+2710
+2911
+3080
+3316
+3661
+4016
+4333
+4640
+4907
+()
+453
+974
+1473
+1825
+2162
+2523
+2932
+3436
+3954
+4431
+()
+449
+730
+***
+1249
+1466
+***
+2799
+3088
+3463
+3824
+4292
+4525
+4929
+()
+447
+908
+1308
+1654
+1888
+2201
+2439
+2786
+3133
+3586
+3952
+4390
+4702
+5040
+5248
+5384
+5511
+()
+446
+735
+***
+2845
+3052
+3243
+3458
+3664
+3958
+***
+4732
+4962
+5103
+5258
+5350
+5434
+5522
+5601
+5689
+5762
+5840
+()
+445
+829
+1307
+1605
+1886
+2148
+2447
+2725
+3130
+3511
+3955
+4320
+4696
+4996
+***
+5566
+***
+5806
+5907
+()
+444
+906
+1408
+1740
+2063
+2385
+***
+3388
+3736
+4100
+4660
+4860
+5230
+5516
+()
+442
+596
+***
+999
+1290
+***
+3345
+3509
+3658
+3814
+3975
+4125
+4270
+4416
+4551
+4680
+4798
+4943
+5043
+5142
+5219
+5270
+5343
+5390
+5459
+5547
+5623
+5712
+5783
+5859
+5915
+5950
+()
+439
+***
+991
+1326
+1562
+1768
+1965
+2176
+2392
+2612
+2848
+3151
+3418
+***
+4849
+5057
+5259
+5444
+5602
+5767
+5900
+()
+437
+***
+988
+***
+2275
+2496
+***
+3007
+3116
+3295
+***
+3783
+()
+436
+463
+762
+1104
+***
+2830
+3063
+3294
+3531
+3774
+4020
+4244
+4464
+4674
+4861
+()
+433
+850
+1284
+1620
+1870
+2163
+2429
+2741
+3104
+3536
+3931
+4343
+4684
+5004
+5217
+()
+432
+645
+***
+1112
+1405
+1635
+1834
+2040
+2246
+2459
+2684
+2953
+3210
+3390
+3515
+3703
+3860
+4169
+***
+4654
+()
+431
+***
+1051
+1328
+1563
+1770
+1966
+2177
+2388
+2613
+2844
+3148
+3457
+3718
+3914
+4120
+4313
+4447
+4721
+4949
+5092
+5232
+***
+5880
+()
+429
+***
+1064
+1373
+1637
+1846
+2080
+2306
+2532
+2762
+***
+3293
+3504
+***
+4107
+***
+4987
+()
+426
+847
+1269
+1618
+***
+2975
+3307
+3646
+3977
+4283
+4606
+4865
+()
+425
+1105
+1603
+2030
+2426
+2941
+3500
+4152
+4677
+5129
+5352
+5567
+5742
+5911
+()
+423
+749
+1304
+1651
+1976
+2284
+2638
+3037
+3539
+3994
+4466
+4845
+5062
+5246
+()
+422
+933
+1452
+1795
+2144
+2500
+2894
+3393
+3910
+4411
+4841
+5220
+5387
+5570
+5718
+()
+421
+751
+1127
+()
+419
+742
+1186
+1543
+1775
+1994
+2230
+2463
+2715
+3023
+***
+3850
+4059
+()
+418
+***
+985
+1298
+1565
+1753
+1911
+2090
+2280
+2468
+2728
+3036
+3373
+***
+4135
+()
+413
+***
+1046
+1345
+1550
+1737
+1916
+2096
+2277
+2469
+2668
+***
+3416
+3581
+3723
+3891
+4044
+4190
+4332
+4477
+4633
+4788
+4901
+5033
+5115
+5213
+5283
+5334
+5402
+()
+411
+***
+977
+1351
+1580
+***
+2965
+()
+409
+720
+1097
+1426
+1675
+1892
+2123
+2356
+2603
+2869
+3202
+3548
+3941
+4221
+4479
+4843
+()
+405
+745
+***
+2006
+2232
+2476
+2716
+3141
+***
+4096
+4323
+()
+404
+***
+1071
+1337
+1568
+***
+2778
+2970
+3157
+3370
+3566
+3813
+***
+4504
+4676
+4831
+()
+403
+***
+944
+***
+2781
+3109
+3434
+3800
+4128
+4460
+4688
+***
+5065
+5329
+5515
+5664
+5834
+5936
+()
+402
+***
+890
+1286
+1522
+1722
+1938
+2178
+2400
+2630
+2874
+***
+4072
+()
+400
+***
+1047
+()
+399
+727
+1230
+1532
+1841
+2079
+2398
+2654
+()
+398
+616
+***
+1089
+1539
+1853
+2021
+2367
+2704
+2923
+3492
+***
+4402
+4725
+5261
+5359
+5428
+()
+389
+***
+835
+1159
+***
+1899
+1951
+1985
+2045
+2108
+2180
+2294
+2326
+2390
+2462
+2585
+***
+2879
+***
+3786
+4000
+***
+4557
+4879
+5082
+5227
+5341
+5462
+5563
+5683
+5777
+5881
+()
+388
+886
+1493
+1655
+1993
+2395
+2766
+3359
+3584
+4173
+()
+385
+***
+1121
+1306
+***
+2098
+2324
+***
+3000
+3131
+***
+3777
+3999
+()
+383
+630
+927
+1223
+1467
+1660
+1837
+2015
+2210
+2389
+2587
+2794
+3060
+3313
+3596
+3856
+4137
+4389
+4636
+4854
+5050
+5205
+5303
+5395
+5478
+5560
+5644
+5722
+()
+374
+621
+***
+1160
+1309
+1415
+1516
+1615
+1705
+1792
+1884
+1978
+2070
+2159
+2253
+2349
+2445
+2546
+2648
+2745
+2862
+***
+3928
+4130
+4274
+4564
+4829
+5053
+5247
+5372
+5497
+5646
+()
+371
+700
+***
+2971
+***
+3535
+***
+5200
+5308
+5393
+5477
+()
+370
+613
+***
+1173
+***
+3017
+3319
+3693
+4281
+***
+4960
+5127
+5319
+5496
+5651
+5818
+5928
+()
+369
+684
+***
+3347
+***
+4018
+***
+4501
+()
+367
+799
+***
+1142
+***
+2833
+3172
+3483
+***
+4414
+4681
+()
+366
+658
+1068
+1424
+2011
+2261
+2906
+3270
+3655
+4028
+4388
+4709
+5214
+5361
+()
+364
+733
+1192
+1495
+1727
+1950
+2182
+2417
+2662
+2963
+3282
+3633
+3966
+4305
+4604
+4893
+()
+361
+550
+***
+1035
+***
+2470
+2690
+***
+3505
+3654
+3969
+4260
+4543
+4796
+()
+360
+636
+1014
+1356
+***
+3278
+***
+4197
+4383
+4567
+4723
+()
+359
+615
+***
+3358
+3711
+4032
+4384
+4669
+4942
+5143
+5307
+5415
+5537
+5636
+5750
+5843
+5925
+()
+358
+640
+***
+2889
+3164
+3431
+3701
+3990
+4238
+4499
+4738
+4941
+5107
+5238
+5380
+5489
+5587
+5707
+5810
+5890
+()
+352
+553
+739
+972
+1194
+1393
+1542
+***
+2582
+2890
+***
+3585
+3963
+4321
+4656
+()
+351
+716
+1146
+1523
+1784
+2066
+2335
+2642
+2979
+3395
+3784
+4217
+4570
+4910
+5151
+5279
+5376
+5457
+5545
+5616
+5708
+5781
+5864
+5912
+()
+349
+***
+821
+1369
+1738
+2071
+2425
+2804
+3300
+3807
+4309
+()
+346
+693
+1162
+1503
+1796
+2057
+2347
+2627
+3001
+3374
+3808
+4195
+4585
+4897
+5137
+5316
+5399
+5488
+5565
+5652
+5726
+5811
+5878
+5927
+5953
+()
+345
+517
+743
+937
+1195
+1372
+***
+3239
+***
+4250
+4446
+4622
+4779
+4891
+5026
+()
+343
+766
+1295
+1657
+1969
+2287
+2637
+3047
+3527
+4004
+4461
+4851
+5153
+()
+342
+650
+965
+1201
+1358
+***
+2380
+2537
+2677
+2849
+3042
+3253
+***
+4497
+()
+341
+***
+990
+1292
+***
+2756
+2925
+3160
+***
+3724
+()
+338
+604
+***
+1205
+***
+1995
+2209
+2657
+***
+3309
+()
+335
+***
+853
+***
+1322
+***
+2640
+2886
+3521
+3738
+4031
+4294
+4597
+4877
+()
+334
+942
+1500
+1940
+2331
+2813
+3362
+4027
+4560
+5056
+5295
+5508
+5688
+5876
+()
+333
+620
+***
+1247
+***
+3409
+()
+329
+532
+647
+783
+932
+***
+1531
+1677
+1807
+***
+2772
+2991
+3222
+3459
+3705
+3942
+4187
+4405
+4614
+4802
+5030
+5190
+5293
+()
+326
+608
+1033
+1444
+1687
+1903
+2137
+2362
+2619
+2888
+3365
+***
+3866
+4033
+4172
+***
+4815
+5020
+5193
+5370
+5482
+5608
+5730
+()
+322
+713
+1124
+1521
+()
+317
+***
+845
+1348
+1622
+1923
+2164
+2483
+2738
+3170
+3541
+4005
+4341
+4741
+5008
+()
+314
+587
+***
+3620
+3809
+***
+4222
+4476
+()
+313
+507
+940
+1367
+1676
+1971
+2262
+2528
+2812
+3191
+3572
+4051
+4745
+5017
+()
+312
+***
+726
+***
+1240
+***
+2579
+2767
+()
+306
+667
+1123
+1487
+1776
+2036
+2327
+2614
+2964
+3351
+3760
+4165
+4553
+4881
+5130
+5342
+5504
+5679
+5824
+5933
+()
+304
+599
+***
+2922
+3216
+3632
+3895
+()
+303
+***
+959
+1168
+***
+2966
+()
+300
+450
+680
+849
+1131
+1305
+***
+2158
+***
+2933
+3115
+3312
+3532
+3812
+***
+4457
+()
+299
+***
+891
+1030
+***
+2949
+3096
+***
+3626
+4087
+4426
+4809
+()
+292
+***
+725
+1110
+1484
+1703
+1942
+2153
+2407
+2628
+2943
+3235
+3621
+3973
+4324
+4628
+()
+291
+823
+1480
+1869
+2310
+2722
+3339
+3913
+4531
+4993
+5280
+5468
+5672
+5842
+()
+290
+594
+***
+3100
+3411
+***
+4271
+()
+288
+582
+1062
+1411
+1741
+1977
+2288
+2542
+2905
+3262
+3721
+4089
+4513
+4812
+5114
+5277
+5427
+5539
+5660
+5779
+()
+287
+491
+***
+1129
+***
+1898
+2140
+***
+3218
+3671
+4040
+4470
+4782
+5090
+***
+5629
+5675
+5765
+***
+5937
+()
+281
+489
+***
+912
+***
+2494
+2669
+2798
+3027
+3197
+***
+3920
+4122
+4308
+()
+280
+***
+905
+1416
+1780
+2119
+2479
+2861
+3366
+3886
+4373
+4808
+()
+279
+428
+***
+1008
+1164
+***
+1726
+1932
+***
+2464
+2692
+***
+3911
+4077
+4206
+4327
+4463
+4578
+4695
+4806
+4915
+5011
+5088
+5164
+()
+278
+***
+1021
+***
+2793
+3025
+3209
+***
+3828
+3940
+4068
+4265
+()
+276
+***
+827
+***
+2034
+2136
+2265
+2366
+2508
+2615
+2757
+***
+3171
+3549
+3927
+4289
+4946
+5165
+5502
+5610
+5724
+5821
+()
+275
+568
+***
+1254
+***
+2972
+3331
+3460
+3601
+***
+4904
+()
+274
+468
+669
+882
+***
+2196
+2419
+2871
+3219
+3580
+3896
+4256
+4546
+4840
+5066
+5245
+5356
+5481
+5584
+5698
+5795
+5895
+()
+273
+***
+872
+1132
+***
+1541
+1751
+***
+4065
+4252
+4430
+4569
+()
+272
+***
+1036
+1370
+1608
+1793
+1955
+2142
+2471
+2664
+2978
+3297
+3732
+4062
+4403
+4655
+***
+5070
+()
+270
+397
+672
+***
+1256
+***
+2994
+3142
+3368
+3562
+3781
+3979
+4188
+4362
+4566
+4713
+***
+5076
+()
+268
+503
+846
+1229
+***
+3801
+***
+4540
+4770
+()
+267
+946
+***
+3105
+3242
+3555
+3820
+()
+266
+408
+***
+859
+1143
+***
+3925
+4189
+4380
+4568
+4724
+()
+264
+***
+866
+***
+2938
+()
+257
+***
+864
+1342
+1628
+1917
+2171
+2474
+2749
+3169
+3550
+3993
+()
+256
+544
+***
+1193
+1533
+1639
+2087
+2608
+2930
+3764
+4153
+4882
+5140
+5551
+5687
+()
+255
+***
+836
+***
+1558
+1803
+2384
+2649
+***
+3484
+***
+4038
+4216
+4424
+4588
+()
+253
+***
+698
+997
+***
+3406
+3754
+4134
+()
+252
+430
+***
+992
+***
+2858
+3016
+3208
+3360
+3551
+3710
+3923
+4113
+4315
+4505
+4679
+()
+249
+***
+816
+1219
+1475
+1743
+1957
+2141
+2329
+2557
+2805
+3149
+3469
+3879
+4193
+4523
+4751
+()
+248
+***
+954
+1199
+***
+2854
+3049
+3240
+3456
+3745
+***
+4475
+4716
+5036
+5266
+5433
+5607
+5757
+5908
+()
+246
+***
+931
+1225
+***
+2967
+3188
+3427
+3666
+3916
+4146
+4379
+4582
+4787
+()
+244
+580
+957
+1414
+***
+3311
+3475
+3864
+4220
+()
+242
+382
+***
+920
+***
+1536
+***
+1904
+2113
+***
+3125
+3271
+3507
+3690
+3921
+4102
+4314
+4484
+4678
+4824
+()
+237
+490
+***
+1074
+()
+236
+476
+***
+1067
+***
+2809
+3051
+3283
+()
+233
+362
+***
+828
+1216
+***
+2184
+2396
+***
+2969
+3094
+3441
+3756
+4126
+4419
+4739
+4983
+5182
+5296
+5420
+5528
+5643
+5743
+5854
+()
+231
+793
+1397
+1848
+2241
+2699
+3226
+3883
+4434
+4971
+()
+226
+392
+519
+646
+764
+930
+***
+2555
+2659
+***
+3404
+3847
+()
+224
+496
+***
+1180
+2386
+2641
+***
+3437
+3591
+3747
+3906
+4058
+4203
+4351
+4485
+4621
+4749
+4894
+4998
+5108
+5189
+()
+221
+***
+952
+***
+2807
+2986
+3175
+3381
+3679
+3968
+4382
+***
+5018
+()
+216
+331
+451
+576
+***
+1028
+1243
+***
+2422
+2620
+2902
+3229
+3560
+3885
+4207
+4503
+4862
+***
+5179
+***
+5788
+()
+215
+***
+934
+1329
+1575
+1809
+2028
+2269
+2501
+2764
+3066
+3995
+***
+4704
+4918
+5187
+5385
+5543
+5717
+5862
+()
+214
+381
+***
+993
+***
+1871
+2150
+2431
+2727
+3107
+3519
+3929
+4328
+4682
+5000
+()
+210
+***
+878
+1226
+1489
+1700
+1900
+2109
+2315
+2534
+2763
+***
+3344
+3653
+3930
+()
+209
+461
+***
+1120
+1449
+1799
+2101
+2446
+2783
+3255
+3714
+4215
+4619
+***
+5128
+***
+5509
+5596
+5704
+5756
+()
+207
+377
+722
+1155
+1525
+1778
+2029
+2343
+2650
+2990
+3402
+()
+206
+***
+786
+1346
+1710
+2055
+2399
+2775
+3254
+3773
+4285
+4737
+5145
+()
+205
+***
+1096
+1264
+1371
+1488
+1578
+1680
+1758
+1854
+1936
+2037
+2117
+2225
+2302
+2412
+2502
+2607
+2697
+2822
+***
+3367
+3523
+3678
+3831
+3997
+4136
+4287
+4428
+4565
+4687
+4842
+4955
+5078
+5156
+5243
+5312
+5367
+5429
+5490
+5569
+5656
+5732
+5815
+5879
+5929
+5954
+()
+203
+***
+744
+876
+***
+2746
+2920
+3162
+3289
+3510
+3695
+3962
+***
+4516
+()
+201
+319
+***
+717
+1282
+1672
+2005
+2348
+2721
+3200
+3697
+4213
+4670
+()
+199
+328
+480
+649
+883
+1090
+1339
+***
+3819
+4163
+4511
+4803
+5058
+5216
+5347
+5461
+5577
+5671
+5789
+()
+197
+260
+410
+559
+671
+787
+948
+***
+3490
+3951
+4300
+4700
+4985
+5224
+***
+5850
+()
+194
+675
+***
+1006
+1210
+***
+3389
+***
+4708
+()
+193
+327
+434
+606
+770
+962
+1147
+1332
+1461
+1598
+1688
+1812
+1927
+2053
+2157
+2296
+2414
+2553
+2667
+2824
+2982
+3154
+3310
+3497
+3657
+3880
+4043
+4242
+4401
+4583
+4719
+4858
+4977
+5093
+5176
+5272
+5336
+5423
+5483
+5561
+5621
+5697
+5752
+5826
+()
+189
+466
+***
+1145
+1419
+1658
+1844
+2000
+2186
+2371
+2568
+2840
+3165
+3603
+3924
+4229
+4534
+4805
+4982
+()
+187
+***
+651
+1118
+1471
+2039
+2303
+3014
+3220
+3825
+4054
+4607
+4786
+5177
+()
+186
+***
+897
+1211
+1451
+1650
+1817
+1999
+2189
+2373
+2567
+***
+3050
+3215
+3380
+3567
+3727
+3947
+4108
+4307
+4458
+4646
+4773
+4903
+5023
+()
+184
+347
+633
+***
+1204
+1404
+1492
+1610
+1679
+1787
+1855
+***
+2675
+***
+3976
+4139
+4295
+4394
+4547
+4644
+4774
+4866
+4981
+5054
+5133
+5191
+5254
+5313
+5375
+5430
+5486
+5542
+5597
+5649
+5706
+5755
+5809
+5858
+5898
+5934
+5952
+()
+182
+323
+584
+***
+1058
+***
+1595
+1843
+2512
+2806
+3624
+4023
+4775
+5055
+5495
+5633
+()
+180
+339
+555
+***
+1190
+1391
+***
+2791
+2983
+3179
+3376
+3599
+3890
+4167
+4473
+4772
+()
+179
+***
+689
+964
+***
+1556
+***
+2443
+3146
+3361
+***
+3788
+3944
+***
+4536
+4821
+5106
+5325
+5492
+5661
+5813
+5935
+()
+178
+406
+***
+1095
+***
+2934
+3272
+3739
+4097
+4528
+4823
+5125
+5305
+5437
+5589
+5713
+5853
+5930
+()
+177
+261
+414
+566
+736
+914
+1125
+1289
+1440
+1567
+1686
+1786
+1912
+2024
+2156
+2271
+2403
+2521
+2661
+2792
+2958
+3113
+3287
+3451
+3663
+3827
+4045
+4205
+4407
+4549
+4731
+4852
+4986
+***
+5641
+()
+176
+387
+***
+870
+2912
+3156
+***
+4532
+4990
+5282
+5445
+5624
+5772
+()
+175
+283
+***
+909
+***
+1434
+2884
+3065
+3284
+3468
+3698
+3884
+4114
+4284
+***
+4818
+***
+5118
+5273
+5365
+5448
+5535
+5612
+5700
+5773
+()
+172
+294
+376
+531
+***
+1041
+()
+171
+321
+***
+1084
+()
+170
+308
+574
+921
+1302
+1564
+1681
+1833
+1947
+2106
+2222
+2387
+2513
+2685
+2817
+3054
+3392
+3737
+4074
+4404
+4703
+4954
+***
+5791
+5891
+5951
+()
+169
+301
+407
+572
+728
+924
+1115
+1296
+1432
+1572
+***
+2611
+***
+3397
+3659
+4055
+4459
+4822
+5083
+5268
+5407
+5555
+5681
+()
+166
+***
+819
+1130
+***
+3067
+3435
+3922
+4116
+4319
+4494
+4729
+()
+165
+289
+481
+758
+***
+3241
+3349
+3520
+()
+163
+452
+813
+1310
+***
+2665
+2850
+3098
+3320
+3576
+3795
+4053
+4276
+4502
+4690
+4935
+5119
+5239
+5379
+5466
+5546
+5632
+5709
+5794
+5860
+()
+160
+***
+922
+1197
+1458
+***
+2719
+2924
+3161
+3386
+3637
+3881
+4121
+4338
+4561
+4757
+()
+158
+284
+***
+902
+***
+1398
+***
+3074
+()
+156
+***
+712
+1013
+***
+1441
+1667
+***
+2846
+***
+3292
+3568
+3667
+()
+155
+***
+478
+***
+986
+1379
+1606
+1851
+2056
+2314
+2529
+2816
+3106
+***
+3794
+()
+154
+353
+706
+1176
+1512
+1804
+2052
+2312
+2636
+3004
+3385
+3776
+4200
+4596
+4905
+5138
+5349
+5500
+5626
+5771
+5892
+()
+153
+485
+***
+1189
+***
+2695
+3009
+3473
+3822
+4279
+4600
+4965
+5167
+5320
+5479
+5604
+5748
+5865
+5943
+()
+152
+356
+***
+1122
+2903
+***
+3542
+3768
+3953
+4183
+4345
+4609
+4761
+4932
+5052
+()
+151
+***
+888
+1303
+1540
+1944
+2212
+2819
+3196
+4042
+4408
+5061
+()
+150
+324
+551
+869
+1207
+1455
+1714
+1920
+2166
+2382
+2651
+2907
+3224
+3553
+3849
+4171
+4478
+4740
+5012
+5184
+5300
+5408
+5534
+5625
+5747
+5835
+()
+148
+316
+677
+1113
+1497
+1772
+2046
+2316
+2616
+2952
+3343
+3761
+4168
+4545
+()
+147
+240
+386
+502
+682
+834
+1042
+1228
+1388
+1509
+1648
+1756
+1876
+1989
+2124
+2236
+2363
+2495
+2625
+2742
+2918
+3085
+3251
+3413
+3631
+3792
+4017
+4176
+4372
+4517
+4692
+4826
+4961
+5073
+5172
+5249
+5330
+5397
+5480
+5540
+5614
+5674
+5749
+5807
+5874
+()
+146
+269
+***
+814
+1099
+***
+1646
+1864
+***
+3015
+3193
+***
+3725
+4118
+4519
+4872
+5150
+5452
+5556
+()
+145
+***
+659
+984
+1311
+1560
+1802
+2009
+2260
+2485
+2755
+3046
+3338
+3651
+()
+143
+521
+1140
+1674
+2051
+2506
+2973
+3608
+4178
+4767
+5148
+5398
+5581
+5780
+5918
+()
+142
+354
+***
+963
+***
+2731
+***
+3552
+3859
+***
+4450
+4712
+()
+141
+380
+***
+966
+***
+1485
+1757
+2321
+2596
+3414
+3573
+3688
+3840
+3980
+4117
+4231
+4377
+4486
+4616
+4722
+4836
+5202
+5351
+5714
+5838
+5932
+()
+138
+396
+982
+1583
+1961
+2402
+2834
+3477
+4048
+4652
+5074
+5339
+5523
+5727
+5886
+()
+137
+***
+627
+***
+1263
+1555
+1885
+2195
+2544
+2896
+3398
+3855
+4340
+4734
+()
+135
+238
+482
+***
+1126
+1238
+1642
+2048
+2112
+2467
+2959
+3062
+3629
+4015
+4366
+4887
+5059
+5211
+5354
+5529
+5685
+()
+133
+285
+***
+841
+1152
+***
+2342
+2472
+2635
+2776
+2989
+***
+3861
+4021
+4316
+4642
+4873
+5098
+()
+132
+218
+350
+469
+644
+801
+998
+1188
+1366
+1486
+1612
+1721
+1849
+1956
+2084
+2202
+2332
+2440
+2591
+2709
+2867
+3011
+3190
+3354
+3529
+3689
+3909
+4076
+4280
+4429
+4612
+4746
+4888
+4999
+5120
+5203
+5304
+5371
+5450
+5507
+5590
+5647
+5721
+5782
+5852
+5906
+5948
+5957
+5965
+5966
+5973
+5974
+5980
+5982
+()
+131
+***
+638
+824
+***
+1287
+1383
+1510
+1593
+1699
+1774
+1873
+1946
+2061
+2135
+2245
+2319
+***
+2882
+3086
+3213
+3410
+3577
+3779
+3988
+()
+130
+277
+589
+1001
+1427
+1689
+1939
+2250
+2548
+2853
+3266
+3702
+3865
+4008
+4378
+4755
+()
+129
+***
+715
+854
+***
+2899
+3163
+3430
+3704
+3987
+4248
+4492
+4733
+4934
+5105
+5255
+5360
+5475
+5603
+5696
+5800
+5902
+()
+128
+239
+***
+767
+1177
+***
+2660
+()
+127
+265
+***
+779
+1082
+()
+124
+243
+344
+509
+668
+843
+1029
+1235
+1384
+1511
+1634
+1752
+1858
+1983
+2089
+2228
+2337
+2475
+2597
+2735
+2876
+3058
+3211
+3387
+3559
+3771
+3935
+4148
+4301
+4495
+4639
+***
+5096
+5204
+5271
+5366
+5432
+5494
+5576
+()
+123
+412
+***
+1054
+***
+3127
+3453
+3790
+4144
+4455
+4748
+5009
+***
+5593
+5716
+5856
+5946
+()
+122
+***
+741
+1019
+1363
+***
+2815
+2909
+***
+3600
+3762
+3982
+4138
+4336
+4489
+4672
+4797
+4933
+5048
+5147
+5228
+()
+121
+***
+648
+1212
+1619
+1959
+2305
+2670
+3129
+3636
+4151
+4608
+5006
+()
+120
+311
+***
+810
+***
+1273
+***
+3607
+3758
+4069
+4359
+4630
+4884
+5031
+5188
+***
+5825
+***
+5949
+5958
+5964
+5967
+5972
+5975
+5981
+()
+119
+298
+***
+822
+***
+1446
+1665
+1819
+2016
+2185
+2393
+***
+2898
+***
+3445
+3708
+4080
+4381
+4756
+4973
+()
+117
+336
+***
+938
+1319
+1582
+1801
+2031
+2259
+2504
+2754
+3075
+3401
+3759
+4095
+()
+114
+282
+***
+995
+1335
+***
+2621
+***
+3124
+3420
+3563
+3706
+3826
+3991
+4106
+4245
+4364
+4500
+4603
+4726
+4825
+4931
+5021
+5100
+5383
+5526
+5817
+5921
+()
+113
+258
+464
+***
+1081
+1376
+1625
+1850
+2074
+2309
+2549
+2810
+3136
+3476
+3816
+()
+112
+***
+840
+1349
+1701
+2008
+2344
+2680
+3122
+3583
+4081
+4514
+4906
+5198
+5353
+5463
+5582
+5684
+5790
+5882
+5941
+()
+111
+330
+662
+1085
+1482
+1790
+2072
+2334
+2601
+2926
+3335
+3791
+4185
+4574
+4916
+5157
+5327
+5464
+5611
+5734
+5847
+()
+110
+332
+626
+1004
+1457
+1707
+2010
+2257
+2577
+2864
+3304
+***
+4014
+()
+107
+222
+***
+709
+***
+1323
+1600
+1805
+2047
+2267
+2515
+2759
+***
+3371
+3751
+4129
+4474
+5111
+5267
+()
+105
+219
+325
+473
+632
+812
+989
+1198
+1359
+1496
+1611
+***
+2942
+3232
+()
+104
+259
+***
+976
+***
+2945
+3092
+3280
+3423
+3648
+***
+4192
+***
+4794
+5015
+()
+102
+365
+***
+1012
+1336
+1773
+2023
+2656
+2831
+3417
+3638
+4232
+4438
+4925
+5028
+()
+101
+213
+***
+867
+1285
+1504
+1766
+1970
+2221
+2428
+2703
+2977
+3306
+3650
+4036
+4356
+4683
+4957
+()
+100
+208
+***
+557
+***
+1000
+1454
+1791
+2103
+2437
+2785
+3250
+3719
+4210
+4627
+5003
+***
+5754
+5868
+()
+99
+***
+639
+960
+()
+98
+228
+395
+***
+979
+1185
+***
+3259
+3604
+3934
+4278
+4577
+4855
+***
+5181
+()
+97
+229
+379
+***
+935
+1320
+1669
+1896
+2213
+2457
+***
+3494
+3741
+4145
+4444
+4717
+4969
+5170
+5310
+5443
+5568
+()
+94
+241
+***
+777
+1334
+1921
+2272
+2689
+3159
+3769
+3882
+4425
+4758
+4944
+5141
+()
+93
+230
+***
+750
+1300
+1694
+2026
+2379
+2739
+3230
+3744
+4241
+4698
+()
+92
+***
+832
+1100
+1330
+***
+2948
+3110
+3206
+3377
+3480
+***
+4180
+()
+90
+295
+***
+1005
+***
+4290
+()
+89
+***
+585
+***
+1116
+1403
+1633
+1832
+2038
+2247
+2460
+2683
+()
+88
+296
+***
+877
+***
+2960
+3147
+3288
+3489
+3643
+3854
+4047
+()
+87
+200
+518
+871
+1246
+1535
+1759
+1991
+2214
+2492
+2718
+3043
+3369
+3692
+4022
+4334
+4638
+()
+86
+202
+293
+443
+600
+785
+951
+1156
+1331
+1469
+1588
+1716
+1815
+1954
+2058
+2191
+2301
+2435
+2559
+2700
+2829
+3019
+3185
+3357
+3518
+3730
+3902
+4115
+4273
+4465
+4605
+4783
+4902
+5037
+5123
+5222
+()
+85
+***
+534
+958
+1385
+1684
+1945
+2231
+2511
+2827
+3207
+3622
+4035
+4422
+4776
+5069
+5281
+5449
+5622
+5776
+()
+84
+227
+320
+448
+581
+708
+900
+***
+3454
+3755
+4071
+***
+5060
+5392
+5499
+5613
+5719
+5823
+()
+82
+191
+***
+660
+955
+***
+1732
+1952
+***
+2950
+3244
+()
+81
+192
+***
+641
+923
+1234
+1462
+1666
+1835
+2019
+2208
+2394
+2584
+2800
+3057
+3324
+3588
+3870
+4132
+4398
+4637
+4864
+5046
+5192
+()
+80
+144
+271
+372
+535
+699
+881
+1070
+1272
+1402
+1538
+1659
+1781
+1887
+2020
+2130
+2263
+2372
+2514
+2629
+2782
+2914
+3091
+3245
+3424
+3594
+3802
+3981
+4181
+4330
+4522
+4664
+4800
+4927
+5067
+5152
+5242
+5311
+5391
+5454
+5538
+5592
+5669
+5725
+5802
+5857
+5913
+5944
+5960
+5962
+5969
+5970
+5976
+5978
+5984
+5985
+()
+79
+340
+***
+971
+1271
+***
+1814
+2018
+***
+2852
+3305
+3796
+4263
+4694
+5042
+5291
+5409
+5524
+5628
+5740
+5837
+5922
+()
+78
+***
+391
+***
+899
+1138
+***
+2432
+2510
+2632
+2711
+2843
+***
+3355
+3700
+3970
+4277
+4602
+4975
+5169
+5414
+5533
+5631
+5798
+()
+77
+***
+711
+1217
+1520
+1831
+2068
+2383
+2645
+3044
+***
+3875
+4159
+4421
+4711
+4970
+()
+74
+223
+***
+692
+1103
+***
+3008
+3152
+3353
+3498
+3713
+***
+4202
+4573
+()
+72
+220
+***
+818
+1136
+***
+2002
+2193
+***
+3013
+3252
+***
+3726
+3985
+4267
+4491
+4750
+4928
+5117
+5237
+5348
+5470
+5573
+5686
+5786
+5885
+5940
+()
+71
+168
+***
+552
+697
+917
+1101
+1314
+1433
+1596
+1690
+1821
+1929
+2062
+2170
+2308
+2415
+2560
+2672
+2839
+2984
+3178
+3336
+3547
+3685
+3903
+4056
+4253
+4397
+4572
+4707
+4874
+4976
+5095
+()
+70
+198
+***
+593
+***
+1083
+***
+3449
+()
+69
+162
+390
+702
+1057
+1399
+1617
+2696
+***
+3613
+3889
+***
+5016
+()
+68
+302
+***
+848
+***
+1429
+1685
+***
+3472
+()
+67
+212
+***
+865
+3093
+***
+4030
+4348
+()
+66
+***
+416
+731
+1094
+1431
+1670
+1902
+2118
+2361
+2595
+2880
+3199
+3525
+3852
+()
+65
+262
+477
+***
+928
+1150
+***
+1926
+1996
+2078
+2139
+2173
+2273
+2358
+2418
+2458
+2517
+***
+3095
+3540
+3904
+4346
+4673
+5007
+***
+5899
+()
+64
+***
+401
+710
+1075
+1413
+1663
+1771
+1924
+2042
+2205
+2317
+2488
+2609
+2797
+2955
+3183
+3533
+3876
+4199
+4524
+4814
+***
+5168
+5208
+5236
+5264
+5297
+5324
+5355
+5386
+5416
+5442
+5472
+5498
+5527
+5552
+5583
+5606
+5635
+5662
+5690
+5715
+5744
+5768
+5796
+5820
+5844
+()
+63
+***
+1076
+***
+3382
+***
+3926
+4275
+4598
+4898
+5136
+5284
+5406
+5506
+5627
+5729
+5836
+()
+62
+183
+337
+***
+907
+1200
+***
+2646
+2832
+3078
+3470
+3841
+4103
+4311
+4436
+4662
+4968
+5441
+5580
+()
+61
+245
+438
+755
+1107
+1425
+1656
+1889
+2105
+2353
+2578
+2866
+3143
+3440
+3752
+4064
+4361
+4594
+4848
+5087
+5226
+5362
+5465
+5586
+5682
+5799
+***
+5942
+()
+60
+195
+687
+1374
+1779
+2217
+2623
+3203
+3772
+4412
+4895
+5215
+5411
+5618
+5793
+5947
+()
+59
+***
+417
+688
+969
+***
+1636
+1729
+2131
+2401
+2666
+2881
+3097
+3223
+3493
+3887
+4246
+4482
+4675
+4785
+4978
+5229
+5605
+5741
+5867
+()
+58
+***
+533
+704
+874
+1086
+1260
+1409
+1534
+***
+1943
+2043
+2174
+2274
+2408
+2516
+2639
+2769
+***
+3303
+3680
+4067
+4417
+5041
+5210
+()
+57
+139
+***
+661
+***
+1183
+***
+2803
+3144
+3587
+3967
+4406
+4714
+5051
+5244
+5381
+5536
+5658
+5803
+5904
+()
+56
+307
+***
+1027
+***
+2961
+3399
+3767
+4214
+4554
+4908
+()
+54
+173
+***
+811
+1184
+1494
+***
+3506
+3829
+4150
+4487
+4765
+()
+53
+384
+***
+950
+1368
+***
+2996
+3281
+3978
+4186
+4720
+4892
+5263
+5413
+5766
+5883
+()
+51
+***
+530
+903
+1412
+1735
+2069
+2374
+2744
+3168
+3674
+4127
+4584
+4939
+()
+50
+140
+***
+575
+***
+1153
+***
+2811
+()
+49
+286
+635
+***
+1218
+1524
+2102
+2352
+3045
+3405
+3785
+4161
+4510
+4819
+5335
+5446
+5558
+5665
+5775
+5872
+()
+47
+235
+***
+805
+1209
+1623
+1918
+2251
+2574
+2995
+3442
+3949
+4385
+4811
+5110
+5276
+5358
+5453
+5530
+5619
+5692
+5778
+5845
+()
+46
+159
+310
+471
+771
+***
+3233
+3763
+3898
+4011
+()
+44
+181
+513
+***
+1165
+1442
+1545
+1724
+1811
+2235
+2416
+2698
+3026
+3276
+3503
+3640
+3901
+4282
+4613
+4828
+4988
+5072
+()
+43
+188
+***
+761
+1161
+1559
+1794
+2104
+2346
+2679
+2992
+3444
+3806
+4262
+4589
+4948
+5163
+5326
+5455
+()
+42
+225
+564
+***
+1137
+1324
+1483
+1632
+1767
+***
+2328
+2520
+2789
+3082
+***
+3656
+()
+41
+115
+375
+769
+1056
+***
+2489
+2771
+2887
+3103
+***
+3717
+()
+40
+305
+571
+1020
+1407
+1718
+1958
+2218
+2538
+2870
+3247
+3639
+4075
+4437
+4804
+5071
+5287
+5447
+5574
+5720
+5851
+()
+39
+96
+234
+***
+889
+1227
+1438
+3249
+***
+3833
+()
+37
+***
+415
+815
+1261
+1599
+1860
+2138
+2410
+2717
+3079
+3478
+3897
+4296
+4667
+4984
+5218
+5394
+5571
+5723
+5889
+()
+36
+***
+563
+***
+1135
+()
+35
+***
+501
+***
+1059
+1340
+1544
+1731
+1909
+2091
+2283
+2473
+2676
+***
+3132
+()
+34
+***
+355
+619
+826
+***
+2752
+()
+33
+250
+***
+892
+1203
+1445
+1644
+1823
+2004
+2187
+2377
+2571
+***
+2993
+3123
+3265
+3421
+3528
+3660
+3799
+3936
+4078
+4198
+4337
+4456
+4579
+4699
+4810
+4914
+5005
+5085
+5161
+()
+32
+232
+***
+901
+***
+1640
+1838
+***
+2364
+2589
+2768
+***
+3534
+3877
+4236
+4742
+()
+31
+108
+***
+441
+738
+1353
+1728
+2125
+2300
+2658
+3174
+3765
+4142
+4488
+4963
+5292
+5476
+5578
+5694
+()
+30
+196
+***
+830
+1251
+()
+29
+185
+420
+765
+918
+1063
+()
+28
+***
+393
+607
+***
+1170
+***
+1875
+2149
+2433
+2724
+3111
+3512
+3939
+4326
+4686
+4997
+***
+5841
+5924
+()
+27
+76
+174
+251
+378
+487
+631
+792
+947
+1141
+1288
+1423
+1537
+1649
+1745
+1868
+1968
+2099
+2206
+2330
+2434
+2575
+2686
+2838
+2981
+3167
+3317
+3474
+3625
+3780
+3937
+4094
+4233
+4386
+4520
+()
+26
+254
+***
+987
+***
+1613
+1894
+2143
+2404
+2736
+3137
+3575
+3729
+3872
+4247
+4634
+()
+25
+204
+440
+863
+1297
+1624
+1866
+2122
+2438
+2753
+3117
+3501
+3938
+4312
+4691
+4989
+5223
+5389
+5518
+5663
+()
+24
+83
+161
+263
+363
+467
+622
+768
+943
+1111
+1278
+1406
+1526
+***
+2441
+***
+3394
+3635
+3805
+4046
+4211
+4496
+4651
+4834
+4967
+5102
+5253
+***
+5870
+***
+5945
+5959
+5963
+5968
+5971
+5977
+5979
+5983
+()
+23
+103
+***
+915
+1242
+1506
+1706
+1865
+2049
+2234
+2423
+2687
+***
+3432
+***
+3950
+***
+5126
+5234
+5315
+5382
+5451
+5541
+5598
+5702
+5759
+5855
+()
+22
+134
+348
+664
+981
+1350
+1626
+1828
+2075
+2289
+2552
+2788
+3134
+3443
+3749
+4066
+4347
+4632
+4920
+5113
+5240
+5346
+5474
+5575
+5695
+5787
+()
+21
+167
+***
+603
+820
+1039
+1277
+1437
+1604
+***
+2946
+()
+20
+106
+***
+558
+1009
+1401
+1704
+1964
+2255
+2530
+2855
+3234
+3669
+4070
+4471
+4795
+5068
+5256
+5338
+5436
+5512
+5600
+5670
+5761
+5829
+5903
+5938
+()
+19
+125
+***
+729
+***
+1344
+2957
+3184
+***
+4650
+5077
+()
+18
+***
+643
+1196
+1586
+1747
+2086
+2406
+2588
+3018
+3479
+3733
+4303
+4645
+4844
+()
+17
+45
+157
+309
+***
+1049
+1275
+***
+3030
+()
+16
+75
+247
+493
+634
+784
+1250
+1574
+1847
+2154
+2455
+2720
+3073
+3467
+3845
+4268
+4657
+4958
+()
+15
+48
+126
+211
+318
+424
+565
+719
+879
+1060
+1224
+1375
+1490
+1602
+1696
+1824
+1930
+2054
+2152
+2285
+2391
+2525
+2631
+2774
+2916
+3102
+3246
+3403
+3558
+3712
+3867
+4029
+4174
+4317
+4454
+()
+14
+***
+427
+803
+1266
+1592
+1862
+2128
+2421
+2706
+3090
+3481
+3892
+4297
+4668
+4980
+5206
+5403
+5559
+5731
+5873
+()
+13
+190
+***
+790
+()
+12
+***
+357
+***
+1038
+***
+2779
+()
+11
+109
+394
+***
+732
+***
+1157
+1333
+1502
+***
+3400
+3862
+4219
+4631
+4911
+5194
+5340
+()
+10
+118
+***
+703
+852
+1007
+***
+3546
+3817
+()
+9
+136
+***
+794
+1237
+1584
+1879
+2172
+2427
+2701
+3061
+3450
+3915
+4629
+4917
+()
+8
+55
+116
+217
+315
+435
+554
+696
+860
+1037
+1206
+1360
+1478
+1589
+1692
+1785
+1915
+2012
+2145
+2244
+2381
+2491
+2624
+2730
+2900
+3048
+3227
+3379
+3545
+3691
+3846
+4012
+4157
+4298
+4440
+4576
+4735
+4853
+4992
+5080
+5180
+5250
+5306
+5373
+5431
+5513
+5599
+5678
+5758
+5833
+5901
+5939
+5956
+()
+7
+91
+***
+714
+***
+1327
+***
+1883
+2050
+2233
+2461
+2693
+3012
+3330
+3665
+3996
+4365
+4648
+4926
+5124
+5309
+5425
+5553
+5703
+()
+6
+95
+***
+652
+1022
+1470
+1720
+2027
+2266
+2598
+2873
+3329
+3681
+4149
+4480
+4869
+5094
+5262
+5421
+5549
+5699
+5816
+()
+5
+164
+***
+695
+894
+1421
+***
+2801
+()
+4
+149
+368
+505
+625
+***
+1065
+1400
+1678
+1878
+2126
+2336
+2606
+2851
+3204
+3513
+***
+4235
+4418
+4521
+4661
+4762
+4885
+4964
+5063
+5122
+5201
+5251
+5321
+5374
+5440
+5484
+5550
+5595
+5657
+5705
+5763
+5808
+5866
+5897
+5931
+5955
+()
+3
+38
+***
+663
+***
+3592
+()
+2
+73
+373
+***
+1178
+***
+1712
+***
+2359
+2617
+3032
+***
+3946
+***
+4370
+***
+4792
+()
+1
+52
+297
+612
+***
+1552
+1736
+***
+2480
+***
+2980
+3087
+***
+3869
Added: test-suite/trunk/External/SPEC/CINT2000/181.mcf/181.mcf.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/181.mcf/181.mcf.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/181.mcf/181.mcf.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CINT2000/181.mcf/181.mcf.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,717 @@
+
+MCF SPEC version 1.6.I
+by Andreas Loebel
+Copyright (c) 1998,1999 ZIB Berlin
+All Rights Reserved.
+
+nodes : 646
+active arcs : 4727
+simplex iterations : 3487
+flow value : 420008515
+new implicit arcs : 33663
+active arcs : 38390
+simplex iterations : 4865
+flow value : 380006269
+checksum : 113792
+optimal
+exit 0
+()
+80
+136
+174
+216
+254
+301
+348
+404
+449
+500
+()
+79
+117
+152
+181
+212
+241
+272
+307
+349
+397
+438
+483
+516
+545
+569
+596
+616
+633
+()
+78
+116
+127
+140
+***
+289
+296
+334
+376
+423
+461
+494
+526
+556
+579
+605
+623
+639
+()
+73
+95
+111
+128
+149
+165
+178
+190
+209
+225
+238
+250
+269
+286
+302
+319
+342
+367
+393
+410
+431
+452
+478
+493
+512
+527
+539
+554
+572
+588
+()
+70
+119
+166
+204
+246
+285
+339
+386
+439
+485
+532
+557
+583
+606
+625
+640
+646
+()
+66
+104
+142
+171
+202
+231
+262
+295
+333
+343
+363
+411
+450
+()
+61
+***
+103
+***
+380
+398
+419
+441
+466
+481
+502
+518
+530
+543
+562
+578
+590
+603
+()
+57
+106
+157
+193
+236
+273
+328
+374
+427
+474
+519
+546
+573
+597
+618
+634
+644
+()
+55
+109
+153
+197
+233
+277
+325
+377
+424
+476
+517
+553
+577
+602
+621
+637
+645
+()
+54
+110
+154
+196
+234
+276
+324
+379
+425
+477
+522
+561
+595
+624
+642
+()
+53
+90
+129
+***
+327
+375
+428
+473
+520
+555
+591
+619
+()
+52
+***
+364
+389
+()
+50
+59
+75
+99
+121
+137
+150
+169
+185
+198
+210
+229
+245
+258
+270
+291
+312
+329
+344
+369
+391
+418
+434
+455
+475
+490
+503
+523
+536
+549
+564
+582
+598
+()
+49
+69
+85
+101
+125
+145
+158
+170
+189
+205
+218
+230
+249
+265
+278
+293
+317
+338
+354
+373
+394
+416
+442
+458
+479
+498
+511
+524
+541
+558
+570
+584
+601
+615
+()
+48
+68
+122
+163
+207
+244
+288
+336
+390
+436
+489
+529
+()
+45
+96
+143
+187
+223
+267
+310
+360
+()
+39
+67
+123
+164
+206
+243
+287
+337
+392
+437
+488
+534
+571
+604
+630
+()
+36
+43
+62
+86
+108
+124
+139
+159
+175
+188
+200
+219
+235
+248
+260
+279
+299
+315
+332
+355
+378
+406
+422
+443
+464
+()
+26
+41
+60
+82
+98
+115
+138
+155
+168
+180
+199
+215
+228
+240
+259
+275
+290
+305
+330
+351
+368
+384
+407
+429
+454
+470
+491
+508
+521
+533
+551
+568
+()
+24
+40
+***
+309
+346
+383
+395
+409
+420
+433
+444
+457
+468
+482
+492
+()
+20
+46
+97
+144
+186
+224
+266
+311
+365
+412
+463
+507
+542
+567
+593
+614
+631
+()
+18
+44
+94
+146
+184
+226
+263
+314
+361
+415
+460
+509
+537
+563
+587
+611
+628
+641
+()
+17
+31
+65
+105
+141
+172
+201
+232
+261
+294
+304
+316
+***
+366
+413
+465
+513
+550
+585
+617
+638
+()
+16
+34
+84
+133
+177
+213
+256
+298
+352
+400
+453
+496
+***
+580
+594
+610
+622
+()
+14
+37
+81
+135
+173
+217
+253
+300
+347
+403
+448
+499
+()
+13
+22
+42
+***
+118
+151
+182
+211
+242
+271
+306
+318
+335
+385
+421
+432
+445
+456
+472
+504
+538
+566
+589
+613
+629
+()
+12
+47
+93
+147
+183
+227
+264
+313
+362
+417
+462
+510
+544
+581
+612
+636
+()
+11
+29
+()
+10
+30
+63
+74
+89
+100
+114
+131
+161
+192
+221
+252
+282
+320
+331
+345
+356
+371
+382
+396
+408
+426
+471
+506
+535
+559
+586
+608
+627
+643
+()
+9
+35
+83
+132
+176
+214
+257
+297
+353
+399
+451
+497
+()
+8
+25
+64
+()
+7
+23
+51
+92
+130
+162
+191
+222
+251
+283
+321
+358
+370
+388
+435
+469
+480
+()
+6
+28
+71
+120
+167
+203
+247
+284
+340
+387
+440
+486
+528
+565
+600
+626
+()
+5
+19
+33
+56
+72
+88
+113
+134
+148
+160
+179
+195
+208
+220
+239
+255
+268
+281
+303
+326
+341
+357
+381
+405
+430
+447
+467
+487
+501
+514
+531
+547
+560
+574
+592
+607
+()
+4
+32
+77
+***
+359
+401
+446
+484
+515
+()
+3
+15
+38
+76
+87
+102
+112
+126
+***
+280
+292
+308
+323
+372
+414
+459
+495
+525
+548
+576
+599
+620
+635
+()
+2
+27
+***
+91
+***
+350
+***
+505
+540
+575
+609
+632
+()
+1
+21
+58
+107
+156
+194
+237
+274
+322
+***
+402
+***
+552
Added: test-suite/trunk/External/SPEC/CINT2000/186.crafty/186.crafty.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/186.crafty/186.crafty.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/186.crafty/186.crafty.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2000/186.crafty/186.crafty.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,169 @@
+
+Crafty v14.3
+
+White(1): White(1): pondering disabled.
+White(1): noise level set to 0.
+White(1): search time set to 99999.00.
+White(1): verbosity set to 5.
+White(1): search depth set to 10.
+White(1): White(1):
+ clearing hash tables
+
+ depth time score variation (1)
+ 1 ###.## 0.05 Bd3
+ 1-> ###.## 0.05 Bd3
+ 2 ###.## 0.01 Bd3 Qd7
+ 2 ###.## 0.08 Bb5+ Nc6 Bxc6+ bxc6 Qf3
+ 2-> ###.## 0.08 Bb5+ Nc6 Bxc6+ bxc6 Qf3
+ 3 ###.## -0.02 Bb5+ Nbd7 Qf3 e6
+ 3 ###.## 0.05 Qb3 Qd7 a4
+ 3-> ###.## 0.05 Qb3 Qd7 a4
+ 4 ###.## -0.08 Qb3 Qd7 Bb5 Nc6
+ 4 ###.## 0.02 Bb5+ Nbd7 Qf3 e6 Bd2
+ 4 ###.## 0.05 Qa4+ Nbd7 Qb5 Qb6 b4
+ 4-> ###.## 0.05 Qa4+ Nbd7 Qb5 Qb6 b4
+ 5 ###.## -0.08 Qa4+ Nbd7 Qb5 Qb6 Qxb6 Nxb6 Bb5+ Nbd7
+ 5 ###.## -0.03 Qb3 Qd7 Bb5 Nc6 Nf3
+ 5-> ###.## -0.03 Qb3 Qd7 Bb5 Nc6 Nf3
+ 6 ###.## -0.05 Qb3 Qd7 Bb5 Nc6 Qa4 e6 Bxc6 Qxc6 Qxc6+
+ bxc6
+ 6 ###.## -0.01 Bb5+ Nbd7 Qf3 e6 Bd2 a6 Be2
+ 6-> ###.## -0.01 Bb5+ Nbd7 Qf3 e6 Bd2 a6 Be2
+ 7 ###.## -0.08 Bb5+ Nbd7 Bd3 Bxd3 Qxd3 Rc8 Nf3 a5
+ O-O
+ 7 ###.## -0.04 Bd3 Bxd3 Qxd3 e6 Bd2 Qb6 Nb5 a5
+ 7 ###.## -0.02 Qa4+ Nc6 Bb5 Qd6 Bxc6+ Qxc6 Qxc6+ bxc6
+ Nf3 Rb8 Ne5 Rb6 <HT>
+ 7 ###.## -0.01 Qb3 Qd7 Nf3 Nc6 Ne5 Nxe5 dxe5 Ng4
+ 7-> ###.## -0.01 Qb3 Qd7 Nf3 Nc6 Ne5 Nxe5 dxe5 Ng4
+ 8 ###.## 0.07 Qb3 Qd7 Nf3 Nc6 Ne5 Nxe5 dxe5 Ng4 Bb5
+ 8-> ###.## 0.07 Qb3 Qd7 Nf3 Nc6 Ne5 Nxe5 dxe5 Ng4 Bb5
+ 9 ###.## 0.18 Qb3 Qd7 Nf3 e6 Bb5 Nc6 Ne5 Qd6 Nxc6
+ bxc6
+ 9-> ###.## 0.18 Qb3 Qd7 Nf3 e6 Bb5 Nc6 Ne5 Qd6 Nxc6
+ bxc6
+ 10 ###.## 0.20 Qb3 Qd7 Nf3 e6 Bb5 Nc6 Ne5 Qc7 Nxc6
+ bxc6 Be2
+ 10-> ###.## 0.20 Qb3 Qd7 Nf3 e6 Bb5 Nc6 Ne5 Qc7 Nxc6
+ bxc6 Be2
+ time:### cpu:### mat:0 n:7970959 nps: ####
+ ext-> checks:195120 recaps:47045 pawns:42 1rep:74037
+ predicted:0 nodes:7970959 evals:3896249
+ endgame tablebase-> probes done: 0 successful: 0
+ hashing-> trans/ref:14% pawn:95% used:w99% b99%
+
+White(1): Qb3
+ time used: ###.##
+Black(1): search depth set to 9.
+Black(1): Black(1):
+ clearing hash tables
+
+ depth time score variation (1)
+ 1 ###.## 0.10 Qd7
+ 1-> ###.## 0.10 Qd7
+ 2 ###.## 0.02 Qd7 Bb5
+ 2-> ###.## 0.02 Qd7 Bb5
+ 3 ###.## 0.08 Qd7 Bb5 Nc6
+ 3-> ###.## 0.08 Qd7 Bb5 Nc6
+ 4 ###.## 0.03 Qd7 Bb5 Nc6 Nf3
+ 4-> ###.## 0.03 Qd7 Bb5 Nc6 Nf3
+ 5 ###.## 0.05 Qd7 Bb5 Nc6 Qa4 e6 Bxc6 Qxc6 Qxc6+
+ bxc6
+ 5-> ###.## 0.05 Qd7 Bb5 Nc6 Qa4 e6 Bxc6 Qxc6 Qxc6+
+ bxc6
+ 6 ###.## -0.08 Qd7 Bb5 Nc6 Qa4 e6 Bxc6 Qxc6 Qxc6+
+ bxc6
+ 6-> ###.## -0.08 Qd7 Bb5 Nc6 Qa4 e6 Bxc6 Qxc6 Qxc6+
+ bxc6
+ 7 ###.## -0.11 Qd7 Nf3 Nc6 Ne5 Nxe5 dxe5 Ng4 Bb5
+ 7-> ###.## -0.11 Qd7 Nf3 Nc6 Ne5 Nxe5 dxe5 Ng4 Bb5
+ 8 ###.## -0.31 Qd7 Nf3 e6 Bb5 Nc6 Ne5 Qd6 Nxc6 bxc6
+ 8-> ###.## -0.31 Qd7 Nf3 e6 Bb5 Nc6 Ne5 Qd6 Nxc6 bxc6
+ 9 ###.## -0.42 Qd7 Nf3 e6 Nh4 Nc6 Nxf5 exf5 Bd2 f4
+ Rc1 fxe3 Bxe3
+ 9 ###.## -0.34 Bc8 Bd2 Nc6 Rc1 Qd6 Nb5 Qd7 f4 Qg4
+ 9-> ###.## -0.34 Bc8 Bd2 Nc6 Rc1 Qd6 Nb5 Qd7 f4 Qg4
+ time:### cpu:### mat:0 n:2693851 nps: ####
+ ext-> checks:70336 recaps:15001 pawns:1 1rep:20183
+ predicted:0 nodes:2693851 evals:1232956
+ endgame tablebase-> probes done: 0 successful: 0
+ hashing-> trans/ref:19% pawn:96% used:w99% b99%
+
+Black(1): Bc8
+ time used: ###.##
+White(2): search depth set to 9.
+White(2): Black(2):
+ depth time score variation (1)
+ 1 ###.## 2.30 Ngxe5
+ 1-> ###.## 2.30 Ngxe5
+ 2 ###.## -- Ngxe5
+ 2 ###.## 1.97 Ngxe5 Re1
+ 2-> ###.## 1.97 Ngxe5 Re1
+ 3 ###.## 2.03 Ngxe5 Nxe5 Nxe5 Re1
+ 3-> ###.## 2.03 Ngxe5 Nxe5 Nxe5 Re1
+ 4 ###.## 1.94 Ngxe5 Re1 Qd6 Bd3
+ 4-> ###.## 1.94 Ngxe5 Re1 Qd6 Bd3
+ 5 ###.## 1.98 Ngxe5 Re1 Qd6 Qe2 d3
+ 5-> ###.## 1.98 Ngxe5 Re1 Qd6 Qe2 d3
+ 6 ###.## -- Ngxe5
+ 6 ###.## 0.83 Ngxe5 Nxe5 Nxe5 Re1 f6 Nf3 c5 Nxe5
+ fxe5 Rxe5+
+ 6-> ###.## 0.83 Ngxe5 Nxe5 Nxe5 Re1 f6 Nf3 c5 Nxe5
+ fxe5 Rxe5+
+ 7 ###.## -- Ngxe5
+ 7 ###.## 0.18 Ngxe5 Nxe5 Nxe5 Re1 f6 f4 Qe7 fxe5
+ fxe5
+ 7-> ###.## 0.18 Ngxe5 Nxe5 Nxe5 Re1 f6 f4 Qe7 fxe5
+ fxe5
+ 8 ###.## 0.32 Ngxe5 Nxe5 Nxe5 Re1 f6 f4 d3 fxe5 Qd4+
+ Kh1 fxe5
+ 8-> ###.## 0.32 Ngxe5 Nxe5 Nxe5 Re1 f6 f4 d3 fxe5 Qd4+
+ Kh1 fxe5
+ 9 ###.## 0.29 Ngxe5 Nxe5 Nxe5 Re1 f6 f4 d3 Qa4+ Bd7
+ Qb3 b5 fxe5 bxc4 exf6+
+ 9-> ###.## 0.29 Ngxe5 Nxe5 Nxe5 Re1 f6 f4 d3 Qa4+ Bd7
+ Qb3 b5 fxe5 bxc4 exf6+
+ time:### cpu:### mat:1 n:1825740 nps: ####
+ ext-> checks:65262 recaps:7175 pawns:293 1rep:14402
+ predicted:0 nodes:1825740 evals:839128
+ endgame tablebase-> probes done: 0 successful: 0
+ hashing-> trans/ref:19% pawn:96% used:w99% b99%
+
+Black(2): Ngxe5
+ time used: ###.##
+White(3): search depth set to 8.
+White(3): White(3):
+ clearing hash tables
+
+ depth time score variation (1)
+ 1 ###.## -0.01 Bxf6 Bxf6
+ 1 ###.## 0.29 Bh6
+ 1-> ###.## 0.29 Bh6
+ 2 ###.## 0.14 Bh6 a5
+ 2-> ###.## 0.14 Bh6 a5
+ 3 ###.## 0.22 Bh6 a5 Rbc1
+ 3-> ###.## 0.22 Bh6 a5 Rbc1
+ 4 ###.## 0.07 Bh6 Ng4 Bf4 a5
+ 4 ###.## 0.08 Bf4 a5 Bh6 Bd6
+ 4 ###.## 0.16 Rbc1 a5 Bh6 Bd6 <HT>
+ 4-> ###.## 0.16 Rbc1 a5 Bh6 Bd6 <HT>
+ 5 ###.## 0.08 Rbc1 Ne6 Bh4 a5 Bg3
+ 5 ###.## 0.12 Bf4 Ne6 Be5 a5 Rbc1
+ 5 ###.## 0.15 h3 a5 Bh6 Bd6 Rbc1
+ 5-> ###.## 0.15 h3 a5 Bh6 Bd6 Rbc1
+ 6 ###.## 0.09 h3 a5 Bh6 Bd6 Qb3 Ne4
+ 6-> ###.## 0.09 h3 a5 Bh6 Bd6 Qb3 Ne4
+ 7 ###.## 0.06 h3 a5 Bh6 Ne6 Rbc1 Bf8 Bxf8 Kxf8
+ 7-> ###.## 0.06 h3 a5 Bh6 Ne6 Rbc1 Bf8 Bxf8 Kxf8
+ 8 ###.## 0.09 h3 a5 Bh6 Ne6 Rbc1 Bf8 Bxf8 Kxf8 Qb3
+ 8-> ###.## 0.09 h3 a5 Bh6 Ne6 Rbc1 Bf8 Bxf8 Kxf8 Qb3
+ time:### cpu:### mat:0 n:1090232 nps: ####
+ ext-> checks:3568 recaps:6868 pawns:1 1rep:2640
+ predicted:0 nodes:1090232 evals:480666
+ endgame tablebase-> probes done: 0 successful: 0
+ hashing-> trans/ref:26% pawn:98% used:w94% b99%
+
+White(3): h3
+ time used: ###.##
+Black(3): execution complete.
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2000/186.crafty/186.crafty.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/186.crafty/186.crafty.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/186.crafty/186.crafty.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CINT2000/186.crafty/186.crafty.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,152 @@
+
+Crafty v14.3
+
+White(1): White(1): pondering disabled.
+White(1): noise level set to 0.
+White(1): search time set to 99999.00.
+White(1): verbosity set to 5.
+White(1): search depth set to 8.
+White(1): White(1):
+ clearing hash tables
+
+ depth time score variation (1)
+ 1 ###.## 0.45 Bd4
+ 1-> ###.## 0.45 Bd4
+ 2 ###.## 0.36 Bd4 Kg8
+ 2 ###.## 0.38 Qe3 a5
+ 2-> ###.## 0.38 Qe3 a5
+ 3 ###.## 0.41 Qe3 g6 Nd4
+ 3 ###.## 0.42 g4 Kg8 Bd4
+ 3-> ###.## 0.42 g4 Kg8 Bd4
+ 4 ###.## 0.35 g4 Kg8 Bd4 a5
+ 4 ###.## 0.36 Qe3 a5 Bd4 Kg8
+ 4 ###.## ++ Nh6!!
+ 4 ###.## 2.27 Nh6 Qxh3 Nxf7+ Kg8 gxh3 Kxf7
+ 4-> ###.## 2.27 Nh6 Qxh3 Nxf7+ Kg8 gxh3 Kxf7
+ 5 ###.## 2.27 Nh6 Qxh3 Nxf7+ Kg8 gxh3 Kxf7
+ 5-> ###.## 2.27 Nh6 Qxh3 Nxf7+ Kg8 gxh3 Kxf7
+ 6 ###.## 2.33 Nh6 Qxh3 Nxf7+ Kg8 gxh3 Kxf7 Bd4
+ 6-> ###.## 2.33 Nh6 Qxh3 Nxf7+ Kg8 gxh3 Kxf7 Bd4
+ 7 ###.## 2.19 Nh6 Qxh3 Nxf7+ Kg8 gxh3 Kxf7 Bd4 g5
+ 7-> ###.## 2.19 Nh6 Qxh3 Nxf7+ Kg8 gxh3 Kxf7 Bd4 g5
+ 8 ###.## 2.21 Nh6 Qxh3 Nxf7+ Kg8 gxh3 Kxf7 Bd4 g5
+ a4
+ 8-> ###.## 2.21 Nh6 Qxh3 Nxf7+ Kg8 gxh3 Kxf7 Bd4 g5
+ a4
+ time:### cpu:### mat:2 n:351574 nps: ####
+ ext-> checks:5636 recaps:952 pawns:9 1rep:3230
+ predicted:0 nodes:351574 evals:61843
+ endgame tablebase-> probes done: 0 successful: 0
+ hashing-> trans/ref:29% pawn:96% used:w73% b97%
+
+White(1): Nh6
+ time used: ###.##
+Black(1): search depth set to 8.
+Black(1): Black(1):
+ clearing hash tables
+
+ depth time score variation (1)
+ 1 ###.## -1.31 d5 exd5
+ 1 ###.## 0.51 e5
+ 1-> ###.## 0.51 e5
+ 2 ###.## -- e5
+ 2 ###.## -0.44 e5 h4
+ 2 ###.## 0.25 Nc5 Nxc5 Qxc5
+ 2-> ###.## 0.25 Nc5 Nxc5 Qxc5
+ 3 ###.## -- Nc5
+ 3 ###.## -0.35 Nc5 Nxc5 Qxc5 a4
+ 3 ###.## -0.19 Rfd8 h4 Nc5
+ 3-> ###.## -0.19 Rfd8 h4 Nc5
+ 4 ###.## -0.19 Rfd8 h4 Nc5 Nxc5 Qxc5
+ 4 ###.## -0.13 Nh5 g3 Nc5 Nxc5 Qxc5
+ 4-> ###.## -0.13 Nh5 g3 Nc5 Nxc5 Qxc5
+ 5 ###.## -0.15 Nh5 g3 Rfd8 Bd4 Nhf6
+ 5-> ###.## -0.15 Nh5 g3 Rfd8 Bd4 Nhf6
+ 6 ###.## -0.27 Nh5 Qe3 Bf6 h4 Nc5 Bxf6 Nxf6 Nxc5 Qxc5
+ Qxc5 Rxc5
+ 6 ###.## ++ Bxe4!!
+ 6 ###.## 1.23 Bxe4 Bxe4 Qxc4 Qxc4 Rxc4 Nxb6 Rxe4
+ 6-> ###.## 1.23 Bxe4 Bxe4 Qxc4 Qxc4 Rxc4 Nxb6 Rxe4
+ 7 ###.## 1.28 Bxe4 Bxe4 Qxc4 Qxc4 Rxc4 Nxb6 Rxe4
+ Bd4 Nxb6 Bxb6
+ 7-> ###.## 1.28 Bxe4 Bxe4 Qxc4 Qxc4 Rxc4 Nxb6 Rxe4
+ Bd4 Nxb6 Bxb6
+ 8 ###.## 1.12 Bxe4 Bxe4 Qxc4 Qxc4 Rxc4 Nxb6 Nxb6
+ Bd3 Rc5
+ 8-> ###.## 1.12 Bxe4 Bxe4 Qxc4 Qxc4 Rxc4 Nxb6 Nxb6
+ Bd3 Rc5
+ time:### cpu:### mat:1 n:418833 nps: ####
+ ext-> checks:2221 recaps:2586 pawns:1 1rep:622
+ predicted:0 nodes:418833 evals:165004
+ endgame tablebase-> probes done: 0 successful: 0
+ hashing-> trans/ref:45% pawn:98% used:w77% b87%
+
+Black(1): Bxe4
+ time used: ###.##
+White(2): search depth set to 8.
+White(2): Black(2):
+ depth time score variation (1)
+ 1 ###.## 0.02 Bf5
+ 1-> ###.## 0.02 Bf5
+ 2 ###.## -0.13 Bf5 e6
+ 2-> ###.## -0.13 Bf5 e6
+ 3 ###.## -0.07 Bf5 e6 O-O
+ 3-> ###.## -0.07 Bf5 e6 O-O
+ 4 ###.## 0.02 Bf5 Rac1 O-O Rfd1
+ 4-> ###.## 0.02 Bf5 Rac1 O-O Rfd1
+ 5 ###.## 0.07 Bf5 Rf2 O-O Rd1 Qc7
+ 5-> ###.## 0.07 Bf5 Rf2 O-O Rd1 Qc7
+ 6 ###.## 0.06 Bf5 Rf2 O-O Rd1 Re8 Rfd2 <HT>
+ 6-> ###.## 0.06 Bf5 Rf2 O-O Rd1 Re8 Rfd2 <HT>
+ 7 ###.## 0.11 Bf5 Rf2 O-O Rd1 Re8 Rfd2 Kf8
+ 7-> ###.## 0.11 Bf5 Rf2 O-O Rd1 Re8 Rfd2 Kf8
+ 8 ###.## 0.08 Bf5 Rf2 b6 Qd2 O-O Rd1 Re8 Qd4
+ 8-> ###.## 0.08 Bf5 Rf2 b6 Qd2 O-O Rd1 Re8 Qd4
+ time:### cpu:### mat:0 n:464547 nps: ####
+ ext-> checks:4283 recaps:1311 pawns:33 1rep:2895
+ predicted:0 nodes:464547 evals:181507
+ endgame tablebase-> probes done: 0 successful: 0
+ hashing-> trans/ref:30% pawn:95% used:w90% b97%
+
+Black(2): Bf5
+ time used: ###.##
+White(3): search depth set to 7.
+White(3): White(3):
+ clearing hash tables
+
+ depth time score variation (1)
+ 1 ###.## -0.25 b5 fxe4 Bxe4
+ 1 ###.## 0.07 h3 fxe4 Bxe4
+ 1 ###.## 0.08 g3 fxe4 Bxe4
+ 1 ###.## 0.17 Re1 fxe4 Bxe4
+ 1 ###.## 0.31 bxc5 bxc5
+ 1-> ###.## 0.31 bxc5 bxc5
+ 2 ###.## 0.05 bxc5 f4
+ 2-> ###.## 0.05 bxc5 f4
+ 3 ###.## -0.08 bxc5 f4 Bxf4 exf4 cxb6
+ 3 ###.## -0.06 g3 f4 gxf4
+ 3 ###.## 0.02 exf5 cxb4 axb4 Bxf5 Bxf5 Rxf5
+ 3-> ###.## 0.02 exf5 cxb4 axb4 Bxf5 Bxf5 Rxf5
+ 4 ###.## 0.14 exf5 cxb4 axb4 Bxf5 Re1
+ 4-> ###.## 0.14 exf5 cxb4 axb4 Bxf5 Re1
+ 5 ###.## -0.01 exf5 gxf5 g3 f4 gxf4 Bh3
+ 5 ###.## 0.04 f4 cxb4 axb4 fxe4 Nxe4 Ba4 Rbb1
+ 5-> ###.## 0.04 f4 cxb4 axb4 fxe4 Nxe4 Ba4 Rbb1
+ 6 ###.## 0.09 f4 cxb4 axb4 fxe4 Bxe4 Qf6 c5 Rb8 cxd6
+ Nxd6
+ 6-> ###.## 0.09 f4 cxb4 axb4 fxe4 Bxe4 Qf6 c5 Rb8 cxd6
+ Nxd6
+ 7 ###.## 0.26 f4 cxb4 axb4 Qh4 fxe5 Bxe5 g3 Qh3 exf5
+ Bxf5 Bxf5 Rxf5 Rxf5 gxf5
+ 7-> ###.## 0.26 f4 cxb4 axb4 Qh4 fxe5 Bxe5 g3 Qh3 exf5
+ Bxf5 Bxf5 Rxf5 Rxf5 gxf5
+ time:### cpu:### mat:0 n:761245 nps: ####
+ ext-> checks:3019 recaps:4116 pawns:19 1rep:1265
+ predicted:0 nodes:761245 evals:537402
+ endgame tablebase-> probes done: 0 successful: 0
+ hashing-> trans/ref:29% pawn:92% used:w92% b75%
+
+White(3): f4
+ time used: ###.##
+Black(3): execution complete.
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2000/197.parser/197.parser.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/197.parser/197.parser.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/197.parser/197.parser.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2000/197.parser/197.parser.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,322 @@
+
+ Reading the dictionary files: *************************************************
+
+
+Welcome to the Link Parser -- Version 2.1
+
+ Copyright (C) 1991-1995 Daniel Sleator and Davy Temperley
+
+Processing sentences in batch mode
+
+Echoing of input sentence turned on.
+ this is the nation 's most dramatic shift in a century in the way public schools are financed
+ Michigan will begin using sales and other taxes , not property taxes , to pay for its 3286 schools .
+ the plan is being examined by several states ; 28 are now mired in lawsuits about the inequities of financing from property taxes .
+ backed by Governor John M Engler , a conservative Republican who faces reelection this fall , the plan improves schools
+ the plan was intended to help improve schools without increasing the burden on property owners .
+ less than 10 percent of school financing would come from property taxes , accomplishing Mr Engler 's initial goal
+ the plan also equalizes expenditures in rich and poor school districts , a goal liberals have sought in many states for more than 20 years
+ it is a huge vote , Mr Engler said by telephone today
+ the property tax had been a terrible problem in the state because of the relentless increases for schools
+ school officials across the state as well as critics wonder whether sales tax receipts are too volatile to support public education in the future
+ but the state 's venture into uncharted terrain has drawn keen interest from other states .
+ in the last month , the Wisconsin Legislature approved two competing proposals that would limit a school district 's reliance on property taxes
+ after weeks of intense negotiations , the United States announced steps today to help peace talks resume between Israel and the Palestinians
+ it also cleared the way for the passage today of a United Nations Security Council resolution condemning the massacre last month in Hebron
+ at a short news conference , Secretary of State Warren Christopher announced that Syria , Lebanon and Jordan agreed to come back
+ they agreed to come back to the peace talks in Washington next month .
+ Mr Christopher also told reporters that in the coming days there will be a meeting of senior-level representatives of Israel and the Palestine Liberation Organization .
+ this would be a prelude to resuming formal talks to settle details of their accord on introducing self-rule in Jericho and the Gaza Strip .
+ Israeli and P L O officials will announce that they will meet quite soon to take up security measures on the West Bank
+ they will also take up the possible resumption of these negotiations at an early time , Mr Christopher said .
+ the announcement missed the Administration 's ultimate goal , an unequivocal commitment from the P L O chairman , Yasir Arafat
+ they wanted Arafat to talk with Israel to complete the details of the peace agreement , signed at the White House last September
+ Mr Christopher said the fact that the three Arab nations involved in peace talks in Washington decided to move ahead would help
+ the fact that the nations decided to move ahead of the Palestinians would provide a strong impetus
+ this provides an impetus to the P L O to get back to the bargaining table and conclude arrangements on the accord with Israel
+ after the massacre , the Clinton administration offered to host an open-ended round of talks in Washington
+ they will host talks until the Israelis and Palestinians decided how they would put their accord into practice
+ in separate telephone conversations , both Mr Arafat and Prime Minister Yitzhak Rabin of Israel told Mr Christopher that they would accept the offer
+ two of the nation 's wealthiest entrepreneurs in communications and computers , Craig O McCaw and William H Gates , plan to disclose the formation of a company
+- the company will develop a global satellite communications network far more ambitious than anything contemplated before
+ even for businessmen with their records , the task is daunting
+ their new company , the Teledesic Corporation of Kirkland , Washington , is proposing to build a nine-billion-dollar system with 840 small satellites .
+ the network would transport information ranging from ordinary telephone calls to high-resolution computerized medical images and two-way video conferences
+ it would transport it to and from virtually any spot on the planet
+ as it is envisioned , the system would be able to deliver almost as many services as the new fiber optic networks being built by many telephone companies
+ but it would be able to reach underdeveloped and rural areas that are typically cut off from advanced communications
+ the real promise of this system is to bring access for rural and remote areas of the world to the health and education services
+ this system gives access to services that you can get in major urban centers , Ruseell Daggatt , the president of Teledesic , said .
+ Mr Daggatt , a telecommunications lawyer , will be leading a project that has been under hushed development for three years .
+ some industry analysts today cautioned that it would be premature to dismiss the concept simply because of its extraordinary scale .
+ indeed , the Motorola Corporation has defied many skeptics in its effort to build a three-billion-dollar satellite telephone system
+ they built a system called Iridium that would use 66 spacecraft
+ the United States started to build support today at the United Nations for tougher measures against North Korea , including economic sanctions .
+ it also moved toward strengthening its military position on the Korean peninsula by ordering the dispatch of Patriot interceptors .
+ the administration 's actions are the latest moves in the growing confrontation between the United States and North Korea
+ the confrontation is over the Koreans ' refusal to allow full inspection of its nuclear program
+ but to reassure South Korea , which has been nervous about accepting the Patriot missiles , President Clinton has sent a letter to President Kim Young Sam
+ the letter says Washington would consider a North Korean attack on South Korea to be an attack on the United States , American officials said .
+ the message was that we have been working on this together and that we must resist North Korea 's efforts
+ we must resist the efforts to try to drive us apart , a senior Administration official said .
+ the United States action at the United Nations came after the board of the International Atomic Energy Agency passed a measure
+ they passed a measure demanding that North Korea permit inspectors to complete their work and referring the matter to the Security Council
+ Madeleine K Albright , the chief United States delegate to the United Nations , met today with delegates of the other four permanent members of the Security Council
+ they met to discuss a draft resolution urging North Korea to comply with the energy agency 's demands
+ the draft refers indirectly to the possibility of sanctions and mentions further action by the Security Council
+- it mentions further action if the North Koreans do not relent , a senior Western diplomat said
+ while Britain and France are supportive and France , which is heading the Council this month , is urging a tough line , China 's response is a big question mark
+ as a permanent member , China has a veto in the Council and its cooperation will be needed
+ its cooperation will be needed if a firm warning is to be issued and sanctions are to be imposed .
+ Citibank , Chase Manhattan , Chemical and a host of other banks increased their prime rates yesterday to 7 percent from 6 percent
+ they raised their rates after the Federal Reserve 's decision on Tuesday to raise short-term interest rates to fend off inflation
+ the prime-rate increase will mean higher interest for millions of consumers and businesses
+ the rates on many mortgages , credit cards and small-business loans are linked to the prime
+ it is the first increase in the prime since February , when it was 11 percent .
+ most banks have set their rates at 6 percent since July .
+ bankers said the increase in the prime was a natural consequence of the increase in the interest rate on Federal funds
+ there was an increase in the rate for overnight loans between banks , to 3 percent from 2 percent .
+- the Federal funds rate is set in an open market , but it is heavily influenced by the trading activity of the Federal Reserve
+ this is what the Fed wanted , said Arjun K Mathrani , the treasurer of the Chase Manhattan Bank
+- if the Federal funds rate went up , it wouldn't have the inflation-fighting effect the Fed expects
+ he noted that interest rates had remained low for almost two years
+ he also noted that banks had reduced the rates they set for certain types of borrowing
+ the consumer has benefited dramatically over the last 18 months as rates declined and banks reduced their rates
+ banks reduced their rates , especially on credit cards , Mr Mathrani said
+ with a bill that bans smoking stalled in Congress , the Labor Department seems prepared to do what the Congress has not done by law
+ the bill bans smoking in virtually all buildings in the country except private homes
+ the Occupational Safety and Health Administration has proposed a rule to ban smoking in the workplace , Labor Secretary Robert B Reich announced today
+ of the more than 70 million Americans who work indoors , OSHA estimates that 21 million are exposed to poor indoor air
+ it estimates that 21 million are exposed and that millions of others are exposed to secondhand smoke
+ OSHA has taken this action to prevent thousands of heart disease deaths and hundreds of lung cancer deaths
+ it also prevents the respiratory diseases and other ailments linked to these hazards , Mr Reich said
+ according to the Environmental Protection Agency and the Centers for Disease Control and Prevention , secondhand smoke causes 3000 deaths each year from lung cancer
+ it also causes 150000 cases of bronchitis and pneumonia in youngsters , and asthma attacks in many others
+ secondhand smoke has also been implicated in deaths from heart disease and other forms of cancer
+ the ban in the workplace would affect fewer people than the proposed legislative ban in all buildings entered by more than 10 people per week
+ but it would nonetheless apply to more than six million indoor workplaces , from offices to factories to restaurants
+ it would cost businesses 6 billion dollars per year to comply with the ban , the Labor Department said
+ but it would also yield 15 billion dollars in annual benefits
+ the benefits would be in increased worker productivity , reduced absenteeism and reduced health care costs , the department said
+ the ban would be enforced by OSHA inspectors visiting workplaces to investigate reported violations of other OSHA regulations
+ China 's frenetic economic boom and natural forces are shrinking the country 's farmland at an alarming rate , scientists and Government officials say .
+ as a result , Chinese and Western scientists are raising new questions about the country 's ability to feed itself in the future
+ in China 's central and eastern provinces , the country 's breadbasket for three milleniums , farmers are abandoning the land to chase prosperity in big cities and towns
+ there , tens of thousands of new factories have opened under the economic reforms of Deng Xiaoping , China 's paramount leader
+ in southern and coastal areas , provincial governments and local entrepreneurs , all racing to get rich , are paving over agricultural land
+ they are doing this for freeways and factories , plus shopping centers , golf courses and villas for the new millionaires .
+ here in the arid northwest area , deserts are encroaching and erosion is ripping away topsoil on millions of acres that once were fertile
+ in this dusty frontier town in Cansu Province , where peasants pushed back the sand dunes , there is a campaign
+ in this dusty frontier town , tens of thousands of peasants pushed back the sand dunes and tumbleweed to build a county seat in 1970
+ the campaign to reclaim fertile land represents the largest part of daily life and government expenditure
+ the winds beat against man-made defenses of tree lines and hedges built like so many ramparts to protect or hold precious topsoil
+ Pamela Schmale , a 39-year-old bookkeeper , says she felt that her only hope of surviving advanced breast cancer was to have a bone marrow transplant
+ but her insurance company said it would not pay for the expensive and risky procedure , which is still undergoing clinical tests
+ in desperation , Mrs Schmale and her husband , Arthur , mortgaged their house in Boring , Oregon , to raise the 100000 dollars they would need for the transplant .
+ and her doctors recommended lawyers who might fight their insurance company for them
+ the Schmales hired Sheldon Weinhaus , a lawyer in St Louis who persuaded Mrs Schmale 's insurance company
+ they hired Weinhaus , a lawyer who persuaded them to pay the full cost of the transplant , which Mrs Schmale had in January
+ although Mrs Schmale said her doctors told her it was too soon to know whether she would be helped , she was confident that she had done the right thing
+ I think it saved my life , she said
+ in the last several years , patients have been increasingly turning to lawyers
+ they have turned to lawyers to pressure insurance companies to pay for claims that were initially denied
+ some claims are even for treatments specifically excluded under their insurance plans .
+ this practice can help critically ill patients get access to treatments they desperately want
+ but it raises issues of fairness , because the rewards go to those with the means to hire a lawyer
+ Mr Weinhause said that lawyers charged about 1000 dollars for an insurance case and that they were not hired in such a case on a contingency basis .
+ bowing to student protesters who have disrupted more than a dozen French cities during the last three weeks , he abandoned it
+- Prime Minister Edouard Balladur today abandoned a Government decree
+ the decree allowed young people to be paid less than the minimum wage
+ after a arranged meeting between Mr Balladur and student leaders this morning , a spokesman for the conservative coalition Government said the decree had been suspended
+ it was suspended for one week to give time for a new policy to be developed and to put an end to the so-called youth wage .
+ the move was anticipated by Mr Balladur himself in a brief television address Sunday night
+ he referred to young people 's anxiety about their future and noted that we must start to restore a dialogue with them and examine various possible solutions
+ but the retreat is no less embarrassing for the Minister , reinforcing the view that he backs down in the face of protests .
+ on two other recent occasions , he dropped policies after angry demonstrations .
+ student leaders were delighted by their victory , but they vowed to stay on the alert until the decree is revoked .
+ last Friday , 200000 youths marched through Paris and a dozen other cities to denounce the decree .
+ some protests continued today , and a new demonstration is scheduled here Thursday .
+ some students warned that the Government was hoping the Easter study break would disperse the movement .
+ one student leader , Philippe Campinchi , noted that suspending the decree is good ; withdrawing it is better .
+ but Helene Joubert , another leader , sounded triumphant .
+ the youth wage will be history within one week , she said .
+ the first reasonably complete skull of the earliest recognized human ancestors after the split from the great apes has been found
+ it has been found near the bank of a dry riverbed in Ethiopia 's arid badlands
+- the skull , with its apelike heavy brow , jutting jaw and small brain case , is apparently that of a large male who lived three million years ago
+ the remarkable find , which fills a serious gap in understanding early human evolution , gives a face to the species
+ the species was first identified and made famous by the discovery in 1974 of the headless Lucy skeleton
+ without a skull , scientists had not been sure what these creatures looked like or what Lucy 's position was in the human lineage .
+ the discovery could thus settle some of the hotly debated issues over whether the varied fossils from this time belonged to a species
+ it settled the issue over whether the fossils , 3.9 million years ago , belonged to one or two species
+ they may have belonged to a single species , known as Australopithecus Afarensis and considered the common root of the human family tree
+ they may also have represented two or more species of different sizes and behavior .
+ as the White House and Congress debate the best way to reshape the nation 's health care system , an overriding concern remains
+ what effect will the final plan have on the quality of care Americans receive
+ many Americans , those with money or health insurance , now get the best medical care in the world
+ under the proposals now before Congress many more would get access to basic and preventive care .
+ but at the same time , hospitals and health maintenance organizations are coming under pressure to reduce costs
+ and even some Clinton Administration officials worry that quality could decline without safeguards
+ both the Administration 's health plan and competing proposals seek to answer that concern
+ they seek to answer that concern by devising ways to monitor and improve quality while holding down costs
+ but the White House and other health experts agree that the science of measuring quality is in its infancy
+ the science is in its infancy , making it unlikely that it could be applied on a national scale soon .
+ that could cloud a scenario of the Clinton plan in which patients would make choices
+ patients , armed with information about the performance of competing doctors , hospitals and HMOS , would make choices
+ they would choose those most likely to provide high-quality care at the most reasonable prices , forcing the others to improve or get out of the business .
+ there is a tremendous need to develop measures of quality , said Dr David M Eddy
+ but anyone who believes that we have all the measures we need right now is kidding themselves
+ there is a tremendous need , said Dr David M Eddy , a professor of health policy and management at Duke University
+ he is a professor who helped develop the Administration 's proposals on quality
+ that assessment was echoed by Dr Jesse Green , the director of health policy research at the N Y U School of Medicine .
+ I think we are raising the expectations of people far beyond the ability to deliver information , he said .
+ with long-term interest rates now above 7 percent , President Clinton 's top economic advisers expressed concern over the weekend
+ they expressed concern that further rate increases could damage the economy and slow growth to an unacceptable level
+ the Administration argues that the economy is going through a transition from very strong growth in last year 's fourth quarter to less growth now
+ but no one can tell where the leveling-off point will be
+ the concern is that if interest rates rise , economic growth could decline too much , slowing the creation of new jobs
+ based on what we know , our view of how strongly the economy will grow this year is not changed by an interest rate in the neighborhood of 7 percent
+ our view is not changed , said Laura Dandrea Tyson , the chairwoman of the Council of Economic Advisers
+ but if the level goes much above 7 percent , then that would exercise a contractionary effect on the economy
+ Long-term interest rates rose nearly three quarters of a point during the last month , reaching 7.26 percent on Friday
+ it reached 7.26 percent in a bond-trading session shortened in observance of Good Friday
+ not since 1981 have rates increased so much in a single month , and the comments by Ms Tyson and other Administration officials were aimed
+ the comments were clearly aimed at calming the markets
+ the Administration 's new concerns could put it in open conflict for the first time with the Federal Reserve Board
+ they may conflict with the Federal Reserve Board , whose chief priority has been to control inflation even at the cost of economic growth
+ the Administration 's priority has been creation of jobs through economic expansion , even at the possible cost of an inflation rate
+ they do it at the cost of a rate that is slightly higher than what the Fed might accept
+ David J Askin entered the small conference room of his Lexington Avenue office last Monday to face his investors
+ he faced his investors : blue-chip corporations , pension funds and wealthy families
+ they had entrusted him with 600 million dollars in what was billed as a low-risk approach to investing in bonds backed by home mortgages
+ but as interest rates rose in recent months , his two investment funds lost more than 100 million dollars
+ several dozen investors were there in person , and 20 more were on the speakerphone
+ what they heard did not please them
+ Mr Askin said he needed 40 million to 50 million dollars immediately because several brokerage firms were seeking more money to cover his funds ' losses
+ if the cash could not be raised , their entire investment was in jeopardy
+ in the days that followed , bond prices continued to plunge , and the size of the bailout needed mushroomed to 120 million dollars
+ then they heard on Wednesday that the brokerage firms were liquidating the funds ' holdings in a string of fire sales
+ when the markets closed for the holiday weekend on Thursday , it appeared that most of the funds had been lost
+ Senator George J Mitchell of Maine emerged today as a leading candidate to succeed Justice Harry A Blackmun , who is retiring as the senior member of the Supreme Court
+ the White House began almost immediately to weigh the potential consequences of nominating him
+ in a White House ceremony this morning , President Clinton paid emotional tribute to Justice Blackmun , who said he would remain
+ he would remain on the Court until late September unless a successor was confirmed before then .
+ White House officials indicated that the President was in no hurry to settle on a replacement for the eighty-five-year-old Justice .
+ Mr Clinton spoke generally about his second opportunity to fill a vacancy on the Court .
+ in a voice choked with admiration , he hailed Justice Blackmun , who wrote the landmark Roe Versus Wade decision that legalized abortion
+ he hailed Justice Blackmun as a jurist of majesty and reason , with scholarship and grace .
+ in stepping down after 24 years on the nation 's highest court , Justice Blackmun would step into our history , Mr Clinton said
+ Mr Clinton stood quietly by the President 's side in the Roosevelt Room of the White House , his hands folded before him
+ later , at his own news conference at the Court , he said he had decided to retire before age overtook him .
+ the age of 85 is pretty old , Mr Blackmun said dryly
+ I don't want to reach a point where my senility level reaches unacceptable proportions
+ and I don't want to be asked to retire like Oliver Wendell Holmes Jr , who stepped down in 1932 at the age of 90
+ a man armed with a hammer and a spear gun attacked the flight crew of a Federal Express cargo plane today
+ he attacked them before the crew wrestled him to the floor and the captain safely landed the plane
+ three people aboard the DC10 were critically injured and a fourth suffered less serious injuries , said Rick Roberts of the Regional Medical Center at Memphis
+ the suspected attacker was among the most seriously hurt people , said Dick Marquise , an agent of the Federal Bureau of Investigation
+ Larry Cox , the president of the Memphis Shelby County Airport Authority , said the crew members suffered head and body injuries
+ they were very bloody , Mr Cox said
+- it looked like they had been in an explosion or a film you would see of Vietnam
+ it must have been hand-to-hand combat
+ only the pilot was still able to fly after the attack , and he brought the plane in
+ he brought the plane in , Mr Cox said , adding that the captain obviously had great skill
+ Federal Express identified its plane 's crew as Captain David G Sanders , 49 , and James M Tucker , 42 , the first officer
+ the crew also included Andre H Peterson , 39 , the second officer
+ the passenger was Auburn Calloway , 42 , a DC10 second officer with Federal Express , the company said
+ no one else was on the plane , Federal Express said
+ a Federal panel today cleared the way for Government approval of the first genetically engineered food
+ they cleared the way for the food , a firmer tomato that can ripen longer on the vine before being picked for shipment
+ after three days of hearings , Dr David A Kessler , the Commissioner of Food and Drugs , said action would come within 90 days
+ he said he thought that final action on the tomato , called the Flavr Savr , would come within 90 days
+ other agency officials said approval was expected
+ although no official vote was taken , Dr Kessler said he heard no dissent today on the safety evaluation of the Flavr Savr tomato
+ he said the committee thought that the evaluation of the Flavr Savr was exceptionally thorough
+ while the tomato sailed through , members of the panel , the Food Advisory Committee , said proponents and critics raised questions
+ critics of genetic engineering techniques in food raised questions about the agency 's policy on biotechnology products
+ the tomato is the first of an expected wave of genetically engineered foods headed to market
+ already there are other types of genetically engineered products , including biochemicals used to make cheese and a hormone to stimulate the milk production of cows
+ the cattle hormone has prompted protests
+ the members of the F D A committee , which met here outside Washington , gave high marks to Calgene Inc , which makes the tomato
+ the company produced a substantial amount of data to show it was safe
+ the agency 's approval is not technically required before the tomato goes into supermarkets
+ still , the company sought the agency 's approval to insure a smooth path to market
+ the new director of the National Association for the Advancement of Colored People held a closed meeting on Friday with black militants and leftists
+ he held a meeting to discuss increasing their influence in the organization
+ the session has angered NAACP board members , who learned of it only afterward
+ the meeting in Detroit was led by the group 's executive director , Dr Benjamin F Chavis Jr , whose spokesman spoke today
+ his spokesman said today that Mr Chavis did so at the behest of some of those invited
+ the spokesman , Don Rojas , said the meeting was organized by the group 's Detroit chapter , which mailed out the invitations
+ the meeting brought together representatives of what Mr Chavis termed the Pan-African community , the progressive community and the nationalist community
+ coming after criticism of Mr Chavis within the NAACP for his overtures to the Nation of Islam , the meeting appeared to be an effort to broaden an organization
+ the meeting was an effort to broaden an organization that is being increasingly seen as ineffective and irrelevant to young blacks
+ they invited Alton H Maddox , a New York lawyer who headed the Senate campaign of the Rev Al Sharpton
+ they also invited Maulana Ron Karenga , a California State professor known for heading US , a radical nationalist group , and for inventing the holiday known as Kwanzaa
+ and they invited Angela Davis , a professor at the University of California at Santa Cruz and a former Communist
+ she was acquitted of kidnapping and murder charges in taking hostages from a courtroom in San Rafael , California , in 1970
+ a state judge and three others were killed in the incident
+ others closer to the political mainstream , still on the political left , were also invited , including the Rev Calvin O Butts Third
+ they also invited Calvin Butts , the pastor of the Abyssinian Baptist Church in Harlem , Cornel West , a professor of philosophy at Princeton , and two actors
+ Dr William Gibson , the organization 's chairman , said he was unaware of the meeting until he was told about it
+ he was unaware of it , even though the invitation was sent out under his name
+ Rush-hour traffic moved as usual today , at a crawl , as the Santa Monica Freeway opened for business
+ it opened for business for the first time since the January earthquake toppled two of its bridges
+ but even as politicians celebrated the reconstruction of the nation 's busiest freeway , questions arose about the adequacy of the repairs
+ Governor Pete Wilson , Mayor Richard J Riordan of Los Angeles and Federico F Pena , the Federal Secretary of Transportation , were there
+ they were among those on the roadway late Monday night
+ they were on the roadway when a phalanx of police officers of motorcycles , followed by rows of merry-making drivers , inaugurated the rebuilt road .
+ at opening ceremonies this morning , Vice President Al Gore praised the quick repairs and said jubilantly that the rubber is meeting the road today
+ but the festivities were marred by disclosures in the Los Angeles Times today that in February consultants made recommendations
+ consultants to the California Department of Transportation made recommendations
+ they recommended fortifying the abutments of the two fallen bridges , but they were already in place because of the accelerated construction schedule .
+ in the event of a major earthquake , the four concrete structures would move laterally
+ the four concrete structures , on which the ends of the bridges rest and are connected to land , would move laterally
+ they would move laterally , causing the bridge deck to slip to one side
+ after internal review , state transportation officials decided last Sunday to go forward with the work
+- they went forward with the work , which they estimated would take two weeks to put out to bid and a few days to complete
+ and they would tack on 100000 dollars to the 30-million-dollar federally financed project .
+ they said the work , drilling eight holes into the ground , then putting in reinforced steel and pouring concrete , could proceed
+ it could proceed without again closing the freeway , which they said was safe even without being strengthened
+- it 's ultraconservative , but because it 's sitting on a soft-soil site , we decided it was prudent , said the engineer
+- it 's ultraconservative , said State Department of Transportation 's chief bridge engineer , James Roberts
+ we're talking about reducing the future risk of damage from minimal risk to no risk
+- it 's not really a big deal
+ a tiny insect that apparently hitched a ride to Florida from West Africa aboard Hurricane Andrew in 1992 has infested groves
+ it has suddenly begun infesting citrus groves throughout the state
+ it has been sucking the life from orange , grapefruit , lemon and lime leaves and drying up profits for the beleaguered 8-billion-dollar-a-year citrus industry
+ the pest , a moth called the citrus leaf miner that is only one tenth of an inch long at maturity , was first spotted
+ it was first spotted last spring in a few lime groves south of Miami
+ but with another growing season getting under way , it has become clear that millions of moth larvae have burrowed into leaves
+ they have burrowed into leaves in every citrus-growing county in the state
+ millions of larvae have burrowed , disrupting the process of photosynthesis vital to the health and growth of young trees
+- it 's been like an explosion , said Carlos Balerdi , a horticulturist and agronomist at the University of Florida
+- the pest does not directly attack citrus fruit , scientists here said , or normally infest mature trees
+ rather , it seeks out the newest leaves on young trees , stunting their growth and rendering them unproductive as long as they are under attack
+ Jorge Pena , an entomologist at the University of Florida who is with the Tropical Research and Education Center here , said they worked
+ he and other researchers were working against the clock to control the pest
+ but the citrus leaf miner , which originated in Asia , has already spread from Florida to Central America and the Caribbean , he said
+ growers in California , Texas and Mexico should also be concerned
+ Dr Pena and other scientists theorize that Hurricane Andrew may have brought the citrus leaf miner from West Africa
+ it comes from West Africa , which had been the westernmost point of its range
+ the pest , which has been known to be carried long distances by wind , appeared during the first growing cycle after the storm
+ the Clinton Administration moved on two fronts today to reshape the way the Government manages logging in the nation 's remaining ancient forests
+ in Seattle , the Administration asked a Federal judge to restore some logging in the old forests of the Pacific Northwest
+ they will restore logging in the Northwest , where for five years the courts have all but eliminated logging on public land
+ they eliminated logging to protect the northern spotted owl
+ and the United States Forest Service canceled a 50-year contract with the Alaska Pulp Corporation that has allowed it to cut timber
+ they can cut timber in the Tongass National Forest , a program that environmentalists have assailed for years
+- environmental groups and the timber industry , for conflicting reasons , today criticized the plan to protect the spotted owl and other species
+ the plan would protect the spotted owl and other species in Washington , Oregon and California
+ although groups criticized the plan , the decision on the Alaskan forest was clearly welcomed by environmentalists
+ Alaska Pulp is one of two companies with special contracts to cut trees in the Tongass
+ the Tongass is one of the last remaining stretches of temperate rain forest in the world
+ the contract that was canceled , one of the biggest ones in the nation involving publicly owned forests , would have allowed the company to cut more lumber
+ it would have allowed them to cut another two billion board feet of lumber by 2011
+ the Forest Service had warned the company that the contract might be terminated after Alaska Pulp shut a mill in Sitka last year , laying off 400 people
+ the long-term contract was intended to provide mill jobs in Alaska
+ defending the spotted owl plan , Administration officials said that neither industrial nor environmental critics of its plan could offer a way
+ they could not offer a better way to save the threatened owl
+ they had no better way to save the owl and preserve a forest that offers habitat for a multitude of species while also nurturing the region 's economy
+ environmentalists said the plan was intended to appease the timber industry , and the industry said it was illegal and unbalanced
+ and the Administration admitted that even if the plan survived legal challenges , it would take at least three years to put into effect
+No errors!
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2000/197.parser/197.parser.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/197.parser/197.parser.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/197.parser/197.parser.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CINT2000/197.parser/197.parser.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,804 @@
+
+ Reading the dictionary files: *************************************************
+
+
+Welcome to the Link Parser -- Version 2.1
+
+ Copyright (C) 1991-1995 Daniel Sleator and Davy Temperley
+
+Processing sentences in batch mode
+
+Echoing of input sentence turned on.
+ the fact that he smiled at me gives me hope
+* the event that he smiled at me gives me hope
+ but my efforts to win his heart have failed
+* but my presents to win his heart have failed
+ failure to comply may result in dismissal
+* absence to comply may result in dismissal
+ the question is whether we should go
+* the party is whether we should go
+ the big question on everybody 's mind is who killed OJ
+* the big mind on everybody 's question is who killed OJ
+ he is the kind of person who would do that
+* he is the character of person who would do that
+ an income tax increase may be necessary
+* a tax on income increase may be necessary
+ last week I saw a great movie
+* last dog I saw a great movie
+ the party that night was a big success
+* the party that dog was a big success
+ John Stuart Mill is an important author
+ the Richard Milhous Nixon Library has been a big success
+ the mystery of the Nixon tapes was never solved
+ high income taxes are important
+ oil company stock prices rose in heavy trading today
+- metals futures prices rose in heavy trading today
+- U.S . economic indicators fell sharply last month
+- Columbia medical and administrative workers continued their strike today
+ Janet , who is an expert on dogs , helped me choose one
+* Janet who is an expert on dogs helped me choose one
+ the dog that we eventually bought was very expensive
+* the dog , that we eventually bought , was very expensive
+* the dog , we eventually bought , was very expensive
+ have you ever seen the Pacific
+- the new David Letterman is a happy , relaxed David Letterman
+- actress Whoopi Goldberg and singer Michael Jackson attended the ceremony
+- we are from the planet Gorpon
+- this is my friend Bob
+ John 's family is renovating their kitchen
+* a man I know 's family is renovating their kitchen
+ the boys ' bedrooms will be enlarged
+* the boys 's bedrooms will be enlarged
+ my uncle 's mother 's cousin is visiting us
+* Emily 's my cousin is visiting us
+- we ate at Joe 's Diner last week
+- the buy-out caused a free-for-all in the mid-afternoon
+ many people were angered by the hearings
+* many person were angered by the hearings
+ many were angered by the hearings
+ my many female friends were angered by the hearings
+* my some female friends were angered by the hearings
+ many who initially supported Thomas later changed their minds
+ the stupidity of the senators annoyed all my friends
+* the stupidity of the senators annoyed many my friends
+ I need to buy a present , but I want something inexpensive
+* I need to buy a present , but I want a gift inexpensive
+ anyone who thinks this will work is crazy
+ their program is better than ours
+ those that want to come can come
+ 2 million attended
+ 2 million people attended
+* 2 million person attended
+ a million attended
+ a million people attended
+ about 2 million people attended
+ about 2 million attended
+* about people attended
+ a million such people attended
+* a million such attended
+ 5 million of the people attended
+ 5 thousand invited by Bob attended
+ the 5 thousand invited by Bob attended
+ the thousands of people who attended enjoyed it
+ the 5 thousand people invited by Bob attended
+ the nearly 5 million people who attended enjoyed it
+ the best five costumes got prizes
+ the five best costumes got prizes
+* the five best five costumes got prizes
+* the hundreds of best costumes got prizes
+* five best costumes got prizes
+* best five costumes got prizes
+ five other costumes got prizes
+* other five costumes got prizes
+ a few attended
+ a few million people attended
+ a few people attended
+ few attended
+* few million people attended
+ millions attended
+* 5 millions attended
+ millions of people attended
+ hundreds of millions of people attended
+ 5 million years ago , the earth was covered with ice
+ millions of years ago , the earth was covered with ice
+* dogs of years ago , the earth was covered with ice
+* the five million years ago , the earth was covered with ice
+* the other five million years ago , the earth was covered with ice
+* 5 million ago , the earth was covered with ice
+ the city of New York contains over one hundred million billion brain cells
+ almost one third of the people in the country have no health insurance
+ of all the people in this country , almost one third have no health insurance
+ three quarters of a million people in this city have no health insurance
+ the price of the stock rose three tenths of one point
+* the price of the stock rose three tenths of one dog
+ the nearest drug store is about three tenths of a mile away
+- they are the Number 3 auto maker and a Fortune 500 company
+- I live at 805 West Indiana Street
+ we're thinking about going to a movie this evening
+* we're thinking about going to a movie this theater
+ I've been grading these stupid exams all day
+* I've been grading these stupid days all exam
+ we're having a big party Tuesday
+* we're having a big party our house
+* there is going to be an important meeting January
+ there is going to be an important meeting in January
+ there is going to be an important meeting next January
+ the party last week was a big success
+- John last week threw a great party
+ until recently , these fossils were believed to belong to different species
+* until initially , these fossils were believed to belong to different species
+* until for many years , these fossils were believed to belong to different species
+ until last week , these fossils were believed to belong to different species
+* until last meeting , these fossils were believed to belong to different species
+- I'm quite excited about next week
+- Monday sounds good for the meeting
+- last Tuesday was really fun
+ almost three years after our first date , I saw Ruth again
+ almost three years after I first met her , I saw Ruth again
+* almost three years , I saw Ruth again
+ almost three years later , I saw Ruth again
+* almost three years for our first date , I saw Ruth again
+ he left here a quarter of an hour ago
+* he left here a quarter of a dog ago
+* he left here a picture of an hour ago
+ I still remember the day I kissed him
+* I still remember the room I kissed him
+ I'm going to Europe the day I graduate
+ Clinton is expected to return to Washington Thursday morning
+* Clinton is expected to return to Thursday Washington office
+ Clinton is expected to return to Washington on Thursday morning
+ Clinton is expected to return to Washington late Thursday morning
+ Clinton is expected to return to Washington next Thursday morning
+ she walked out of the room the minute I saw her
+* she walked out of the room two minutes I saw her
+ in January 1990 , a historic new law was passed
+* in Washington 1990 , a historic new law was passed
+ on January 15 , 1990 , a historic new law was passed
+* on January 320 , 1990 , a historic new law was passed
+ he was convicted under an obscure 1990 law
+* he was convicted under an obscure 50 law
+ which dog did you chase
+* which dog you chased
+ which dog did you say you chased
+* which dog you said you chased
+* which dog did you say did you chase
+ I wonder which dog he said you chased
+* I wonder which dog did he say you chased
+* I wonder which dog did he say did you chase
+ what did John say he thought you should do
+* what did John say did he think you should do
+* what John said he thought you should do
+ what Alice did really annoyed me
+* who Alice did really annoyed me
+ whoever designed this program didn't know what they were doing
+* who designed this program didn't know what they were doing
+ invite John and whoever else you want to invite
+ the dog which Chris bought is really ugly
+* the dog what Chris bought is really ugly
+ I wonder whether we should go
+* whether should we go
+ we can't decide whether to go to the party
+* we can't decide who to go the party
+* we can't decide whether to go the the party with
+ I am wondering who to go to the party with
+ I am wondering who to invite to the party
+* I am wondering whether to invite to the party
+* I am wondering the people to invite to the party
+* whether to go to the party
+* who to invite to the party
+ do you think we should go to the party
+* what do you think we should go to the party
+ how do you operate this machine
+ how fast is the program
+ how certain are you that John is coming
+* how tired are you that John is coming
+ how likely is it that he will come
+* how likely is John that he will come
+ how certain does he seem to be that John is coming
+ how efficient a program is it
+* efficient a program is it
+* how fast programs are they
+* how fast the program is it
+ how fast a program does he think it is
+* how fast a program he thinks it is
+* how fast programs does he think they are
+* how big a dog chased you
+ I wonder how fast a program he thinks it is
+* I wonder how fast a program does he think it is
+ how much money did you earn
+* how much money you earn
+ I wonder how much money you earned
+* I wonder how much money have you earned
+ how much oil spilled
+ how much do you swim
+* how much you swim
+ I wonder how much you swim
+* I wonder how much do you swim
+* I don't have how much money
+ I don't have very much money
+ I don't have much money
+ how much did you read
+* how much of the book you read
+ how much of the book did you read
+ I wonder how much of the book you read
+ how many people died
+ how many people did you see
+* how many people you saw
+ I wonder how many people you saw
+ I wonder how many of the people you saw were students
+ how did John do it
+ I wonder how John did it
+ how many years did it take to do it
+ how big is the department
+* how big the department is
+* I wonder how big is the department
+ I wonder how big the department is
+* I wonder how big departments they are
+* I wonder how a department it is
+ I wonder how big a department it is
+ how important is it to turn the computer off
+ I wonder how important it is to turn off the computer
+* I wonder how important is it to turn off the computer
+ how quickly did Joe run
+* how quickly Joe ran
+ I know how quickly you ran
+* I know how quickly did you run
+* he ran I know how quickly
+* quickly did Joe run
+* very quickly did Joe run
+* I know very quickly did Joe run
+* I know quickly did John run
+ how much more quickly did you run
+* how much more quickly you run
+* I wonder how much more quickly did he run
+ I wonder how much more quickly he ran
+ how much more quickly did he run than Joe
+ how much more should we work on this
+ how much further do you think we should drive tonight
+ I don't know how much longer I can tolerate this
+ how much bigger is the dog
+* how much bigger dogs are they
+* how much bigger dogs ran
+* how big dogs run
+ how much further did you run
+ how much more oil spilled
+ how much more spilled
+ how much more oil did they spill
+ how much more did they spill
+* how much more they spilled
+ I wonder how much oil spilled
+ I wonder how much oil they spilled
+* how much more efficient programs are available
+ how many dogs ran
+ how many ran
+ how many dogs did you see
+ how many more people did you see
+ how many more people do you think will come
+ I wonder how many more people he thinks will come
+* I wonder how many more people does he think will come
+ how many times did you do it
+* how many times you did it
+ I wonder how many times you did it
+* how many more stupid times did you do it
+ how many years ago did you do it
+* many years ago did you do it
+* how many years did you do it
+ I wonder how many years ago you did it
+* how many years ago you did it
+ I'll show you the house where I met your mother
+* I'll show you the house which I met your mother
+ this is the man whose dog I bought
+* this is the man which dog I bought
+ I wonder where John is
+* I wonder where John hit
+ the dogs , some of which were very large , ran after the man
+ the dogs , some of which I had seen before , ran after the man
+* the dogs some of which were very large ran after the man
+ the box contained many books , some of which were badly damaged
+* some of which were badly damaged
+* the box contained many books , some were badly damaged
+* the box contained many books , some of the books were badly damaged
+ I believe it was John who stole the priceless documents
+* I believe Fred was John who stole the priceless documents
+ it seems to have been Einstein who first came up with the idea
+* there seems to have been Einstein who first came up with the idea
+* it hopes to have been Einstein who first came up with the idea
+* the book discussed Einstein who first came up with the idea
+* Stravinsky was in Paris that Debussy first heard Balinese music
+ it was in Paris that Debussy first heard Balinese music
+ it must have been there that he realized his destiny
+* it tried to have been there that he realized his destiny
+* he composed some good music that he realized his destiny
+* it was quickly that he wrote his first symphony
+ wasn't it in 1955 that Sally first met Joe
+ the man we saw when we went to Paris is here
+* the man we saw but we went to Paris is here
+ you should see a play while in London
+* you should see a play after in London
+ I left the party after seeing Ann there
+* I left the party because seeing Ann there
+* I left the party despite I saw Ann there
+ because I didn't see Ann , I left
+* therefore I didn't see Ann , I left
+ I left , therefore I didn't see Ann
+ but I really wanted to see her
+* after I really wanted to see her
+ as I suspected , he had already left
+* because I suspected , he had already left
+* I suspected , he had already left
+* I suspected
+ some grammars are better than others , as we have proved
+ as had been expected , the party was a big success
+* as had been green , the party was a big success
+* as had wanted to be expected , the party was a big success
+* as had expected the party to be a success , it was a success
+ Abrams does like programming
+* Abrams does be a good programmer
+ he is being hired by another company
+ he is looking for another job
+ Fred has had five years of experience as a programmer
+* Fred has had been a programmer for five years
+ I gave my mother the present I bought for her
+ I gave her the present I bought for her
+* I gave my mother it
+ we picked out some beautiful flowers for her
+ we picked some beautiful flowers out for her
+ we picked them out for her
+* we picked out them for her
+ did you put the milk in the refrigerator
+* did you put the milk
+ where did you put the milk
+ I hope he comes to the party tomorrow
+ I hope that he comes to the party tomorrow
+* I hope him to come to the party tomorrow
+ I expect him to come to the party tomorrow
+ I expect to go to the party tomorrow
+* I expect
+* I expected who would come to the party
+ I knew who would come to the party
+* I expected he go to the party
+ I suggested he go to the party
+* he knew me how to use the program
+ he asked me how to use the program
+* he disputed our program was superior
+ he disputed that our program was superior
+ Anne told me I would almost certainly be hired
+* Anne expected me I would almost certainly be hired
+* we argued adding new features to the program
+ we discussed adding new features to the program
+* I thought terrible after our discussion
+ I felt terrible after our discussion
+ I made him make some changes in the program
+* I encouraged him make some changes in the program
+ I helped him make some changes in the program
+ I helped make some changes in the program
+* I saw make some changes in the program
+* I made him telling her about the party
+ I saw him telling her about the party
+ Phil gave me a sweater which he bought in Paris
+* Phil chose me a sweater which he bought in Paris
+ Alan bet me five dollars Clinton would lose the election
+* Alan offered me five dollars Clinton would lose the election
+ she said she didn't approve of my behavior
+* she said she didn't like of my behavior
+ the results are in , the game is up and the truth is out
+* the in results show the out truth about the up game
+* the results became in and the truth seemed out
+- he sold for five dollars the ring his mother had given him
+- Clinton announced on Tuesday a bold new proposal
+* Clinton announced on Tuesday it
+ I gave my brother an expensive present
+ I gave him an expensive present
+ I gave an expensive present
+ I gave it
+* I gave my brother it
+- I gave him for his birthday a very expensive present
+* I gave him for his birthday it
+- I gave for his birthday an expensive present
+* I gave for his birthday it
+ the President announced on Monday that several more bases would be closed
+ he had attempted for years to make a career as a concert pianist
+* he had attempted for years
+ I asked him when I saw him at the party yesterday what he was working on
+* I spoke to him when I saw him at the party yesterday what he was working on
+ I wondered for a long time why everyone liked her so much
+* I thought for a long time why everyone liked her so much
+ I told Margaret that I thought she would probably be hired
+* I told on Tuesday Margaret that I thought she would probably be hired
+ I told Margaret on Tuesday that I thought she would probably be hired
+ we discussed at the meeting hiring a new secretary
+* we discussed at the meeting
+ we informed the new employees that no salary increase would be possible
+- we informed at the meeting the new employees
+* we informed at the meeting the new employees that no salary increase would be possible
+ they were asked that he be allowed to go
+ if his calculations were correct , Copernicus reasoned , the earth must revolve around the sun
+ the earth , Copernicus reasoned , must revolve around the sun
+ the earth must revolve around the sun , Copernicus reasoned
+* the earth must revolve around the sun , Copernicus was happy
+* the earth must revolve around the sun , Copernicus destroyed
+* the earth , the pope cringed when Copernicus reasoned , revolves around the sun
+ abortion was legal until the third month , the court ruled
+ if the pregnancy was within the first three months , the court ruled , abortion was legal
+- nobody , it seems , wants to be a liberal
+* nobody , John seems , wants to be a liberal
+ business is booming , Joe Smith , a car dealer , says
+ business is booming , says Joe Smith , a car dealer
+- in the last few years , it seems , nobody wants to be a liberal
+- also invited to the meeting were several prominent scientists
+* also invited to the meeting invited several prominent scientists
+- also awarded the prize was Jean Smith , a prominent computer scientist
+- chosen to lead the commission was Fred Schultz , a former Federal judge
+* chosen to lead the commission seemed likely to be Fred Schultz , a former Federal judge
+* chooses to lead the investigation Fred Schultz
+* choose to lead the investigation did Fred Schultz
+- also recommended in the report was a new initiative to combat crime
+* also chosen the leader for the commission was Fred Schultz
+- included in our paper is a summary of the features of our program
+- also performing in the concert were members of the Budapest Quartet
+* were performing in the concert members of the Budapest Quartet
+- voting in favor of the bill were 36 Republicans and 4 moderate Democrats
+ glaring coldly at Sarah , he walked out of the room
+ he walked out of the room , glaring coldly at Sarah
+* glaring coldly at Sarah , walking out of the room
+ finding that it was impossible to get work as a waiter , he worked as a janitor
+ he had hoped to get work as a waiter , but , finding this was impossible , he worked as a janitor
+* he said that , finding that it was impossible to get work as a waiter , he would work as a janitor
+ used by some of the finest pianists in the country , Baldwin pianos are technical marvels
+ using specially designed parts , Baldwin pianos are technical marvels
+* used specially designed parts , Baldwin pianos are technical marvels
+ sending a message of discontent to Washington , voters overwhelmingly rejected the Clinton administration
+- she 's a really good player
+- John 's coming to the party tonight
+- he 's usually gone to Boston for Thanksgiving
+* do you know where John 's
+- who 's afraid of the big bad wolf
+- that 's just the kind of person he is
+* that 's just the kind of person he 's
+- there 's no reason to get so upset about it
+- I didn't think he would do it , but he did
+* I didn't think he would invite her , but he invited
+- if you don't want to do it , you should find someone who will
+- if you don't want to do it , you should find someone who does
+- find someone who does
+* find someone who wants to do
+- I don't like programming , and someone who does may be difficult to find
+ I have doubts about inviting him
+* I have doubts behind inviting him
+: from your description , I don't think I would enjoy it
+ we had an argument over whether it was a good movie
+* we had an argument at whether it was a good movie
+ because of the rain , we decided to stay home
+ they're having a party in front of the building
+ the man with whom I play tennis is here
+ the man I play tennis with is here
+* the man whom I play tennis is here
+* the man with whom I play tennis with is here
+ with whom did you play tennis
+ who did you play tennis with
+ you are lucky that there is no exam today
+* you are stupid that there is no exam today
+ you are lucky I am here
+* you are right I am here
+ this is something we should be happy about
+* this is something we should be happy
+* the happy about it man kissed his wife
+ is he sure how to find the house
+* is he correct how to find the house
+ you should be proud of your achievement
+* you should be happy of your achievement
+ he is the smartest man I know
+* they are some smartest men I know
+ I've seen a lot of programs , but ours is the fastest
+ ours is the fastest of the programs we have seen
+ I've seen a lot of programs , but ours runs the most quickly
+* this is our the fastest program
+ voters angry about the economy will probably vote for Clinton
+* voters angry will probably vote for Clinton
+ many Democrats unhappy about the economy but doubtful that Clinton can be elected probably won't vote at all
+* many Democrats unhappy but doubtful probably won't vote at all
+* many Democrats likely that Bush will be reelected probably won't vote
+ hundreds of young men , furious about the verdict in the Rodney King case , looted stores in Los Angeles today
+* hundreds of young men , furious , looted stores in Los Angeles today
+ we need a programmer knowledgeable about Lisp
+* we need a programmer knowledgeable
+ any program as good as ours should be useful
+* any program good should be useful
+ let us know if you have a program capable of parsing this sentence
+* let us know if you have a program capable
+ it is believed that even the troops loyal to Hussein will soon be forced to surrender
+* it is believed that even the troops loyal will soon be forced to surrender
+- Republican policies only benefit the rich and powerful
+- Republican policies only benefit the rich and the powerful
+* Republican policies only benefit a rich and a powerful
+* Republican policies only benefit some rich and some powerful
+- the meek will inherit the earth , and the best is the enemy of the good
+ he is apparently an expert on dogs
+* he knows apparently an expert on dogs
+ Mary suddenly left the room
+ Mary just left the room
+ suddenly , Mary left the room
+* just , Mary left the room
+ he told them about the accident immediately
+* he told them about the accident presumably
+ she is very careful about her work
+ she works very carefully
+* she very works carefully
+ is the piece easy enough for you
+ is the piece too easy for you
+* is the piece enough easy for you
+ she is apparently an excellent pianist
+* she married apparently an excellent pianist
+ only after the movie did he realize his mistake
+* after the movie did he realize his mistake
+ I may have taken cocaine a few times , but at no time did I inhale
+* a few times may I have taken cocaine , but I inhaled at no time
+ never have I seen such a grotesque display of incompetence
+* often have I seen such a grotesque display of incompetence
+ we like to eat at restaurants , particularly on weekends
+ we like to eat at restaurants , usually on weekends
+* we like to eat at restaurants , fortunately on weekends
+ such flowers are found chiefly in Europe
+* such flowers are found apparently in Europe
+* such flowers are found chiefly particularly in Europe
+* such flowers are found particularly
+ many people , particularly doctors , believe there is no health care crisis
+* many people , strongly doctors , believe there is no health care crisis
+ I found a house that even John thinks we should buy
+ he told me that even his mother likes me
+* he told me that even , his mother likes me
+ we put it straight in the oven
+* we put it quickly in the oven
+ we put it straight in
+* we put it straight
+ he lives high in the mountains
+- he lives over by the lake
+- he lives out down by the lake
+* he lives out down by
+- the apparently angry man walked out of the room
+- the often underpaid administrators resent the invariably rude students and the understandably impatient professors
+- the delicately lyrical tone of the cello contrasted with the fiercely percussive piano chords
+- the always delicately lyrical tone was really beautiful
+* the delicately always lyrical tone was really beautiful
+* the delicately very lyrical tone was really beautiful
+ biochemically , I think the experiment has a lot of problems
+ I think the experiment has a lot of problems biochemically
+ it is biochemically an interesting experiment
+ I'm not sure the results are biochemically valid
+ there is a dog in the park
+* there is chasing dogs
+* there are a dog in the park
+ does there seem to be a dog in the park ?
+* does there want to be a dog in the park ?
+ there seems to appear to have been likely to be a problem
+* there seems to appear to have been likely to be problems
+* there seems to appear to have been likely to be stupid
+ there was an attempt to kill Rod
+ the man there was an attempt to kill died
+ there was a problem , but we solved it
+ it is likely that Rod died
+* Joe is likely that Rod died
+ it is clear who killed Rod
+* Joe is clear who killed Rod
+ it may not be possible to fix the problem
+: Grace may not be possible to fix the problem
+ it is important that women be ready when they make these choices
+* it is clear that women be ready when they make these choices
+* Joe is important that women be ready when they make these choices
+: flowers are red to attract bees
+ I made it clear that I was angry
+* I made Anne clear that I was angry
+ Dick is easy to hit
+* Dick is black to hit
+ it is important to fix the problem
+: Dick is important to fix the problem
+ the man it is likely that John hit died
+* the man Joe is likely that Dick hit died
+ does it seem likely that Ann will come
+ does Ann act glad that Joe came
+* does it act likely that Joe came
+ it doesn't matter what Ted does
+* Joe doesn't matter what Ted does
+ I want it to be possible to use the program
+: I want Joe to be possible to use the program
+ I want it to be clear that it was my idea
+* I asked it to be clear that it was my idea
+ I want it to be obvious how to use the program
+* I want Emily to be obvious how to use the program
+ I want Joe to be easy to hit
+ it is likely they will come
+* Joe is likely they will come
+ this is because he is extremely famous
+- the trial is because he is extremely famous
+- the excitement over the trial is because he is extremely famous
+ this seems to have been because he is extremely famous
+ our program works more elegantly than yours
+ ours works more elegantly than yours does
+ ours works more elegantly than yours works
+* ours works more elegant than yours
+* ours is more elegant than yours works
+: our program works more elegantly than efficiently
+: our program is more elegant than efficient
+ our program works better than yours
+: we do this more for pleasure than for money
+ he is more likely to go than to stay
+* he is more likely than to stay
+* he is more black to go than to stay
+ he is more likely to go than he is to stay
+ he is more likely to go than John is
+ it is more likely that Joe died than that Fred died
+ it is more likely that Joe died than it is that Fred died
+* John is more likely that Joe died than it is that Fred died
+* it is more likely that Joe died than John is that Fred died
+ it is easier to ignore the problem than to solve it
+ it is easier to ignore the problem than it is to solve it
+* Greg is easier to ignore the problem than to solve it
+ our program is easier to use than to understand
+* our program is easier to use it than to understand
+ I am more happy now than I was in college
+* I am more happy now than I earned in college
+: he is more a teacher than a scholar
+ I make more money in a month than John makes in a year
+- I make more money in a month than John dies in a year
+- I hit more the dog than the cat
+ I have more money than John has time
+- I have more dogs than John has five cats
+- I have more money than John has a dog
+ she interviewed more programmers than were hired
+* she interviewed more programmers than was hired
+ I am as intelligent as John
+ I earn as much money as John does
+- I am as intelligent as John does
+ I earn as much money in a month as John earns in a year
+* I earn as much money in a month than John earns in a year
+ our program was better than had been expected
+* our program was better than had been argued
+* our program was better than had been responded
+ our program was better than was expected
+* our program was better than were expected
+ more people came to the party than were expected
+ more people came to the party than was expected
+ our program did not run as quickly as expected
+* our program did not run as quickly as said
+ how much faster is our program than theirs
+* how much faster our program is than theirs
+ the more quickly we write the program , the more money we will earn
+* the more people like the program
+* the people like the program , the more money we will earn
+ the better the program is , the more people will like it
+ the better the program , the more people will like it
+* the better a program , the more people will like it
+ the less likely it is that we can parse this , the easier it is to understand
+- the shuttle is so big that it has to be carried on the back of a jet
+* the shuttle is big that it has to be carried on the back of a jet
+- so many people attended that they spilled over into several neighboring fields
+* many people attended that they spilled over into several neighboring fields
+- the program has so many problems that you should probably just rewrite it
+* the program has many problems that you should probably just rewrite it
+- I love her so much that I can't let her go
+* I love her very much that I can't let her go
+- he ran home so quickly that his mother could hardly believe he had called from school
+* he ran home quickly that his mother could hardly believe he had called from school
+- she presented her case with such eloquence that we could only admire her
+* she presented her case with eloquence that we could only admire her
+ I went to the store and got a gallon of milk
+* I got and went a gallon of milk
+ I got a gallon of milk and some eggs
+ I went to the store , got a gallon of milk , and returned the eggs
+* I went to the store , got a gallon of milk , and some eggs
+ Mary , Joe and Louise are coming to the party
+ neither Mary nor Louise are coming to the party
+ I am ready and eager to go to the party
+ she handled it skillfully and with compassion
+ I told him that I hated him and that I never wanted to see him again
+ he told me why he was here and what he was doing
+* he told me why he was here and that he hated me
+ although he likes me and he respects me , he says he needs some privacy
+ your house and garden are very attractive
+ I am in New York and I would like to see you
+ this is not the man we know and love
+* this is not the man we know and love him
+ the coverage on TV and on the radio has been terrible
+* the coverage on TV and I have seen has been terrible
+ the sky is blue , so it is likely that Joe will come
+* it is blue and likely that Joe will come
+ that is the man for whom and with whom Joe works
+* that is the man for whom and with Janet Joe works
+* when did Joe and John did leave the party
+ my dog , cat , and cousin 's friend came
+* my dog , cat , horse , mouse , and his cow left
+ my dog , cat , horse , and mouse , and his cow left
+ you should not only ask for your money back , but demand it
+ I was both angry and sad at the same time
+ there is neither a dog nor a cat here
+* there are neither a dog nor a cat here
+ there is a dog or a cat here
+* there are a dog or a cat here
+* there are a dog and a cat here
+ there is a dog and a cat here
+ he and I are friends
+ neither I nor my friend knows what happened
+ neither I nor my friend know what happened
+ either I or my friend knows what happened
+ either I or my friend know what happened
+ the dog and cats know what happened
+* the dog and cats knows what happened
+ are a dog and a cat here
+* is a dog and a cat here
+* is John and I invited
+ are John and I invited
+ is John or I invited
+ are John or I invited
+ is neither John nor I invited
+ are neither John nor I invited
+ playing the piano bothers John
+ releasing the program at this point would annoy our competitors
+ the playing of the piano really bothers John
+* the playing the piano really bothers John
+ telling Joe about the party would create a real problem
+* the telling Joe about the party could create a real problem
+ your telling Joe about the party could create a real problem
+ telling Joe that Sue was coming to the party would create a real problem
+- telling would create a real problem
+- I want her to know about it , but the telling won't be easy
+* the telling her won't be easy
+* some children like to tease
+- teasing can be very cruel
+ your telling John to leave may have destroyed your relationship
+ the graduating of Fred changes the situation
+ the sleeping of students is becoming a big problem
+ the sleeping of students can ruin a lecture
+- buying of shares was brisk on Wall Street today
+- the sleeping in class is becoming a big problem
+* the telling John to leave was stupid
+* the inviting your mother was stupid
+* the showing how to use the program seemed to interest people
+* the attempting to go to the party angered Joe
+ the showing of the program seemed to impress people
+ the sleeping of students described by Fred is a big problem
+ the sleeping of students I told you about is a big problem
+ the frequent sleeping of students is a big problem
+ his hitting of the dog didn't help matters
+ some hitting of dogs will solve the problem
+ the drug running here has become a massive problem
+ he made a mistake in inviting John
+ he made a mistake in the inviting of John
+ I should have talked to you before inviting John
+ I should have talked to you before the inviting of John
+ to pretend that our program is usable in its current form would be silly
+* to pretend that our program is usable in its current form would be happy
+ that our program will be immediately accepted is hardly likely
+* that our program will be immediately accepted wrote the program
+* is that our program will be accepted likely
+* that our program will be accepted seems likely that our program will be accepted
+ using the conventional Minuet form , Beethoven produced a piece of great originality
+ written in 1820 , the symphony shows a new level of maturity for the composer
+ abandoned by his friends , he left Vienna three years later
+ in Vienna , Beethoven met someone who would later be greatly influenced by him : Franz Schubert
+* in Vienna , Beethoven met someone who would later be greatly influenced by him ; Franz Schubert
+ today I did something very important : I bought a dog
+* the store where I did something very important : I bought a dog was closed today
+ it has been said that Schubert ran out of the room when he met Beethoven ; but we now know this is untrue
+ an important question remains : did Beethoven know about Schubert 's music
+ I agree that , in some ways , your program is better
+ I agree that in some ways , your program is better
+* I agree that , in some ways your program is better
+ that is the man who , in Joe 's opinion , we should hire
+* that is the man , in Joe 's opinion , we should hire
+* that is the man who , in Joe 's opinion we should hire
+ I know you hate Bill , but why did you send him that nasty note
+* I know you hate Bill , because why did you send him that nasty note
+ but why did you send him that nasty note
+ if John was with Lisa last night , who went to the movie with Diane
+* although John was with Lisa last night , who went to the movie with Diane
+ we need a President who understands us
+ we need a president who understands us
+* we need a Melvin who understand us
+ the Zongle of Bongle Dongle resigned today
+* a Zongle with a Bongle Dongle resigned today
+ if you were a middle-class American without a job , who would you vote for
+ the National Association of Linguists is meeting here
+* an Association that many Linguists belong to is meeting here
+ an association that many linguists belong to is meeting here
+No errors!
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2000/252.eon/252.eon.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/252.eon/252.eon.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/252.eon/252.eon.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2000/252.eon/252.eon.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,128 @@
+0 0 7 0.385445 0.395542 0.405073 0.412365 0.417041 0.417680 0.412600 0.401190
+0 8 15 0.381974 0.353383 0.316268 0.271993 0.223333 0.173617 0.124311 0.119803
+0 16 23 0.124092 0.127904 0.131541 0.134450 0.136935 0.138281 0.138778 0.138392
+0 24 31 0.136507 0.133100 0.128766 0.122937 0.115623 0.106828 0.096216 0.084881
+1 0 7 0.391847 0.403399 0.413287 0.421940 0.427843 0.429308 0.425723 0.415888
+1 8 15 0.396590 0.369240 0.332076 0.286140 0.235218 0.183313 0.133601 0.113127
+1 16 23 0.117658 0.121309 0.124314 0.126853 0.129071 0.130155 0.130551 0.129614
+1 24 31 0.127619 0.124430 0.119777 0.113991 0.106859 0.098066 0.088029 0.076836
+2 0 7 0.398522 0.410700 0.421154 0.431555 0.437942 0.440830 0.439052 0.429516
+2 8 15 0.412134 0.384282 0.346464 0.300033 0.247332 0.192675 0.141381 0.105749
+2 16 23 0.110576 0.113741 0.116720 0.119118 0.120468 0.121594 0.121675 0.120762
+2 24 31 0.118510 0.115026 0.110412 0.104661 0.097533 0.089123 0.079321 0.068739
+3 0 7 0.404061 0.416926 0.429402 0.439816 0.448500 0.452061 0.451346 0.443567
+3 8 15 0.426196 0.398693 0.361104 0.313702 0.259560 0.202857 0.149018 0.102721
+3 16 23 0.103096 0.106342 0.108553 0.110572 0.111999 0.112592 0.112329 0.111214
+3 24 31 0.108846 0.105324 0.100930 0.095061 0.088315 0.080090 0.070962 0.060792
+4 0 7 0.409257 0.423264 0.435785 0.447742 0.457099 0.462537 0.463099 0.455645
+4 8 15 0.439571 0.412979 0.375532 0.327075 0.271001 0.212843 0.155835 0.105593
+4 16 23 0.095644 0.098210 0.100214 0.101824 0.103028 0.103348 0.102653 0.101365
+4 24 31 0.098989 0.095535 0.091061 0.085499 0.078802 0.071126 0.062357 0.052928
+5 0 7 0.413838 0.428313 0.442717 0.455311 0.465519 0.472408 0.473330 0.461616
+5 8 15 0.452464 0.426630 0.388471 0.339551 0.282278 0.221515 0.162915 0.111945
+5 16 23 0.087076 0.090014 0.091801 0.093179 0.093869 0.093891 0.093290 0.091605
+5 24 31 0.089177 0.085848 0.081523 0.075982 0.069696 0.062371 0.054352 0.045593
+6 0 7 0.418574 0.433382 0.448044 0.461630 0.472706 0.480588 0.480807 0.459442
+6 8 15 0.464315 0.439087 0.401024 0.350762 0.292428 0.230739 0.169760 0.116350
+6 16 23 0.079661 0.081756 0.083263 0.084169 0.084553 0.084487 0.083530 0.081911
+6 24 31 0.079414 0.076199 0.071973 0.066845 0.061059 0.054201 0.046843 0.038877
+7 0 7 0.421407 0.437525 0.452894 0.467882 0.479667 0.488259 0.482319 0.445182
+7 8 15 0.474626 0.449980 0.411705 0.363062 0.302419 0.238604 0.175752 0.120559
+7 16 23 0.076921 0.073693 0.074809 0.075451 0.075606 0.075345 0.074215 0.072576
+7 24 31 0.070160 0.066812 0.063047 0.058222 0.052642 0.046560 0.039916 0.032682
+8 0 7 0.424811 0.441279 0.457422 0.472161 0.484771 0.490006 0.448258 0.410486
+8 8 15 0.468615 0.459451 0.422259 0.371847 0.311478 0.245796 0.181697 0.124518
+8 16 23 0.078926 0.065730 0.066673 0.067072 0.067089 0.066554 0.065474 0.063700
+8 24 31 0.061344 0.058267 0.054470 0.050231 0.044905 0.039183 0.033115 0.026701
+9 0 7 0.426614 0.443330 0.460340 0.476229 0.489787 0.486445 0.315582 0.211604
+9 8 15 0.227885 0.240945 0.221222 0.165202 0.172812 0.130816 0.090884 0.062293
+9 16 23 0.125662 0.059373 0.060407 0.061442 0.061870 0.062186 0.061672 0.060603
+9 24 31 0.059052 0.056829 0.053999 0.050210 0.045644 0.040447 0.034657 0.028266
+10 0 7 0.428498 0.445954 0.462793 0.478894 0.493299 0.343632 0.148259 0.177806
+10 8 15 0.377103 0.474880 0.407384 0.288969 0.406981 0.257840 0.136566 0.089621
+10 16 23 0.168384 0.067141 0.068674 0.069919 0.070643 0.070691 0.070372 0.069242
+10 24 31 0.067483 0.064820 0.061338 0.057224 0.052215 0.046541 0.040139 0.033061
+11 0 7 0.429925 0.446921 0.464377 0.481250 0.432765 0.209491 0.023199 0.093568
+11 8 15 0.255429 0.354899 0.211893 0.642279 0.466130 0.262060 0.130759 0.105472
+11 16 23 0.159756 0.074063 0.075816 0.077348 0.078339 0.078678 0.078384 0.077373
+11 24 31 0.075646 0.072986 0.069457 0.064788 0.059444 0.053171 0.046114 0.038279
+12 0 7 0.430209 0.447243 0.465031 0.482035 0.418315 0.117917 0.006272 0.046264
+12 8 15 0.213110 0.343034 0.211039 0.700282 0.522780 0.265556 0.103303 0.146715
+12 16 23 0.161028 0.081195 0.083479 0.085181 0.086300 0.087059 0.086891 0.085981
+12 24 31 0.084084 0.081605 0.077903 0.073080 0.067202 0.060336 0.052665 0.043980
+13 0 7 0.430052 0.447781 0.465083 0.481753 0.437778 0.202654 0.000000 0.000000
+13 8 15 0.225769 0.432572 0.183663 0.687985 0.571895 0.283003 0.123041 0.178355
+13 16 23 0.161899 0.088320 0.091116 0.093260 0.094718 0.095734 0.095855 0.095194
+13 24 31 0.093391 0.090868 0.086758 0.081716 0.075575 0.068186 0.059585 0.050248
+14 0 7 0.429137 0.446605 0.464046 0.480503 0.487090 0.277610 0.026483 0.000000
+14 8 15 0.076325 0.209008 0.130469 0.559126 0.632501 0.165904 0.095209 0.115633
+14 16 23 0.134776 0.103186 0.098790 0.101251 0.103213 0.104430 0.105054 0.104475
+14 24 31 0.102912 0.100068 0.096215 0.090698 0.084272 0.076341 0.067110 0.056852
+15 0 7 0.427183 0.444861 0.462001 0.478649 0.493459 0.352908 0.095725 0.013116
+15 8 15 0.103508 0.453236 0.372590 0.410348 0.576196 0.266644 0.198680 0.136933
+15 16 23 0.100604 0.102864 0.106271 0.109211 0.111679 0.113233 0.113857 0.113787
+15 24 31 0.112256 0.109623 0.105611 0.099908 0.093093 0.084843 0.074944 0.063942
+16 0 7 0.424974 0.442123 0.459713 0.476011 0.490434 0.416606 0.171031 0.026623
+16 8 15 0.329620 0.447533 0.409082 0.240596 0.398868 0.265295 0.196986 0.136325
+16 16 23 0.105710 0.110006 0.113747 0.117175 0.120077 0.121822 0.122788 0.122832
+16 24 31 0.121743 0.119105 0.115153 0.109516 0.101848 0.093274 0.082602 0.071000
+17 0 7 0.422058 0.438917 0.456123 0.471699 0.486131 0.481428 0.312513 0.275087
+17 8 15 0.269705 0.252738 0.236177 0.266377 0.332710 0.261345 0.194887 0.134433
+17 16 23 0.112054 0.116627 0.120921 0.124619 0.127860 0.130200 0.131517 0.131651
+17 24 31 0.130650 0.128089 0.124299 0.118554 0.110827 0.101744 0.090860 0.078318
+18 0 7 0.418437 0.435227 0.451485 0.467195 0.480637 0.491507 0.427126 0.494330
+18 8 15 0.487199 0.464741 0.430989 0.382710 0.322815 0.257618 0.191636 0.132638
+18 16 23 0.118072 0.123083 0.127505 0.131691 0.135352 0.138050 0.139552 0.140153
+18 24 31 0.139490 0.137008 0.133036 0.127081 0.119390 0.109802 0.098493 0.085537
+19 0 7 0.414682 0.430860 0.446842 0.461302 0.474705 0.484785 0.476810 0.488571
+19 8 15 0.477959 0.455887 0.421726 0.373740 0.315920 0.251568 0.187567 0.131787
+19 16 23 0.123507 0.128865 0.133729 0.138272 0.142146 0.144820 0.147175 0.147989
+19 24 31 0.147489 0.144940 0.141055 0.135210 0.127507 0.117616 0.106355 0.092487
+20 0 7 0.409815 0.425895 0.440938 0.454834 0.467342 0.476375 0.481033 0.478627
+20 8 15 0.467859 0.446150 0.411345 0.364836 0.308050 0.244476 0.182947 0.131292
+20 16 23 0.128408 0.133961 0.139358 0.144039 0.148190 0.151375 0.153730 0.154786
+20 24 31 0.154084 0.151904 0.148328 0.142681 0.135096 0.124863 0.112913 0.099176
+21 0 7 0.404901 0.419728 0.433672 0.447554 0.459053 0.468014 0.471393 0.467763
+21 8 15 0.456810 0.434755 0.399961 0.354230 0.298925 0.237448 0.177059 0.131527
+21 16 23 0.132730 0.138464 0.144094 0.149024 0.153239 0.156794 0.159369 0.160882
+21 24 31 0.160333 0.158705 0.154734 0.149087 0.141335 0.131442 0.118932 0.105282
+22 0 7 0.399060 0.413381 0.427563 0.439976 0.450048 0.457384 0.460132 0.456736
+22 8 15 0.444263 0.421876 0.388176 0.342637 0.288371 0.229137 0.170969 0.131803
+22 16 23 0.136296 0.142316 0.147912 0.153076 0.157668 0.161275 0.163940 0.165409
+22 24 31 0.165204 0.163498 0.159891 0.154141 0.146637 0.136571 0.124636 0.109732
+23 0 7 0.393425 0.406270 0.419790 0.431162 0.440970 0.446683 0.448378 0.443842
+23 8 15 0.431471 0.408531 0.374814 0.330382 0.277510 0.220766 0.164667 0.132853
+23 16 23 0.139037 0.145338 0.150923 0.156365 0.160972 0.164828 0.167764 0.169163
+23 24 31 0.169064 0.167431 0.163606 0.158697 0.150559 0.140913 0.129035 0.114824
+24 0 7 0.386745 0.399220 0.411531 0.422171 0.430633 0.435269 0.436552 0.430550
+24 8 15 0.417206 0.393678 0.360905 0.317067 0.266466 0.211551 0.157069 0.134734
+24 16 23 0.141168 0.147291 0.153025 0.158384 0.163025 0.167034 0.169605 0.171503
+24 24 31 0.171690 0.170224 0.166593 0.161388 0.154023 0.143930 0.132261 0.118086
+25 0 7 0.379758 0.391377 0.402532 0.412005 0.419602 0.424148 0.423053 0.416774
+25 8 15 0.402347 0.379582 0.346222 0.303834 0.254650 0.202059 0.150622 0.136207
+25 16 23 0.142384 0.148567 0.154328 0.159891 0.164510 0.168174 0.171415 0.172916
+25 24 31 0.173461 0.171379 0.168551 0.162685 0.155613 0.146492 0.134180 0.120571
+26 0 7 0.372798 0.383053 0.393059 0.402145 0.408153 0.411188 0.409948 0.402157
+26 8 15 0.387845 0.363837 0.331021 0.290563 0.242653 0.192045 0.144573 0.136847
+26 16 23 0.142883 0.149118 0.154923 0.160037 0.164587 0.168513 0.171257 0.173045
+26 24 31 0.173246 0.172293 0.168497 0.163396 0.156673 0.147520 0.135550 0.121919
+27 0 7 0.365348 0.374557 0.384086 0.391317 0.396646 0.399066 0.396014 0.387738
+27 8 15 0.371994 0.348567 0.316195 0.276504 0.230679 0.182670 0.139515 0.136890
+27 16 23 0.143111 0.148820 0.154290 0.159530 0.164372 0.167929 0.170471 0.172170
+27 24 31 0.172374 0.171069 0.167776 0.162802 0.156142 0.146502 0.135392 0.122397
+28 0 7 0.356842 0.366318 0.374604 0.380801 0.385230 0.385899 0.381846 0.372811
+28 8 15 0.356758 0.332895 0.301334 0.262615 0.218495 0.172380 0.134740 0.136241
+28 16 23 0.142234 0.147830 0.153366 0.158187 0.162531 0.166243 0.168827 0.170380
+28 24 31 0.170492 0.169202 0.166074 0.161204 0.154679 0.146029 0.134431 0.122444
+29 0 7 0.349152 0.356860 0.364677 0.369464 0.372164 0.372415 0.367443 0.357847
+29 8 15 0.340758 0.317406 0.286724 0.248457 0.206389 0.162813 0.131079 0.135161
+29 16 23 0.140978 0.146641 0.151697 0.156518 0.160365 0.164085 0.166423 0.167466
+29 24 31 0.167977 0.166364 0.163458 0.158763 0.152520 0.143853 0.133298 0.121090
+30 0 7 0.340894 0.347751 0.353632 0.358282 0.360023 0.358951 0.352769 0.342947
+30 8 15 0.326099 0.301870 0.271581 0.235427 0.194821 0.153517 0.128272 0.133505
+30 16 23 0.139144 0.144206 0.149126 0.153468 0.157746 0.160777 0.163332 0.164535
+30 24 31 0.164687 0.162945 0.159887 0.155330 0.149289 0.141345 0.131102 0.119076
+31 0 7 0.331994 0.338050 0.344111 0.347101 0.348077 0.345493 0.339327 0.327724
+31 8 15 0.310382 0.286394 0.256869 0.221651 0.183757 0.144033 0.125838 0.131490
+31 16 23 0.136595 0.141821 0.146540 0.150561 0.154227 0.157130 0.159302 0.160261
+31 24 31 0.160319 0.158719 0.155920 0.151493 0.145635 0.137442 0.127901 0.116855
Added: test-suite/trunk/External/SPEC/CINT2000/252.eon/252.eon.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/252.eon/252.eon.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/252.eon/252.eon.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CINT2000/252.eon/252.eon.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,11 @@
+0 0 7 0.408383 0.432584 0.408618 0.298047 0.141064 0.121400 0.128771 0.128111
+ 0.114085 0.0860921 0 7 0.429023 0.465579 0.449997 0.343504 0.161271 0.095890 0.100201 0.096653
+ 0.083032 0.0594742 0 7 0.443612 0.488994 0.438416 0.365324 0.165721 0.069785 0.070053 0.065694
+ 0.054276 0.0362673 0 7 0.450584 0.384844 0.183620 0.373665 0.160582 0.109439 0.077087 0.075382
+ 0.064665 0.0449504 0 7 0.450190 0.344762 0.135151 0.458742 0.200586 0.111737 0.104021 0.103952
+ 0.092387 0.0670695 0 7 0.442123 0.459617 0.334232 0.356473 0.202292 0.118818 0.130701 0.133347
+ 0.121700 0.0927486 0 7 0.426444 0.469268 0.472160 0.376042 0.189957 0.136644 0.151362 0.157334
+ 0.146574 0.1160977 0 7 0.404307 0.439291 0.432549 0.338276 0.176325 0.147117 0.163119 0.169948
+ 0.161133 0.1309148 0 7 0.378685 0.401140 0.385670 0.294186 0.157858 0.148816 0.164739 0.171559
+ 0.163607 0.1358089 0 7 0.349833 0.362917 0.336565 0.249451 0.140923 0.144426 0.157574 0.162794
+ 0.155555 0.131538
\ No newline at end of file
Added: test-suite/trunk/External/SPEC/CINT2000/253.perlbmk/253.perlbmk.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/253.perlbmk/253.perlbmk.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/253.perlbmk/253.perlbmk.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2000/253.perlbmk/253.perlbmk.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,3 @@
+yankeeist --> yankeeist
+acetylic --> acetylic
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2000/253.perlbmk/253.perlbmk.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/253.perlbmk/253.perlbmk.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/253.perlbmk/253.perlbmk.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CINT2000/253.perlbmk/253.perlbmk.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,1344 @@
+1..3
+#1 :abcdef: eq :abcdef:
+ok 1
+#2 :abcdefxyz: eq :abcdefxyz:
+ok 2
+#3 :abcdef: eq :abcdef:
+ok 3
+1..4
+ok 1
+ok 2
+ok 3
+ok 4
+1..36
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+ok 23
+ok 24
+ok 25
+ok 26
+ok 27
+ok 28
+ok 29
+ok 30
+ok 31
+ok 32
+ok 33
+ok 34
+ok 35
+ok 36
+1..34
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+ok 23
+ok 24
+ok 25
+ok 26
+ok 27
+ok 28
+ok 29
+ok 30
+ok 31
+ok 32
+ok 33
+ok 34
+1..28
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+ok 23
+ok 24
+ok 25
+ok 26
+ok 27
+ok 28
+1..44
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+ok 23
+ok 24
+ok 25
+ok 26
+ok 27
+ok 28
+ok 29
+ok 30
+ok 31
+ok 32
+ok 33
+ok 34
+ok 35
+ok 36
+ok 37
+ok 38
+ok 39
+ok 40
+ok 41
+ok 42
+ok 43
+ok 44
+1..72
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+ok 23
+ok 24
+ok 25
+ok 26
+ok 27
+ok 28
+ok 29
+ok 30
+ok 31
+ok 32
+ok 33
+ok 34
+ok 35
+ok 36
+ok 37
+ok 38
+ok 39
+ok 40
+ok 41
+ok 42
+ok 43
+ok 44
+ok 45
+ok 46
+ok 47
+ok 48
+ok 49
+ok 50
+ok 51
+ok 52
+ok 53
+ok 54
+ok 55
+ok 56
+ok 57
+ok 58
+ok 59
+ok 60
+ok 61
+ok 62
+ok 63
+ok 64
+ok 65
+ok 66
+ok 67
+ok 68
+ok 69
+ok 70
+ok 71
+ok 72
+1..4
+ok 1
+ok 2
+ok 3
+ok 4
+1..7
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+1..16
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+1..15
+ok 1
+#2 :value: eq :value:
+ok 2
+ok 3
+ok 4
+#5 :value: eq :value:
+ok 5
+ok 6
+ok 7
+#8 :value: eq :value:
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+1..14
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+1..4
+ok 1
+ok 2
+ok 3
+ok 4
+1..16
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+1..6
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+1..7
+#1 :10: eq :10:
+#1 :0 1 2 3 4 5 6 7 8 9 10: eq :0 1 2 3 4 5 6 7 8 9 10:
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+1..9
+#1 :2: == 2
+ok 1
+#2 :4: == 4
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+1..11
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+1..2
+ok 1
+ok 2
+1..6
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+1..20
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+1..4
+ok 1
+ok 2
+ok 3
+ok 4
+1..3
+ok 1
+ok 2
+ok 3
+1..27
+#1 :x: eq :x:
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+ok 23
+ok 24
+ok 25
+ok 26
+ok 27
+1..27
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+#11 1;2;3;4 eq 1;2;3;4
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+ok 23
+ok 24
+ok 25
+ok 26
+ok 27
+1..23
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+ok 23
+1..24
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+ok 23
+ok 24
+1..11
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+1..28
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+ok 23
+ok 24
+ok 25
+ok 26
+ok 27
+ok 28
+1..8
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+1..3
+ok 1
+ok 2
+ok 3
+1..7
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+1..62
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+ok 23
+ok 24
+ok 25
+ok 26
+ok 27
+ok 28
+ok 29
+ok 30
+ok 31
+ok 32
+ok 33
+ok 34
+ok 35
+ok 36
+ok 37
+ok 38
+ok 39
+ok 40
+ok 41
+ok 42
+ok 43
+ok 44
+ok 45
+ok 46
+ok 47
+ok 48
+ok 49
+ok 50
+ok 51
+ok 52
+ok 53
+ok 54
+ok 55
+ok 56
+ok 57
+ok 58
+ok 59
+ok 60
+ok 61
+ok 62
+1..16
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+1..13
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+1..15
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+Looking for 3023170969...got it!
+Random numbers okay!
+1..8
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+1..23
+ok 1
+# gcd(1147, 1271) = 31
+ok 2
+# gcd(1908, 2016) = 36
+ok 3
+# factorial(10) = 3628800
+ok 4
+# factorial(factorial(3)) = 720
+ok 5
+# fibonacci(10) = 89
+ok 6
+# fibonacci(fibonacci(7)) = 17711
+ok 7
+# ackermann(0, 0) = 1
+ok 8
+# ackermann(0, 1) = 2
+ok 9
+# ackermann(0, 2) = 3
+ok 10
+# ackermann(0, 3) = 4
+ok 11
+# ackermann(1, 0) = 2
+ok 12
+# ackermann(1, 1) = 3
+ok 13
+# ackermann(1, 2) = 4
+ok 14
+# ackermann(1, 3) = 5
+ok 15
+# ackermann(2, 0) = 3
+ok 16
+# ackermann(2, 1) = 5
+ok 17
+# ackermann(2, 2) = 7
+ok 18
+# ackermann(2, 3) = 9
+ok 19
+# ackermann(3, 0) = 5
+ok 20
+# ackermann(3, 1) = 13
+ok 21
+# ackermann(3, 2) = 29
+ok 22
+# ackermann(3, 3) = 61
+ok 23
+# takeuchi(18, 12, 6) = 7
+1..18
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+1..51
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+ok 23
+ok 24
+ok 25
+ok 26
+ok 27
+ok 28
+ok 29
+ok 30
+ok 31
+ok 32
+ok 33
+ok 34
+ok 35
+ok 36
+ok 37
+ok 38
+ok 39
+ok 40
+ok 41
+ok 42
+ok 43
+ok 44
+# leaving block
+# larry
+ok 45
+# curly
+ok 46
+# moe
+ok 47
+# left block
+ok 48
+ok 49
+ok 50
+ok 51
+1..19
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+1..3
+ok 1
+ok 2
+ok 3
+1..1
+ok 1
+1..19
+ok 1
+# x = 'AbelCaincatdogx'
+ok 2
+# x = 'xdogcatCainAbel'
+ok 3
+# x = 'AbelAxedCaincatchaseddoggonepunishedtoxyz'
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+# x = '1 2 3 4'
+ok 12
+# x = '1 2 3 4'
+ok 13
+# x = '1 2 3 4'
+ok 14
+# x = '1 2 3 4'
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+1..20
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+1..4
+ok 1
+ok 2
+ok 3
+ok 4
+1..24
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+ok 23
+ok 24
+1..62
+#1 :$x: eq :$x:
+ok 1
+#2 :foo: eq :foo:
+ok 2
+#3 :$x foo: eq :$x foo:
+ok 3
+#4 :bcde: eq :bcde:
+#4 :a\n$1f: eq :a\n$1f:
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+ok 23
+ok 24
+ok 25
+ok 26
+ok 27
+ok 28
+ok 29
+ok 30
+ok 31
+ok 32
+ok 33
+ok 34
+ok 35
+ok 36
+ok 37
+ok 38
+ok 39
+ok 40
+ok 41
+ok 42
+ok 43
+ok 44
+ok 45
+ok 46
+ok 47
+ok 48
+ok 49
+ok 50
+ok 51
+ok 52
+ok 53
+ok 54
+ok 55
+ok 56
+ok 57
+ok 58
+ok 59
+ok 60
+ok 61
+ok 62
+1..97
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+ok 23
+ok 24
+ok 25
+ok 26
+ok 27
+ok 28
+ok 29
+ok 30
+ok 31
+ok 32
+ok 33
+ok 34
+ok 35
+ok 36
+ok 37
+ok 38
+ok 39
+ok 40
+ok 41
+ok 42
+ok 43
+ok 44
+ok 45
+ok 46
+ok 47
+ok 48
+ok 49
+ok 50
+ok 51
+ok 52
+ok 53
+ok 54
+ok 55
+ok 56
+ok 57
+ok 58
+ok 59
+ok 60
+ok 61
+ok 62
+ok 63
+ok 64
+ok 65
+ok 66
+ok 67
+ok 68
+ok 69
+ok 70
+ok 71
+ok 72
+ok 73
+ok 74
+ok 75
+ok 76
+ok 77
+ok 78
+ok 79
+ok 80
+ok 81
+ok 82
+ok 83
+ok 84
+ok 85
+ok 86
+ok 87
+ok 88
+ok 89
+ok 90
+ok 91
+ok 92
+ok 93
+ok 94
+ok 95
+ok 96
+ok 97
+1..34
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+ok 23
+ok 24
+ok 25
+ok 26
+ok 27
+ok 28
+ok 29
+ok 30
+ok 31
+ok 32
+ok 33
+ok 34
+1..18
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+1..8
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+1..22
+#1 :\n: eq :\n:
+ok 1
+#2 :\n: eq :\n:
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+ok 22
+
+append
+
+arith
+
+array
+
+auto
+
+chop
+
+cmdopt
+
+cmp
+
+cond
+
+decl
+
+delete
+
+do
+
+each
+
+elsif
+
+eval
+
+exp
+
+for
+
+goto
+
+gv
+
+if
+
+inc
+
+index
+
+int
+
+join
+
+lex
+
+list
+
+local
+
+method
+
+mod
+
+my
+
+oct
+
+ord
+
+package
+
+pat
+
+print
+
+push
+
+quotemeta
+
+rand
+
+range
+
+recurse
+
+redef
+
+ref
+
+repeat
+
+script
+
+sleep
+
+sort
+
+split
+
+sprintf
+
+study
+
+subst
+
+substr
+
+subval
+
+switch
+
+symbol
+
+term
+
+time
+
+undef
+
+unshift
+
+vec
+
+while
+exit 0
+1..5
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+1..21
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+ok 14
+ok 15
+ok 16
+ok 17
+ok 18
+ok 19
+ok 20
+ok 21
+1..2
+ok 1
+ok 2
+1..13
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
+ok 11
+ok 12
+ok 13
+1..10
+ok 1
+ok 2
+ok 3
+ok 4
+ok 5
+ok 6
+ok 7
+ok 8
+ok 9
+ok 10
Added: test-suite/trunk/External/SPEC/CINT2000/254.gap/254.gap.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/254.gap/254.gap.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/254.gap/254.gap.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2000/254.gap/254.gap.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,265 @@
+[ 1, 1, 2, 6, 24, 120, 720, 5040, 40320, 362880, 3628800 ]
+30414093201713378043612608166064768844377641568960512000000000000
+[ 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0 ]
+[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
+17035900270730601418919867558071677342938596450600561760371485120
+[ 1, 1, 2, 5, 15, 52, 203, 877, 4140, 21147, 115975 ]
+[ 1, 1, 2, 5, 15, 52, 203, 877, 4140, 21147, 115975 ]
+976939307467007552986994066961675455550246347757474482558637
+[ 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0 ]
+[ 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0 ]
+true
+568611292461582075463109862277030309493811818619783570055397018154658816
+[ 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0 ]
+[ 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0 ]
+true
+170886257768137628374668205554120607567311094075812403938286
+[ [ ] ]
+[ [ [ ] ], [ ] ]
+[ [ ], [ 1 ], [ 1, 2 ], [ 1, 2, 3 ], [ 1, 2, 3, 4 ], [ 1, 2, 4 ], [ 1, 3 ],
+ [ 1, 3, 4 ], [ 1, 4 ], [ 2 ], [ 2, 3 ], [ 2, 3, 4 ], [ 2, 4 ], [ 3 ],
+ [ 3, 4 ], [ 4 ] ]
+[ [ [ ] ], [ [ 1 ], [ 2 ], [ 3 ], [ 4 ] ],
+ [ [ 1, 2 ], [ 1, 3 ], [ 1, 4 ], [ 2, 3 ], [ 2, 4 ], [ 3, 4 ] ],
+ [ [ 1, 2, 3 ], [ 1, 2, 4 ], [ 1, 3, 4 ], [ 2, 3, 4 ] ], [ [ 1, 2, 3, 4 ] ],
+ [ ] ]
+[ [ ], [ 1 ], [ 1, 2 ], [ 1, 2, 2 ], [ 1, 2, 2, 3 ], [ 1, 2, 3 ], [ 1, 3 ],
+ [ 2 ], [ 2, 2 ], [ 2, 2, 3 ], [ 2, 3 ], [ 3 ] ]
+[ [ [ ] ], [ [ 1 ], [ 2 ], [ 3 ] ],
+ [ [ 1, 2 ], [ 1, 3 ], [ 2, 2 ], [ 2, 3 ] ],
+ [ [ 1, 2, 2 ], [ 1, 2, 3 ], [ 2, 2, 3 ] ], [ [ 1, 2, 2, 3 ] ], [ ] ]
+[ 7, 8, 9, 10, 11, 12 ]
+[ 1, 5, 9, 13 ]
+[ 1, 2, 3, 4, 5, 6, 7 ]
+[ 1, 2, 3, 4, 5, 6, 7, 8 ]
+[ 17 ]
+1
+[ 1, 0 ]
+16
+[ 1, 4, 6, 4, 1, 0 ]
+12
+[ 1, 3, 4, 3, 1, 0 ]
+4096
+1820
+2880
+1558
+[ [ ] ]
+[ [ [ ] ], [ ] ]
+[ [ ], [ 1 ], [ 1, 2 ], [ 1, 2, 3 ], [ 1, 3 ], [ 1, 3, 2 ], [ 2 ], [ 2, 1 ],
+ [ 2, 1, 3 ], [ 2, 3 ], [ 2, 3, 1 ], [ 3 ], [ 3, 1 ], [ 3, 1, 2 ], [ 3, 2 ],
+ [ 3, 2, 1 ] ]
+[ [ [ ] ], [ [ 1 ], [ 2 ], [ 3 ] ],
+ [ [ 1, 2 ], [ 1, 3 ], [ 2, 1 ], [ 2, 3 ], [ 3, 1 ], [ 3, 2 ] ],
+ [ [ 1, 2, 3 ], [ 1, 3, 2 ], [ 2, 1, 3 ], [ 2, 3, 1 ], [ 3, 1, 2 ],
+ [ 3, 2, 1 ] ], [ ] ]
+[ [ ], [ 1 ], [ 1, 2 ], [ 1, 2, 2 ], [ 1, 2, 2, 3 ], [ 1, 2, 3 ],
+ [ 1, 2, 3, 2 ], [ 1, 3 ], [ 1, 3, 2 ], [ 1, 3, 2, 2 ], [ 2 ], [ 2, 1 ],
+ [ 2, 1, 2 ], [ 2, 1, 2, 3 ], [ 2, 1, 3 ], [ 2, 1, 3, 2 ], [ 2, 2 ],
+ [ 2, 2, 1 ], [ 2, 2, 1, 3 ], [ 2, 2, 3 ], [ 2, 2, 3, 1 ], [ 2, 3 ],
+ [ 2, 3, 1 ], [ 2, 3, 1, 2 ], [ 2, 3, 2 ], [ 2, 3, 2, 1 ], [ 3 ], [ 3, 1 ],
+ [ 3, 1, 2 ], [ 3, 1, 2, 2 ], [ 3, 2 ], [ 3, 2, 1 ], [ 3, 2, 1, 2 ],
+ [ 3, 2, 2 ], [ 3, 2, 2, 1 ] ]
+[ [ [ ] ], [ [ 1 ], [ 2 ], [ 3 ] ],
+ [ [ 1, 2 ], [ 1, 3 ], [ 2, 1 ], [ 2, 2 ], [ 2, 3 ], [ 3, 1 ], [ 3, 2 ] ],
+ [ [ 1, 2, 2 ], [ 1, 2, 3 ], [ 1, 3, 2 ], [ 2, 1, 2 ], [ 2, 1, 3 ],
+ [ 2, 2, 1 ], [ 2, 2, 3 ], [ 2, 3, 1 ], [ 2, 3, 2 ], [ 3, 1, 2 ],
+ [ 3, 2, 1 ], [ 3, 2, 2 ] ],
+ [ [ 1, 2, 2, 3 ], [ 1, 2, 3, 2 ], [ 1, 3, 2, 2 ], [ 2, 1, 2, 3 ],
+ [ 2, 1, 3, 2 ], [ 2, 2, 1, 3 ], [ 2, 2, 3, 1 ], [ 2, 3, 1, 2 ],
+ [ 2, 3, 2, 1 ], [ 3, 1, 2, 2 ], [ 3, 2, 1, 2 ], [ 3, 2, 2, 1 ] ], [ ] ]
+[ 3, 2, 1, 6, 5, 4 ]
+[ 3, 1, 7, 5 ]
+[ 5, 4, 3, 2, 1 ]
+[ 2, 3, 4, 5, 6 ]
+1
+[ 1, 0 ]
+16
+[ 1, 3, 6, 6, 0 ]
+35
+[ 1, 3, 7, 12, 12, 0 ]
+1957
+1680
+3592
+2880
+[ [ [ ] ], [ ] ]
+[ [ [ ] ], [ [ 1 ], [ 2 ], [ 3 ] ],
+ [ [ 1, 1 ], [ 1, 2 ], [ 1, 3 ], [ 2, 2 ], [ 2, 3 ], [ 3, 3 ] ],
+ [ [ 1, 1, 1 ], [ 1, 1, 2 ], [ 1, 1, 3 ], [ 1, 2, 2 ], [ 1, 2, 3 ],
+ [ 1, 3, 3 ], [ 2, 2, 2 ], [ 2, 2, 3 ], [ 2, 3, 3 ], [ 3, 3, 3 ] ],
+ [ [ 1, 1, 1, 1 ], [ 1, 1, 1, 2 ], [ 1, 1, 1, 3 ], [ 1, 1, 2, 2 ],
+ [ 1, 1, 2, 3 ], [ 1, 1, 3, 3 ], [ 1, 2, 2, 2 ], [ 1, 2, 2, 3 ],
+ [ 1, 2, 3, 3 ], [ 1, 3, 3, 3 ], [ 2, 2, 2, 2 ], [ 2, 2, 2, 3 ],
+ [ 2, 2, 3, 3 ], [ 2, 3, 3, 3 ], [ 3, 3, 3, 3 ] ] ]
+[ 1, 3, 5, 7, 9, 10 ]
+[ 18, 18, 18, 18, 18, 18 ]
+[ 1, 0 ]
+[ 1, 3, 6, 10, 15 ]
+5005
+[ [ [ ] ], [ ] ]
+[ [ [ ] ], [ [ 1 ], [ 2 ], [ 3 ] ],
+ [ [ 1, 1 ], [ 1, 2 ], [ 1, 3 ], [ 2, 1 ], [ 2, 2 ], [ 2, 3 ], [ 3, 1 ],
+ [ 3, 2 ], [ 3, 3 ] ],
+ [ [ 1, 1, 1 ], [ 1, 1, 2 ], [ 1, 1, 3 ], [ 1, 2, 1 ], [ 1, 2, 2 ],
+ [ 1, 2, 3 ], [ 1, 3, 1 ], [ 1, 3, 2 ], [ 1, 3, 3 ], [ 2, 1, 1 ],
+ [ 2, 1, 2 ], [ 2, 1, 3 ], [ 2, 2, 1 ], [ 2, 2, 2 ], [ 2, 2, 3 ],
+ [ 2, 3, 1 ], [ 2, 3, 2 ], [ 2, 3, 3 ], [ 3, 1, 1 ], [ 3, 1, 2 ],
+ [ 3, 1, 3 ], [ 3, 2, 1 ], [ 3, 2, 2 ], [ 3, 2, 3 ], [ 3, 3, 1 ],
+ [ 3, 3, 2 ], [ 3, 3, 3 ] ] ]
+[ 1, 3, 5, 7 ]
+[ 1, 0 ]
+[ 1, 3, 9, 27 ]
+4096
+[ [ ] ]
+[ [ 1, 2, 3, 4 ], [ 1, 2, 4, 3 ], [ 1, 3, 2, 4 ], [ 1, 3, 4, 2 ],
+ [ 1, 4, 2, 3 ], [ 1, 4, 3, 2 ], [ 2, 1, 3, 4 ], [ 2, 1, 4, 3 ],
+ [ 2, 3, 1, 4 ], [ 2, 3, 4, 1 ], [ 2, 4, 1, 3 ], [ 2, 4, 3, 1 ],
+ [ 3, 1, 2, 4 ], [ 3, 1, 4, 2 ], [ 3, 2, 1, 4 ], [ 3, 2, 4, 1 ],
+ [ 3, 4, 1, 2 ], [ 3, 4, 2, 1 ], [ 4, 1, 2, 3 ], [ 4, 1, 3, 2 ],
+ [ 4, 2, 1, 3 ], [ 4, 2, 3, 1 ], [ 4, 3, 1, 2 ], [ 4, 3, 2, 1 ] ]
+[ [ 1, 2, 2, 3 ], [ 1, 2, 3, 2 ], [ 1, 3, 2, 2 ], [ 2, 1, 2, 3 ],
+ [ 2, 1, 3, 2 ], [ 2, 2, 1, 3 ], [ 2, 2, 3, 1 ], [ 2, 3, 1, 2 ],
+ [ 2, 3, 2, 1 ], [ 3, 1, 2, 2 ], [ 3, 2, 1, 2 ], [ 3, 2, 2, 1 ] ]
+[ 2, 1, 4, 3, 6, 5 ]
+[ 4, 3, 2, 1, 4, 3, 2, 4 ]
+1
+24
+12
+720
+1680
+[ [ ] ]
+[ [ 2, 1, 4, 3 ], [ 2, 3, 4, 1 ], [ 2, 4, 1, 3 ], [ 3, 1, 4, 2 ],
+ [ 3, 4, 1, 2 ], [ 3, 4, 2, 1 ], [ 4, 1, 2, 3 ], [ 4, 3, 1, 2 ],
+ [ 4, 3, 2, 1 ] ]
+[ 4, 3, 6, 1, 2, 5 ]
+[ 4, 1, 4, 2, 4, 2, 3, 3 ]
+1
+9
+265
+126
+9
+24
+[ [ ] ]
+[ [ [ ] ], [ ] ]
+[ [ [ 1 ], [ 2 ], [ 3 ], [ 4 ] ], [ [ 1 ], [ 2 ], [ 3, 4 ] ],
+ [ [ 1 ], [ 2, 3 ], [ 4 ] ], [ [ 1 ], [ 2, 3, 4 ] ],
+ [ [ 1 ], [ 2, 4 ], [ 3 ] ], [ [ 1, 2 ], [ 3 ], [ 4 ] ],
+ [ [ 1, 2 ], [ 3, 4 ] ], [ [ 1, 2, 3 ], [ 4 ] ], [ [ 1, 2, 3, 4 ] ],
+ [ [ 1, 2, 4 ], [ 3 ] ], [ [ 1, 3 ], [ 2 ], [ 4 ] ], [ [ 1, 3 ], [ 2, 4 ] ],
+ [ [ 1, 3, 4 ], [ 2 ] ], [ [ 1, 4 ], [ 2 ], [ 3 ] ], [ [ 1, 4 ], [ 2, 3 ] ] ]
+[ [ ], [ [ [ 1, 2, 3 ] ] ],
+ [ [ [ 1 ], [ 2, 3 ] ], [ [ 1, 2 ], [ 3 ] ], [ [ 1, 3 ], [ 2 ] ] ],
+ [ [ [ 1 ], [ 2 ], [ 3 ] ] ], [ ] ]
+[ [ 1, 3, 5, 7 ], [ 2, 4, 6 ] ]
+[ [ 1, 2, 3 ], [ 4, 5 ], [ 6, 7, 8 ] ]
+1
+[ 1, 0 ]
+15
+[ 0, 1, 3, 1, 0 ]
+4140
+3025
+[ [ ] ]
+[ [ [ ] ], [ ] ]
+[ [ 1, 1, 1, 1, 1, 1 ], [ 2, 1, 1, 1, 1 ], [ 2, 2, 1, 1 ], [ 2, 2, 2 ],
+ [ 3, 1, 1, 1 ], [ 3, 2, 1 ], [ 3, 3 ], [ 4, 1, 1 ], [ 4, 2 ], [ 5, 1 ],
+ [ 6 ] ]
+[ [ ], [ [ 6 ] ], [ [ 3, 3 ], [ 4, 2 ], [ 5, 1 ] ],
+ [ [ 2, 2, 2 ], [ 3, 2, 1 ], [ 4, 1, 1 ] ],
+ [ [ 2, 2, 1, 1 ], [ 3, 1, 1, 1 ] ], [ [ 2, 1, 1, 1, 1 ] ],
+ [ [ 1, 1, 1, 1, 1, 1 ] ], [ ] ]
+[ 7, 4, 3, 3, 2, 1 ]
+[ 5, 3, 3, 2, 2, 1, 1, 1, 1, 1 ]
+1
+[ 1, 0 ]
+11
+[ 0, 1, 3, 3, 2, 1, 1, 0 ]
+190569292
+2977866
+[ [ ] ]
+[ [ [ ] ], [ ] ]
+[ [ 1, 1, 1, 1, 1 ], [ 1, 1, 1, 2 ], [ 1, 1, 2, 1 ], [ 1, 1, 3 ],
+ [ 1, 2, 1, 1 ], [ 1, 2, 2 ], [ 1, 3, 1 ], [ 1, 4 ], [ 2, 1, 1, 1 ],
+ [ 2, 1, 2 ], [ 2, 2, 1 ], [ 2, 3 ], [ 3, 1, 1 ], [ 3, 2 ], [ 4, 1 ], [ 5 ] ]
+[ [ ], [ [ 5 ] ], [ [ 1, 4 ], [ 2, 3 ], [ 3, 2 ], [ 4, 1 ] ],
+ [ [ 1, 1, 3 ], [ 1, 2, 2 ], [ 1, 3, 1 ], [ 2, 1, 2 ], [ 2, 2, 1 ],
+ [ 3, 1, 1 ] ],
+ [ [ 1, 1, 1, 2 ], [ 1, 1, 2, 1 ], [ 1, 2, 1, 1 ], [ 2, 1, 1, 1 ] ],
+ [ [ 1, 1, 1, 1, 1 ] ], [ ] ]
+[ 1, 12 ]
+[ 1, 11, 1, 1, 1, 1 ]
+1
+[ 1, 0 ]
+16
+[ 0, 1, 4, 6, 4, 1, 0 ]
+4096
+3003
+[ [ ] ]
+[ [ [ ] ], [ ] ]
+[ [ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ], [ 2, 1, 1, 1, 1, 1, 1, 1, 1 ],
+ [ 2, 2, 1, 1, 1, 1, 1, 1 ], [ 2, 2, 2, 1, 1, 1, 1 ], [ 2, 2, 2, 2, 1, 1 ],
+ [ 2, 2, 2, 2, 2 ], [ 5, 1, 1, 1, 1, 1 ], [ 5, 2, 1, 1, 1 ], [ 5, 2, 2, 1 ],
+ [ 5, 5 ], [ 10 ] ]
+[ [ [ 10 ] ], [ [ 5, 5 ] ], [ ], [ [ 5, 2, 2, 1 ] ],
+ [ [ 2, 2, 2, 2, 2 ], [ 5, 2, 1, 1, 1 ] ],
+ [ [ 2, 2, 2, 2, 1, 1 ], [ 5, 1, 1, 1, 1, 1 ] ], [ [ 2, 2, 2, 1, 1, 1, 1 ] ],
+ [ [ 2, 2, 1, 1, 1, 1, 1, 1 ] ], [ [ 2, 1, 1, 1, 1, 1, 1, 1, 1 ] ],
+ [ [ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ] ] ]
+[ [ 2, 2, 2, 2, 2, 2, 2, 2, 2, 2 ], [ 5, 5, 2, 2, 2, 2, 2 ], [ 5, 5, 5, 5 ],
+ [ 10, 2, 2, 2, 2, 2 ], [ 10, 5, 5 ], [ 10, 10 ] ]
+[ [ ], [ [ 10, 10 ] ], [ [ 10, 5, 5 ] ], [ [ 5, 5, 5, 5 ] ], [ ],
+ [ [ 10, 2, 2, 2, 2, 2 ] ], [ [ 5, 5, 2, 2, 2, 2, 2 ] ], [ ], [ ],
+ [ [ 2, 2, 2, 2, 2, 2, 2, 2, 2, 2 ] ], [ ], [ ], [ ], [ ], [ ], [ ],
+ [ ], [ ], [ ], [ ] ]
+[ 13, 7, 5, 5, 5, 5, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2 ]
+[ 17, 17, 13, 13, 13, 7, 5, 5, 5, 5 ]
+1
+[ 1, 0 ]
+341
+[ 0, 0, 0, 0, 1, 1, 1, 2, 4, 6, 6, 8, 10, 11, 11, 12, 13, 14, 14, 14, 15, 15,
+ 14, 14, 14, 13, 12, 12, 11, 10, 9, 9, 8, 7, 6, 6, 6, 5, 4, 4, 4, 3, 2, 2,
+ 2, 2, 1, 1, 1, 1 ]
+21
+[ 0, 0, 0, 0, 1, 1, 1, 1, 2, 2, 1, 1, 2, 1, 1, 1, 1, 1, 1, 0, 1, 1, 0, 0, 1,
+ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]
+1213
+125
+[ 0, 1, 1, 3, 5, 11, 21, 43, 85, 171, 341 ]
+[ 2, 1, 5, 7, 17, 31, 65, 127, 257, 511, 1025 ]
+[ 0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55 ]
+[ 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
+true
+[ 0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144, 233, 377, 610, 987, 1597 ]
+1751455877444438095408940282208383549115781784912085789506677971125378
+[ 1, -1/2, 1/6, 0, -1/30, 0, 1/42, 0, -1/30, 0, 5/66, 0, -691/2730, 0, 7/6 ]
+-4603784299479457646935574969019046849794257872751288919656867/230010
+[ [ 1, 16 ], [ 4, 18 ], [ 16, 2 ] ]
+3280
+1
+G has 96 classes of altogether 11300 subgroups.
+
+
+********* S_3
+[sizes:2*3,2*3,3]
+size=3size=3
+
+Subgroup generated by 4 random elements...
+[sizes:2*3,2*3,3]
+size=3size=3
+
+
+********* S_3wrS_4
+[sizes:2^7*3^5,2^7*3^5,3^5]
+size=3^5size=3^5
+
+Subgroup generated by 4 random elements...
+[sizes:2^7*3^5,2^7*3^5,3^5]
+size=3^5size=3^5
+
+
+********* S_4wrS_4
+[sizes:2^15*3^5,2^15*3^5,3^5]
+size=3^5size=3^5
+
+Subgroup generated by 4 random elements...
+[sizes:2^14*3^5,2^14*3^5,3^5]
+size=3^5size=3^5
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2000/254.gap/254.gap.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/254.gap/254.gap.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/254.gap/254.gap.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CINT2000/254.gap/254.gap.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,255 @@
+[ 1, 1, 2, 6, 24, 120, 720, 5040, 40320, 362880, 3628800 ]
+30414093201713378043612608166064768844377641568960512000000000000
+[ 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0 ]
+[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
+true
+17035900270730601418919867558071677342938596450600561760371485120
+[ 1, 1, 2, 5, 15, 52, 203, 877, 4140, 21147, 115975 ]
+[ 1, 1, 2, 5, 15, 52, 203, 877, 4140, 21147, 115975 ]
+976939307467007552986994066961675455550246347757474482558637
+[ 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0 ]
+[ 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0 ]
+true
+568611292461582075463109862277030309493811818619783570055397018154658816
+[ 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0 ]
+[ 0, 0, 0, 0, 0, 0, 0, 0, 1, 0, 0, 0, 0, 0, 0, 0, 0 ]
+true
+170886257768137628374668205554120607567311094075812403938286
+[ [ ] ]
+[ [ [ ] ], [ ] ]
+[ [ ], [ 1 ], [ 1, 2 ], [ 1, 2, 3 ], [ 1, 2, 3, 4 ], [ 1, 2, 4 ], [ 1, 3 ],
+ [ 1, 3, 4 ], [ 1, 4 ], [ 2 ], [ 2, 3 ], [ 2, 3, 4 ], [ 2, 4 ], [ 3 ],
+ [ 3, 4 ], [ 4 ] ]
+[ [ [ ] ], [ [ 1 ], [ 2 ], [ 3 ], [ 4 ] ],
+ [ [ 1, 2 ], [ 1, 3 ], [ 1, 4 ], [ 2, 3 ], [ 2, 4 ], [ 3, 4 ] ],
+ [ [ 1, 2, 3 ], [ 1, 2, 4 ], [ 1, 3, 4 ], [ 2, 3, 4 ] ], [ [ 1, 2, 3, 4 ] ],
+ [ ] ]
+[ [ ], [ 1 ], [ 1, 2 ], [ 1, 2, 2 ], [ 1, 2, 2, 3 ], [ 1, 2, 3 ], [ 1, 3 ],
+ [ 2 ], [ 2, 2 ], [ 2, 2, 3 ], [ 2, 3 ], [ 3 ] ]
+[ [ [ ] ], [ [ 1 ], [ 2 ], [ 3 ] ],
+ [ [ 1, 2 ], [ 1, 3 ], [ 2, 2 ], [ 2, 3 ] ],
+ [ [ 1, 2, 2 ], [ 1, 2, 3 ], [ 2, 2, 3 ] ], [ [ 1, 2, 2, 3 ] ], [ ] ]
+[ 7, 8, 9, 10, 11, 12 ]
+[ 1, 5, 9, 13 ]
+[ 1, 2, 3, 4, 5, 6, 7 ]
+[ 1, 2, 3, 4, 5, 6, 7, 8 ]
+1
+[ 1, 0 ]
+16
+[ 1, 4, 6, 4, 1, 0 ]
+12
+[ 1, 3, 4, 3, 1, 0 ]
+4096
+1820
+2880
+1558
+[ [ ] ]
+[ [ [ ] ], [ ] ]
+[ [ ], [ 1 ], [ 1, 2 ], [ 1, 2, 3 ], [ 1, 3 ], [ 1, 3, 2 ], [ 2 ], [ 2, 1 ],
+ [ 2, 1, 3 ], [ 2, 3 ], [ 2, 3, 1 ], [ 3 ], [ 3, 1 ], [ 3, 1, 2 ], [ 3, 2 ],
+ [ 3, 2, 1 ] ]
+[ [ [ ] ], [ [ 1 ], [ 2 ], [ 3 ] ],
+ [ [ 1, 2 ], [ 1, 3 ], [ 2, 1 ], [ 2, 3 ], [ 3, 1 ], [ 3, 2 ] ],
+ [ [ 1, 2, 3 ], [ 1, 3, 2 ], [ 2, 1, 3 ], [ 2, 3, 1 ], [ 3, 1, 2 ],
+ [ 3, 2, 1 ] ], [ ] ]
+[ [ ], [ 1 ], [ 1, 2 ], [ 1, 2, 2 ], [ 1, 2, 2, 3 ], [ 1, 2, 3 ],
+ [ 1, 2, 3, 2 ], [ 1, 3 ], [ 1, 3, 2 ], [ 1, 3, 2, 2 ], [ 2 ], [ 2, 1 ],
+ [ 2, 1, 2 ], [ 2, 1, 2, 3 ], [ 2, 1, 3 ], [ 2, 1, 3, 2 ], [ 2, 2 ],
+ [ 2, 2, 1 ], [ 2, 2, 1, 3 ], [ 2, 2, 3 ], [ 2, 2, 3, 1 ], [ 2, 3 ],
+ [ 2, 3, 1 ], [ 2, 3, 1, 2 ], [ 2, 3, 2 ], [ 2, 3, 2, 1 ], [ 3 ], [ 3, 1 ],
+ [ 3, 1, 2 ], [ 3, 1, 2, 2 ], [ 3, 2 ], [ 3, 2, 1 ], [ 3, 2, 1, 2 ],
+ [ 3, 2, 2 ], [ 3, 2, 2, 1 ] ]
+[ [ [ ] ], [ [ 1 ], [ 2 ], [ 3 ] ],
+ [ [ 1, 2 ], [ 1, 3 ], [ 2, 1 ], [ 2, 2 ], [ 2, 3 ], [ 3, 1 ], [ 3, 2 ] ],
+ [ [ 1, 2, 2 ], [ 1, 2, 3 ], [ 1, 3, 2 ], [ 2, 1, 2 ], [ 2, 1, 3 ],
+ [ 2, 2, 1 ], [ 2, 2, 3 ], [ 2, 3, 1 ], [ 2, 3, 2 ], [ 3, 1, 2 ],
+ [ 3, 2, 1 ], [ 3, 2, 2 ] ],
+ [ [ 1, 2, 2, 3 ], [ 1, 2, 3, 2 ], [ 1, 3, 2, 2 ], [ 2, 1, 2, 3 ],
+ [ 2, 1, 3, 2 ], [ 2, 2, 1, 3 ], [ 2, 2, 3, 1 ], [ 2, 3, 1, 2 ],
+ [ 2, 3, 2, 1 ], [ 3, 1, 2, 2 ], [ 3, 2, 1, 2 ], [ 3, 2, 2, 1 ] ], [ ] ]
+[ 3, 2, 1, 6, 5, 4 ]
+[ 3, 1, 7, 5 ]
+[ 5, 4, 3, 2, 1 ]
+[ 2, 3, 4, 5, 6 ]
+1
+[ 1, 0 ]
+16
+[ 1, 3, 6, 6, 0 ]
+35
+[ 1, 3, 7, 12, 12, 0 ]
+1957
+1680
+3592
+2880
+[ [ [ ] ], [ ] ]
+[ [ [ ] ], [ [ 1 ], [ 2 ], [ 3 ] ],
+ [ [ 1, 1 ], [ 1, 2 ], [ 1, 3 ], [ 2, 2 ], [ 2, 3 ], [ 3, 3 ] ],
+ [ [ 1, 1, 1 ], [ 1, 1, 2 ], [ 1, 1, 3 ], [ 1, 2, 2 ], [ 1, 2, 3 ],
+ [ 1, 3, 3 ], [ 2, 2, 2 ], [ 2, 2, 3 ], [ 2, 3, 3 ], [ 3, 3, 3 ] ],
+ [ [ 1, 1, 1, 1 ], [ 1, 1, 1, 2 ], [ 1, 1, 1, 3 ], [ 1, 1, 2, 2 ],
+ [ 1, 1, 2, 3 ], [ 1, 1, 3, 3 ], [ 1, 2, 2, 2 ], [ 1, 2, 2, 3 ],
+ [ 1, 2, 3, 3 ], [ 1, 3, 3, 3 ], [ 2, 2, 2, 2 ], [ 2, 2, 2, 3 ],
+ [ 2, 2, 3, 3 ], [ 2, 3, 3, 3 ], [ 3, 3, 3, 3 ] ] ]
+[ 1, 3, 5, 7, 9, 10 ]
+[ 1, 0 ]
+[ 1, 3, 6, 10, 15 ]
+5005
+[ [ [ ] ], [ ] ]
+[ [ [ ] ], [ [ 1 ], [ 2 ], [ 3 ] ],
+ [ [ 1, 1 ], [ 1, 2 ], [ 1, 3 ], [ 2, 1 ], [ 2, 2 ], [ 2, 3 ], [ 3, 1 ],
+ [ 3, 2 ], [ 3, 3 ] ],
+ [ [ 1, 1, 1 ], [ 1, 1, 2 ], [ 1, 1, 3 ], [ 1, 2, 1 ], [ 1, 2, 2 ],
+ [ 1, 2, 3 ], [ 1, 3, 1 ], [ 1, 3, 2 ], [ 1, 3, 3 ], [ 2, 1, 1 ],
+ [ 2, 1, 2 ], [ 2, 1, 3 ], [ 2, 2, 1 ], [ 2, 2, 2 ], [ 2, 2, 3 ],
+ [ 2, 3, 1 ], [ 2, 3, 2 ], [ 2, 3, 3 ], [ 3, 1, 1 ], [ 3, 1, 2 ],
+ [ 3, 1, 3 ], [ 3, 2, 1 ], [ 3, 2, 2 ], [ 3, 2, 3 ], [ 3, 3, 1 ],
+ [ 3, 3, 2 ], [ 3, 3, 3 ] ] ]
+[ 1, 3, 5, 7 ]
+[ 1, 0 ]
+[ 1, 3, 9, 27 ]
+4096
+[ [ ] ]
+[ [ 1, 2, 3, 4 ], [ 1, 2, 4, 3 ], [ 1, 3, 2, 4 ], [ 1, 3, 4, 2 ],
+ [ 1, 4, 2, 3 ], [ 1, 4, 3, 2 ], [ 2, 1, 3, 4 ], [ 2, 1, 4, 3 ],
+ [ 2, 3, 1, 4 ], [ 2, 3, 4, 1 ], [ 2, 4, 1, 3 ], [ 2, 4, 3, 1 ],
+ [ 3, 1, 2, 4 ], [ 3, 1, 4, 2 ], [ 3, 2, 1, 4 ], [ 3, 2, 4, 1 ],
+ [ 3, 4, 1, 2 ], [ 3, 4, 2, 1 ], [ 4, 1, 2, 3 ], [ 4, 1, 3, 2 ],
+ [ 4, 2, 1, 3 ], [ 4, 2, 3, 1 ], [ 4, 3, 1, 2 ], [ 4, 3, 2, 1 ] ]
+[ [ 1, 2, 2, 3 ], [ 1, 2, 3, 2 ], [ 1, 3, 2, 2 ], [ 2, 1, 2, 3 ],
+ [ 2, 1, 3, 2 ], [ 2, 2, 1, 3 ], [ 2, 2, 3, 1 ], [ 2, 3, 1, 2 ],
+ [ 2, 3, 2, 1 ], [ 3, 1, 2, 2 ], [ 3, 2, 1, 2 ], [ 3, 2, 2, 1 ] ]
+[ 2, 1, 4, 3, 6, 5 ]
+[ 4, 3, 2, 1, 4, 3, 2, 4 ]
+1
+24
+12
+720
+1680
+[ [ ] ]
+[ [ 2, 1, 4, 3 ], [ 2, 3, 4, 1 ], [ 2, 4, 1, 3 ], [ 3, 1, 4, 2 ],
+ [ 3, 4, 1, 2 ], [ 3, 4, 2, 1 ], [ 4, 1, 2, 3 ], [ 4, 3, 1, 2 ],
+ [ 4, 3, 2, 1 ] ]
+[ 4, 3, 6, 1, 2, 5 ]
+[ 4, 1, 4, 2, 4, 2, 3, 3 ]
+1
+9
+265
+126
+9
+24
+[ [ ] ]
+[ [ [ ] ], [ ] ]
+[ [ [ 1 ], [ 2 ], [ 3 ], [ 4 ] ], [ [ 1 ], [ 2 ], [ 3, 4 ] ],
+ [ [ 1 ], [ 2, 3 ], [ 4 ] ], [ [ 1 ], [ 2, 3, 4 ] ],
+ [ [ 1 ], [ 2, 4 ], [ 3 ] ], [ [ 1, 2 ], [ 3 ], [ 4 ] ],
+ [ [ 1, 2 ], [ 3, 4 ] ], [ [ 1, 2, 3 ], [ 4 ] ], [ [ 1, 2, 3, 4 ] ],
+ [ [ 1, 2, 4 ], [ 3 ] ], [ [ 1, 3 ], [ 2 ], [ 4 ] ], [ [ 1, 3 ], [ 2, 4 ] ],
+ [ [ 1, 3, 4 ], [ 2 ] ], [ [ 1, 4 ], [ 2 ], [ 3 ] ], [ [ 1, 4 ], [ 2, 3 ] ] ]
+[ [ ], [ [ [ 1, 2, 3 ] ] ],
+ [ [ [ 1 ], [ 2, 3 ] ], [ [ 1, 2 ], [ 3 ] ], [ [ 1, 3 ], [ 2 ] ] ],
+ [ [ [ 1 ], [ 2 ], [ 3 ] ] ], [ ] ]
+[ [ 1, 3, 5, 7 ], [ 2, 4, 6 ] ]
+[ [ 1, 2, 3 ], [ 4, 5 ], [ 6, 7, 8 ] ]
+1
+[ 1, 0 ]
+15
+[ 0, 1, 3, 1, 0 ]
+4140
+3025
+[ [ ] ]
+[ [ [ ] ], [ ] ]
+[ [ 1, 1, 1, 1, 1, 1 ], [ 2, 1, 1, 1, 1 ], [ 2, 2, 1, 1 ], [ 2, 2, 2 ],
+ [ 3, 1, 1, 1 ], [ 3, 2, 1 ], [ 3, 3 ], [ 4, 1, 1 ], [ 4, 2 ], [ 5, 1 ],
+ [ 6 ] ]
+[ [ ], [ [ 6 ] ], [ [ 3, 3 ], [ 4, 2 ], [ 5, 1 ] ],
+ [ [ 2, 2, 2 ], [ 3, 2, 1 ], [ 4, 1, 1 ] ],
+ [ [ 2, 2, 1, 1 ], [ 3, 1, 1, 1 ] ], [ [ 2, 1, 1, 1, 1 ] ],
+ [ [ 1, 1, 1, 1, 1, 1 ] ], [ ] ]
+[ 7, 4, 3, 3, 2, 1 ]
+[ 5, 3, 3, 2, 2, 1, 1, 1, 1, 1 ]
+1
+[ 1, 0 ]
+11
+[ 0, 1, 3, 3, 2, 1, 1, 0 ]
+190569292
+2977866
+[ [ ] ]
+[ [ [ ] ], [ ] ]
+[ [ 1, 1, 1, 1, 1 ], [ 1, 1, 1, 2 ], [ 1, 1, 2, 1 ], [ 1, 1, 3 ],
+ [ 1, 2, 1, 1 ], [ 1, 2, 2 ], [ 1, 3, 1 ], [ 1, 4 ], [ 2, 1, 1, 1 ],
+ [ 2, 1, 2 ], [ 2, 2, 1 ], [ 2, 3 ], [ 3, 1, 1 ], [ 3, 2 ], [ 4, 1 ], [ 5 ] ]
+[ [ ], [ [ 5 ] ], [ [ 1, 4 ], [ 2, 3 ], [ 3, 2 ], [ 4, 1 ] ],
+ [ [ 1, 1, 3 ], [ 1, 2, 2 ], [ 1, 3, 1 ], [ 2, 1, 2 ], [ 2, 2, 1 ],
+ [ 3, 1, 1 ] ],
+ [ [ 1, 1, 1, 2 ], [ 1, 1, 2, 1 ], [ 1, 2, 1, 1 ], [ 2, 1, 1, 1 ] ],
+ [ [ 1, 1, 1, 1, 1 ] ], [ ] ]
+[ 1, 12 ]
+[ 1, 11, 1, 1, 1, 1 ]
+1
+[ 1, 0 ]
+16
+[ 0, 1, 4, 6, 4, 1, 0 ]
+4096
+3003
+[ [ ] ]
+[ [ [ ] ], [ ] ]
+[ [ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ], [ 2, 1, 1, 1, 1, 1, 1, 1, 1 ],
+ [ 2, 2, 1, 1, 1, 1, 1, 1 ], [ 2, 2, 2, 1, 1, 1, 1 ], [ 2, 2, 2, 2, 1, 1 ],
+ [ 2, 2, 2, 2, 2 ], [ 5, 1, 1, 1, 1, 1 ], [ 5, 2, 1, 1, 1 ], [ 5, 2, 2, 1 ],
+ [ 5, 5 ], [ 10 ] ]
+[ [ [ 10 ] ], [ [ 5, 5 ] ], [ ], [ [ 5, 2, 2, 1 ] ],
+ [ [ 2, 2, 2, 2, 2 ], [ 5, 2, 1, 1, 1 ] ],
+ [ [ 2, 2, 2, 2, 1, 1 ], [ 5, 1, 1, 1, 1, 1 ] ], [ [ 2, 2, 2, 1, 1, 1, 1 ] ],
+ [ [ 2, 2, 1, 1, 1, 1, 1, 1 ] ], [ [ 2, 1, 1, 1, 1, 1, 1, 1, 1 ] ],
+ [ [ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ] ] ]
+[ [ 2, 2, 2, 2, 2, 2, 2, 2, 2, 2 ], [ 5, 5, 2, 2, 2, 2, 2 ], [ 5, 5, 5, 5 ],
+ [ 10, 2, 2, 2, 2, 2 ], [ 10, 5, 5 ], [ 10, 10 ] ]
+[ [ ], [ [ 10, 10 ] ], [ [ 10, 5, 5 ] ], [ [ 5, 5, 5, 5 ] ], [ ],
+ [ [ 10, 2, 2, 2, 2, 2 ] ], [ [ 5, 5, 2, 2, 2, 2, 2 ] ], [ ], [ ],
+ [ [ 2, 2, 2, 2, 2, 2, 2, 2, 2, 2 ] ], [ ], [ ], [ ], [ ], [ ], [ ],
+ [ ], [ ], [ ], [ ] ]
+[ 13, 7, 5, 5, 5, 5, 2, 2, 2, 2, 2, 2, 2, 2, 2, 2 ]
+[ 17, 17, 13, 13, 13, 7, 5, 5, 5, 5 ]
+1
+[ 1, 0 ]
+341
+[ 0, 0, 0, 0, 1, 1, 1, 2, 4, 6, 6, 8, 10, 11, 11, 12, 13, 14, 14, 14, 15, 15,
+ 14, 14, 14, 13, 12, 12, 11, 10, 9, 9, 8, 7, 6, 6, 6, 5, 4, 4, 4, 3, 2, 2,
+ 2, 2, 1, 1, 1, 1 ]
+21
+[ 0, 0, 0, 0, 1, 1, 1, 1, 2, 2, 1, 1, 2, 1, 1, 1, 1, 1, 1, 0, 1, 1, 0, 0, 1,
+ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0 ]
+1213
+125
+[ 0, 1, 1, 3, 5, 11, 21, 43, 85, 171, 341 ]
+[ 2, 1, 5, 7, 17, 31, 65, 127, 257, 511, 1025 ]
+[ 0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55 ]
+[ 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ]
+true
+[ 0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144, 233, 377, 610, 987, 1597 ]
+1751455877444438095408940282208383549115781784912085789506677971125378
+[ 1, -1/2, 1/6, 0, -1/30, 0, 1/42, 0, -1/30, 0, 5/66, 0, -691/2730, 0, 7/6 ]
+-4603784299479457646935574969019046849794257872751288919656867/230010
+[ [ 1, 6 ], [ 4, 6 ] ]
+364
+1
+G has 19 classes of altogether 156 subgroups.
+
+
+********* S_3
+[sizes:2*3,2*3,3]
+size=3size=3
+
+Subgroup generated by 4 random elements...
+[sizes:2*3,2*3,3]
+size=3size=3
+
+
+********* S_3wrS_4
+[sizes:2^7*3^5,2^7*3^5,3^5]
+size=3^5size=3^5
+
+Subgroup generated by 4 random elements...
+[sizes:2^7*3^4,2^7*3^4,3^4]
+size=3^4size=3^4
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2000/255.vortex/255.vortex.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/255.vortex/255.vortex.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/255.vortex/255.vortex.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2000/255.vortex/255.vortex.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,606 @@
+ CREATE Db Header and Db Primal ...
+ NEW DB [ 3] Created.
+
+VORTEX INPUT PARAMETERS::
+ MESSAGE FileName: vortex.msg
+ OUTPUT FileName: vortex.out
+ DISK CACHE FileName: NULL
+ PART DB FileName: parts.db
+ DRAW DB FileName: draw.db
+ PERSON DB FileName: emp.db
+ PERSONS Data FileName: persons.250
+ PARTS Count : 10000
+ OUTER Loops : 1
+ INNER Loops : 4
+ LOOKUP Parts : 2500
+ DELETE Parts : 1000
+ STUFF Parts : 1000
+ DEPTH Traverse: 5
+ % DECREASE Parts : 0
+ % INCREASE LookUps : 0
+ % INCREASE Deletes : 0
+ % INCREASE Stuffs : 0
+ FREEZE_PACKETS : 1
+ ALLOC_CHUNKS : 10000
+ EXTEND_CHUNKS : 5000
+ DELETE Draw objects : True
+ DELETE Part objects : False
+ QUE_BUG : 1000
+ VOID_BOUNDARY : 67108864
+ VOID_RESERVE : 1048576
+
+ COMMIT_DBS : False
+
+
+
+ BMT TEST :: files...
+ EdbName := PartLib
+ EdbFileName := parts.db
+ DrwName := DrawLib
+ DrwFileName := draw.db
+ EmpName := PersonLib
+ EmpFileName := emp.db
+
+ Swap to DiskCache := False
+ Freeze the cache := True
+
+
+ BMT TEST :: parms...
+ DeBug modulo := 1000
+ Create Parts count:= 10000
+ Outer Loops := 1
+ Inner Loops := 4
+ Look Ups := 2500
+ Delete Parts := 1000
+ Stuff Parts := 1000
+ Traverse Limit := 5
+ Delete Draws := True
+ Delete Parts := False
+ Delete ALL Parts := after every <mod 0>Outer Loop
+
+ INITIALIZE LIBRARY ::
+
+ INITIALIZE SCHEMA ::
+ Primal_CreateDb Accessed !!!
+ CREATE Db Header and Db Primal ...
+ NEW DB [ 4] Created.
+ PartLibCreate:: Db[ 4]; VpartsDir= 1
+
+ Part Count= 1
+
+ Initialize the Class maps
+ LIST HEADS loaded ... DbListHead_Class = 207
+ DbListNode_Class = 206
+
+...NOTE... ShellLoadCode:: Class[ 228] will NOT be Activated.
+
+
+...NOTE... ShellLoadCode:: Class[ 229] will NOT be Activated.
+
+ Primal_CreateDb Accessed !!!
+ CREATE Db Header and Db Primal ...
+ NEW DB [ 5] Created.
+ DrawLibCreate:: Db[ 5]; VpartsDir= 1
+
+ Initialize the Class maps of this schema.
+ Primal_CreateDb Accessed !!!
+ CREATE Db Header and Db Primal ...
+ NEW DB [ 6] Created.
+
+ ***NOTE*** Persons Library Extended!
+
+ Create <131072> Persons.
+ ItNum 0. Person[ 6: 5]. Name= Riddell , Robert V. ;
+
+ LAST Person Read::
+ ItNum 250. Person[ 6: 503]. Name= Gonzales , Warren X. ;
+
+ BUILD <Query0> for <Part2> class::
+
+ if (link[1].length >= 5) ::
+
+ Build Query2 for <Address> class::
+
+ if (State == CA || State == T*)
+
+ Build Query1 for <Person> class::
+
+ if (LastName >= H* && LastName <= P* && Query0(Residence)) ::
+
+ BUILD <Query3> for <DrawObj> class::
+
+ if (Id >= 3000
+ && (Id >= 3000 && Id <= 3001)
+ && Id >= 3002)
+
+ BUILD <Query4> for <NamedDrawObj> class::
+
+ if (Nam == Pre*
+ || (Nam == ??Mid??? || == Pre??Mid?? || == ??Post
+ || == Pre??Post || == ??Mid???Post || == Pre??Mid???Post)
+ && Id <= 7)
+ SEED := 1008; Swap = False; RgnEntries = 24000
+
+ OUTER LOOP [ 1] : NewParts = 10000 LookUps = 2500 StuffParts = 1000.
+
+ Create 10000 New Parts
+ Create Part 1. Token[ 4: 2].
+ Create Part 1001. Token[ 4: 1002].
+ Create Part 2001. Token[ 4: 2002].
+ Create Part 3001. Token[ 4: 3002].
+ Create Part 4001. Token[ 4: 4002].
+ Create Part 5001. Token[ 4: 5002].
+ Create Part 6001. Token[ 4: 6002].
+ Create Part 7001. Token[ 4: 7002].
+ Create Part 8001. Token[ 4: 8002].
+ Create Part 9001. Token[ 4: 9002].
+
+ < 10000> Parts Created. CurrentId= 10000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 1. Token[ 4: 2]
+ Connect Part 2021. Token[ 4: 2022] FromList= 2022.
+ Connect Part 9992. Token[ 4: 9993] FromList= 9993.
+ Connect Part 7743. Token[ 4: 7744] FromList= 7744.
+ Connect Part 1001. Token[ 4: 1002]
+ Connect Part 2001. Token[ 4: 2002]
+ Connect Part 3001. Token[ 4: 3002]
+ Connect Part 4001. Token[ 4: 4002]
+ Connect Part 5001. Token[ 4: 5002]
+ Connect Part 6001. Token[ 4: 6002]
+ Connect Part 7001. Token[ 4: 7002]
+ Connect Part 8001. Token[ 4: 8002]
+ Connect Part 9001. Token[ 4: 9002]
+
+ SET <DrawObjs> entries::
+ 1. [ 5: 5] := <1 >; @[: 6]
+ 1001. [ 5: 2631] := <1001 >; @[: 2632]
+ 2001. [ 5: 5256] := <2001 >; @[: 5257]
+ 3001. [ 5: 7881] := <3001 >; @[: 7882]
+ 4001. [ 5: 10506] := <4001 >; @[: 10507]
+ 5001. [ 5: 13131] := <5001 >; @[: 13132]
+ 6001. [ 5: 15756] := <6001 >; @[: 15757]
+ 7001. [ 5: 18381] := <7001 >; @[: 18382]
+ 8001. [ 5: 21006] := <8001 >; @[: 21007]
+ 9001. [ 5: 23631] := <9001 >; @[: 23632]
+ Iteration count = 10000
+
+ SET <NamedDrawObjs> entries::
+ 1. [ 5: 2643] := <1006 >;
+ 1001. [ 5: 21543] := <8206 >;
+ Iteration count = 1250
+
+ SET <LibRectangles> entries::
+ 1. [ 5: 23] := <8 >; @[: 24]
+ 1001. [ 5: 21024] := <8008 >; @[: 21025]
+ Iteration count = 1250
+
+ LIST <DbRectangles> entries::
+ 1. [ 5: 23]
+ 1001. [ 5: 21024]
+ Iteration count = 1250
+
+ SET <PersonNames > entries::
+ Iteration count = 250
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=10000
+ < 10000> Part images' Committed.
+ < 0> are Named.
+ < 5000> Point images' Committed.
+ < 250> Person images' Committed.
+
+ COMMIT Parts(* 10000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 0: 0]. TestObj Committed.
+ < 0> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 0: 0]. CartesianPoint Committed.
+ < 0> CartesianPoint images' Committed.
+
+ BEGIN Inner Loop Sequence::.
+
+ INNER LOOP [ 1: 1] :
+
+ LOOK UP 2500 Random Parts and Export each Part.
+ Set 100. Part# 9460 Handle= 9461.
+ Set 200. Part# 3492 Handle= 3493.
+ Set 300. Part# 1108 Handle= 1109.
+ Set 400. Part# 308 Handle= 309.
+ Set 500. Part# 612 Handle= 613.
+ Set 600. Part# 4196 Handle= 4197.
+ Set 700. Part# 6404 Handle= 6405.
+ Set 800. Part# 5236 Handle= 5237.
+ Set 900. Part# 5780 Handle= 5781.
+ Set 1000. Part# 1860 Handle= 1861.
+ Set 1100. Part# 4388 Handle= 4389.
+ Set 1200. Part# 1364 Handle= 1365.
+ Set 1300. Part# 5092 Handle= 5093.
+ Set 1400. Part# 2180 Handle= 2181.
+ Set 1500. Part# 3540 Handle= 3541.
+ Set 1600. Part# 4388 Handle= 4389.
+ Set 1700. Part# 9812 Handle= 9813.
+ Set 1800. Part# 3636 Handle= 3637.
+ Set 1900. Part# 6772 Handle= 6773.
+ Set 2000. Part# 4 Handle= 5.
+ Set 2100. Part# 68 Handle= 69.
+ Set 2200. Part# 6356 Handle= 6357.
+ Set 2300. Part# 9780 Handle= 9781.
+ Set 2400. Part# 8340 Handle= 8341.
+ Set 2500. Part# 1556 Handle= 1557.
+
+ LookUp for 2501 parts; Asserts = 1060
+ <Part2 > Asserts = 104; NULL Asserts = 396.
+ <DrawObj > Asserts = 207; NULL Asserts = 292.
+ <NamedObj > Asserts = 0; NULL Asserts = 0.
+ <Person > Asserts = 0; NULL Asserts = 500.
+ <TestObj > Asserts =626001; NULL Asserts = 0.
+
+ DELETE 1000 Random Parts.
+
+ PartDelete :: Token[ 4: 5036].
+ PartDisconnect:: Token[ 4: 5036] id:= 5035 for each link.
+ DisConnect link [ 0]:= 6971; PartToken[ 6972: 6972].
+ DisConnect link [ 1]:= 6646; PartToken[ 6647: 6647].
+ DisConnect link [ 2]:= 4805; PartToken[ 4806: 4806].
+ DeleteFromList:: Vchunk[ 4: 5036]. (* 3)
+ DisConnect FromList[ 0]:= 1579; Token[ 1580: 1580].
+ DisConnect FromList[ 1]:= 4752; Token[ 4753: 4753].
+ DisConnect FromList[ 2]:= 5744; Token[ 5745: 5745].
+ Vlists[5034] := 10000;
+ Delete 1000. Part# 3748 Handle= 3749.
+
+ Delete for 1001 parts;
+
+ Traverse Count= 0
+
+ TRAVERSE PartId[ 9336] and all Connections to 5 Levels
+
+ Traverse Count= 159
+ Traverse Asserts = 3. True Tests = 1
+ < 2> DrawObj objects DELETED.
+ < 80> are Named.
+ < 2> Point objects DELETED.
+
+ CREATE 1000 Additional Parts
+
+ Create 1000 New Parts
+ Create Part 10001. Token[ 4: 10002].
+
+ < 1000> Parts Created. CurrentId= 11000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 10001. Token[ 4: 10002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=11000
+ < 4791> Part images' Committed.
+ < 0> are Named.
+ < 2674> Point images' Committed.
+ < 250> Person images' Committed.
+
+ COMMIT Parts(* 10000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 4]. TestObj Committed.
+ ItNum 1000. Token[ 3: 2004]. TestObj Committed.
+ < 1251> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Committed.
+ ItNum 1000. Token[ 3: 2003]. CartesianPoint Committed.
+ < 1252> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 4]. TestObj Deleted.
+ ItNum 1000. Token[ 3: 2004]. TestObj Deleted.
+ < 1251> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Deleted.
+ ItNum 1000. Token[ 3: 2003]. CartesianPoint Deleted.
+ < 1252> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 1: 1].
+
+ INNER LOOP [ 1: 2] :
+
+ LOOK UP 2500 Random Parts and Export each Part.
+ Set 100. Part# 3511 Handle= 3512.
+ Set 200. Part# 1399 Handle= 1400.
+ Set 300. Part# 5335 Handle= 5336.
+ Set 400. Part# 1127 Handle= 1128.
+ Set 500. Part# 3319 Handle= 3320.
+ Set 600. Part# 6327 Handle= 6328.
+ Set 700. Part# 6087 Handle= 6088.
+ Set 800. Part# 2839 Handle= 2840.
+ Set 900. Part# 10479 Handle= 10480.
+ Set 1000. Part# 7639 Handle= 7640.
+ Set 1100. Part# 471 Handle= 472.
+ Set 1200. Part# 3783 Handle= 3784.
+ Set 1300. Part# 7687 Handle= 7688.
+ Set 1400. Part# 8247 Handle= 8248.
+ Set 1500. Part# 10751 Handle= 10752.
+ Set 1600. Part# 10655 Handle= 10656.
+ Set 1700. Part# 8071 Handle= 8072.
+ Set 1800. Part# 10415 Handle= 10416.
+ Set 1900. Part# 6839 Handle= 6840.
+ Set 2000. Part# 3367 Handle= 3368.
+ Set 2100. Part# 1895 Handle= 1896.
+ Set 2200. Part# 8487 Handle= 8488.
+ Set 2300. Part# 4647 Handle= 4648.
+ Set 2400. Part# 615 Handle= 616.
+ Set 2500. Part# 9012 Handle= 9013.
+
+ LookUp for 2501 parts; Asserts = 841
+ <Part2 > Asserts = 153; NULL Asserts = 597.
+ <DrawObj > Asserts = 188; NULL Asserts = 306.
+ <NamedObj > Asserts = 0; NULL Asserts = 6.
+ <Person > Asserts = 0; NULL Asserts = 500.
+ <TestObj > Asserts =470125; NULL Asserts = 0.
+
+ DELETE 1000 Random Parts.
+ Delete 1000. Part# 10123 Handle= 10124.
+
+ Delete for 1001 parts;
+
+ Traverse Count= 159
+
+ TRAVERSE PartId[ 9017] and all Connections to 5 Levels
+
+ Traverse Count= 111
+ Traverse Asserts = 2. True Tests = 1
+ < 2> DrawObj objects DELETED.
+ < 124> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 1000 Additional Parts
+
+ Create 1000 New Parts
+ Create Part 11001. Token[ 4: 11002].
+
+ < 1000> Parts Created. CurrentId= 12000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 11001. Token[ 4: 11002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=12000
+ < 4727> Part images' Committed.
+ < 0> are Named.
+ < 1874> Point images' Committed.
+ < 250> Person images' Committed.
+
+ COMMIT Parts(* 10000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. TestObj Committed.
+ ItNum 1000. Token[ 3: 2005]. TestObj Committed.
+ < 1251> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Committed.
+ ItNum 1000. Token[ 3: 2003]. CartesianPoint Committed.
+ < 1251> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. TestObj Deleted.
+ ItNum 1000. Token[ 3: 2005]. TestObj Deleted.
+ < 1251> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Deleted.
+ ItNum 1000. Token[ 3: 2003]. CartesianPoint Deleted.
+ < 1251> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 1: 2].
+
+ INNER LOOP [ 1: 3] :
+
+ LOOK UP 2500 Random Parts and Export each Part.
+ Set 100. Part# 10009 Handle= 10010.
+ Set 200. Part# 11214 Handle= 11215.
+ Set 300. Part# 8638 Handle= 8639.
+ Set 400. Part# 5038 Handle= 5039.
+ Set 500. Part# 6494 Handle= 6495.
+ Set 600. Part# 9283 Handle= 9284.
+ Set 700. Part# 6766 Handle= 6767.
+ Set 800. Part# 1614 Handle= 1615.
+ Set 900. Part# 798 Handle= 799.
+ Set 1000. Part# 11486 Handle= 11487.
+ Set 1100. Part# 4366 Handle= 4367.
+ Set 1200. Part# 4782 Handle= 4783.
+ Set 1300. Part# 10082 Handle= 10083.
+ Set 1400. Part# 9857 Handle= 9858.
+ Set 1500. Part# 2702 Handle= 2703.
+ Set 1600. Part# 3022 Handle= 3023.
+ Set 1700. Part# 11022 Handle= 11023.
+ Set 1800. Part# 9039 Handle= 9040.
+ Set 1900. Part# 11118 Handle= 11119.
+ Set 2000. Part# 11246 Handle= 11247.
+ Set 2100. Part# 1550 Handle= 1551.
+ Set 2200. Part# 8414 Handle= 8415.
+ Set 2300. Part# 2094 Handle= 2095.
+ Set 2400. Part# 6366 Handle= 6367.
+ Set 2500. Part# 2094 Handle= 2095.
+
+ LookUp for 2501 parts; Asserts = 805
+ <Part2 > Asserts = 160; NULL Asserts = 590.
+ <DrawObj > Asserts = 145; NULL Asserts = 346.
+ <NamedObj > Asserts = 0; NULL Asserts = 9.
+ <Person > Asserts = 0; NULL Asserts = 500.
+ <TestObj > Asserts =469375; NULL Asserts = 0.
+
+ DELETE 1000 Random Parts.
+ Delete 1000. Part# 11758 Handle= 11759.
+
+ Delete for 1001 parts;
+
+ Traverse Count= 111
+
+ TRAVERSE PartId[ 3671] and all Connections to 5 Levels
+
+ Traverse Count= 192
+ Traverse Asserts = 3. True Tests = 0
+ < 3> DrawObj objects DELETED.
+ < 91> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 1000 Additional Parts
+
+ Create 1000 New Parts
+ Create Part 12001. Token[ 4: 12002].
+
+ < 1000> Parts Created. CurrentId= 13000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 12001. Token[ 4: 12002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=13000
+ < 4486> Part images' Committed.
+ < 0> are Named.
+ < 1822> Point images' Committed.
+ < 250> Person images' Committed.
+
+ COMMIT Parts(* 10000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. TestObj Committed.
+ ItNum 1000. Token[ 3: 2004]. TestObj Committed.
+ < 1251> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. CartesianPoint Committed.
+ ItNum 1000. Token[ 3: 2005]. CartesianPoint Committed.
+ < 1251> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. TestObj Deleted.
+ ItNum 1000. Token[ 3: 2004]. TestObj Deleted.
+ < 1251> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. CartesianPoint Deleted.
+ ItNum 1000. Token[ 3: 2005]. CartesianPoint Deleted.
+ < 1251> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 1: 3].
+
+ INNER LOOP [ 1: 4] :
+
+ LOOK UP 2500 Random Parts and Export each Part.
+ Set 100. Part# 8787 Handle= 8788.
+ Set 200. Part# 5235 Handle= 5236.
+ Set 300. Part# 5315 Handle= 5316.
+ Set 400. Part# 9095 Handle= 9096.
+ Set 500. Part# 5427 Handle= 5428.
+ Set 600. Part# 1571 Handle= 1572.
+ Set 700. Part# 1923 Handle= 1924.
+ Set 800. Part# 9638 Handle= 9639.
+ Set 900. Part# 2035 Handle= 2036.
+ Set 1000. Part# 3475 Handle= 3476.
+ Set 1100. Part# 1347 Handle= 1348.
+ Set 1200. Part# 11614 Handle= 11615.
+ Set 1300. Part# 4307 Handle= 4308.
+ Set 1400. Part# 1075 Handle= 1076.
+ Set 1500. Part# 10063 Handle= 10064.
+ Set 1600. Part# 7747 Handle= 7748.
+ Set 1700. Part# 7939 Handle= 7940.
+ Set 1800. Part# 11907 Handle= 11908.
+ Set 1900. Part# 8643 Handle= 8644.
+ Set 2000. Part# 11530 Handle= 11531.
+ Set 2100. Part# 5843 Handle= 5844.
+ Set 2200. Part# 6147 Handle= 6148.
+ Set 2300. Part# 5123 Handle= 5124.
+ Set 2400. Part# 12939 Handle= 12940.
+ Set 2500. Part# 10063 Handle= 10064.
+
+ LookUp for 2501 parts; Asserts = 846
+ <Part2 > Asserts = 108; NULL Asserts = 392.
+ <DrawObj > Asserts = 238; NULL Asserts = 490.
+ <NamedObj > Asserts = 0; NULL Asserts = 22.
+ <Person > Asserts = 0; NULL Asserts = 500.
+ <TestObj > Asserts =469375; NULL Asserts = 0.
+
+ DELETE 1000 Random Parts.
+ Delete 1000. Part# 871 Handle= 872.
+
+ Delete for 1001 parts;
+
+ Traverse Count= 192
+
+ TRAVERSE PartId[ 301] and all Connections to 5 Levels
+
+ Traverse Count= 117
+ Traverse Asserts = 1. True Tests = 0
+ < 2> DrawObj objects DELETED.
+ < 91> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 1000 Additional Parts
+
+ Create 1000 New Parts
+ Create Part 13001. Token[ 4: 13002].
+
+ < 1000> Parts Created. CurrentId= 14000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 13001. Token[ 4: 13002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=14000
+ < 4449> Part images' Committed.
+ < 0> are Named.
+ < 2412> Point images' Committed.
+ < 250> Person images' Committed.
+
+ COMMIT Parts(* 10000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. TestObj Committed.
+ ItNum 1000. Token[ 3: 2005]. TestObj Committed.
+ < 1251> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Committed.
+ ItNum 1000. Token[ 3: 2004]. CartesianPoint Committed.
+ < 1251> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. TestObj Deleted.
+ ItNum 1000. Token[ 3: 2005]. TestObj Deleted.
+ < 1251> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Deleted.
+ ItNum 1000. Token[ 3: 2004]. CartesianPoint Deleted.
+ < 1251> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 1: 4].
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ < 0> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ < 0> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ STATUS= -201
+V O R T E x 0 1!V O R T E x 0 1!V O R T E x 0 1!V O R T E x 0 1!V O R T E x 0 1!
Added: test-suite/trunk/External/SPEC/CINT2000/255.vortex/255.vortex.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/255.vortex/255.vortex.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/255.vortex/255.vortex.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CINT2000/255.vortex/255.vortex.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,847 @@
+ CREATE Db Header and Db Primal ...
+ NEW DB [ 3] Created.
+
+VORTEX INPUT PARAMETERS::
+ MESSAGE FileName: vortex.msg
+ OUTPUT FileName: vortex.out
+ DISK CACHE FileName: NULL
+ PART DB FileName: parts.db
+ DRAW DB FileName: draw.db
+ PERSON DB FileName: emp.db
+ PERSONS Data FileName: persons.1k
+ PARTS Count : 10000
+ OUTER Loops : 2
+ INNER Loops : 4
+ LOOKUP Parts : 250
+ DELETE Parts : 500
+ STUFF Parts : 500
+ DEPTH Traverse: 5
+ % DECREASE Parts : 50
+ % INCREASE LookUps : 25
+ % INCREASE Deletes : 50
+ % INCREASE Stuffs : 100
+ FREEZE_PACKETS : 1
+ ALLOC_CHUNKS : 10000
+ EXTEND_CHUNKS : 5000
+ DELETE Draw objects : True
+ DELETE Part objects : False
+ QUE_BUG : 1000
+ VOID_BOUNDARY : 67108864
+ VOID_RESERVE : 1048576
+
+ COMMIT_DBS : False
+
+
+
+ BMT TEST :: files...
+ EdbName := PartLib
+ EdbFileName := parts.db
+ DrwName := DrawLib
+ DrwFileName := draw.db
+ EmpName := PersonLib
+ EmpFileName := emp.db
+
+ Swap to DiskCache := False
+ Freeze the cache := True
+
+
+ BMT TEST :: parms...
+ DeBug modulo := 1000
+ Create Parts count:= 10000
+ Outer Loops := 2
+ Inner Loops := 4
+ Look Ups := 250
+ Delete Parts := 500
+ Stuff Parts := 500
+ Traverse Limit := 5
+ Delete Draws := True
+ Delete Parts := False
+ Delete ALL Parts := after every <mod 0>Outer Loop
+
+ INITIALIZE LIBRARY ::
+
+ INITIALIZE SCHEMA ::
+ Primal_CreateDb Accessed !!!
+ CREATE Db Header and Db Primal ...
+ NEW DB [ 4] Created.
+ PartLibCreate:: Db[ 4]; VpartsDir= 1
+
+ Part Count= 1
+
+ Initialize the Class maps
+ LIST HEADS loaded ... DbListHead_Class = 207
+ DbListNode_Class = 206
+
+...NOTE... ShellLoadCode:: Class[ 228] will NOT be Activated.
+
+
+...NOTE... ShellLoadCode:: Class[ 229] will NOT be Activated.
+
+ Primal_CreateDb Accessed !!!
+ CREATE Db Header and Db Primal ...
+ NEW DB [ 5] Created.
+ DrawLibCreate:: Db[ 5]; VpartsDir= 1
+
+ Initialize the Class maps of this schema.
+ Primal_CreateDb Accessed !!!
+ CREATE Db Header and Db Primal ...
+ NEW DB [ 6] Created.
+
+ ***NOTE*** Persons Library Extended!
+
+ Create <131072> Persons.
+ ItNum 0. Person[ 6: 5]. Name= Riddell , Robert V. ;
+
+ LAST Person Read::
+ ItNum 1000. Person[ 6: 2003]. Name= Stanton , Miklos Q. ;
+
+ BUILD <Query0> for <Part2> class::
+
+ if (link[1].length >= 5) ::
+
+ Build Query2 for <Address> class::
+
+ if (State == CA || State == T*)
+
+ Build Query1 for <Person> class::
+
+ if (LastName >= H* && LastName <= P* && Query0(Residence)) ::
+
+ BUILD <Query3> for <DrawObj> class::
+
+ if (Id >= 3000
+ && (Id >= 3000 && Id <= 3001)
+ && Id >= 3002)
+
+ BUILD <Query4> for <NamedDrawObj> class::
+
+ if (Nam == Pre*
+ || (Nam == ??Mid??? || == Pre??Mid?? || == ??Post
+ || == Pre??Post || == ??Mid???Post || == Pre??Mid???Post)
+ && Id <= 7)
+ SEED := 1008; Swap = False; RgnEntries = 26000
+
+ OUTER LOOP [ 1] : NewParts = 10000 LookUps = 250 StuffParts = 500.
+
+ Create 10000 New Parts
+ Create Part 1. Token[ 4: 2].
+ Create Part 1001. Token[ 4: 1002].
+ Create Part 2001. Token[ 4: 2002].
+ Create Part 3001. Token[ 4: 3002].
+ Create Part 4001. Token[ 4: 4002].
+ Create Part 5001. Token[ 4: 5002].
+ Create Part 6001. Token[ 4: 6002].
+ Create Part 7001. Token[ 4: 7002].
+ Create Part 8001. Token[ 4: 8002].
+ Create Part 9001. Token[ 4: 9002].
+
+ < 10000> Parts Created. CurrentId= 10000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 1. Token[ 4: 2]
+ Connect Part 2021. Token[ 4: 2022] FromList= 2022.
+ Connect Part 9992. Token[ 4: 9993] FromList= 9993.
+ Connect Part 7743. Token[ 4: 7744] FromList= 7744.
+ Connect Part 1001. Token[ 4: 1002]
+ Connect Part 2001. Token[ 4: 2002]
+ Connect Part 3001. Token[ 4: 3002]
+ Connect Part 4001. Token[ 4: 4002]
+ Connect Part 5001. Token[ 4: 5002]
+ Connect Part 6001. Token[ 4: 6002]
+ Connect Part 7001. Token[ 4: 7002]
+ Connect Part 8001. Token[ 4: 8002]
+ Connect Part 9001. Token[ 4: 9002]
+
+ SET <DrawObjs> entries::
+ 1. [ 5: 5] := <1 >; @[: 6]
+ 1001. [ 5: 2631] := <1001 >; @[: 2632]
+ 2001. [ 5: 5256] := <2001 >; @[: 5257]
+ 3001. [ 5: 7881] := <3001 >; @[: 7882]
+ 4001. [ 5: 10506] := <4001 >; @[: 10507]
+ 5001. [ 5: 13131] := <5001 >; @[: 13132]
+ 6001. [ 5: 15756] := <6001 >; @[: 15757]
+ 7001. [ 5: 18381] := <7001 >; @[: 18382]
+ 8001. [ 5: 21006] := <8001 >; @[: 21007]
+ 9001. [ 5: 23631] := <9001 >; @[: 23632]
+ Iteration count = 10000
+
+ SET <NamedDrawObjs> entries::
+ 1. [ 5: 2643] := <1006 >;
+ 1001. [ 5: 21543] := <8206 >;
+ Iteration count = 1250
+
+ SET <LibRectangles> entries::
+ 1. [ 5: 23] := <8 >; @[: 24]
+ 1001. [ 5: 21024] := <8008 >; @[: 21025]
+ Iteration count = 1250
+
+ LIST <DbRectangles> entries::
+ 1. [ 5: 23]
+ 1001. [ 5: 21024]
+ Iteration count = 1250
+
+ SET <PersonNames > entries::
+ Iteration count = 1000
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=10000
+ < 10000> Part images' Committed.
+ < 0> are Named.
+ < 5000> Point images' Committed.
+ < 1000> Person images' Committed.
+
+ COMMIT Parts(* 10000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 0: 0]. TestObj Committed.
+ < 0> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 0: 0]. CartesianPoint Committed.
+ < 0> CartesianPoint images' Committed.
+
+ BEGIN Inner Loop Sequence::.
+
+ INNER LOOP [ 1: 1] :
+
+ LOOK UP 250 Random Parts and Export each Part.
+ Set 100. Part# 9460 Handle= 9461.
+ Set 200. Part# 3492 Handle= 3493.
+
+ LookUp for 251 parts; Asserts = 106
+ <Part2 > Asserts = 11; NULL Asserts = 39.
+ <DrawObj > Asserts = 21; NULL Asserts = 28.
+ <NamedObj > Asserts = 0; NULL Asserts = 0.
+ <Person > Asserts = 0; NULL Asserts = 50.
+ <TestObj > Asserts = 6351; NULL Asserts = 0.
+
+ DELETE 500 Random Parts.
+
+ PartDelete :: Token[ 4: 7220].
+ PartDisconnect:: Token[ 4: 7220] id:= 7219 for each link.
+ DisConnect link [ 0]:= 7363; PartToken[ 7364: 7364].
+ DisConnect link [ 1]:= 4286; PartToken[ 4287: 4287].
+ DisConnect link [ 2]:= 5533; PartToken[ 5534: 5534].
+ DeleteFromList:: Vchunk[ 4: 7220]. (* 3)
+ DisConnect FromList[ 0]:= 2360; Token[ 2361: 2361].
+ DisConnect FromList[ 1]:= 2557; Token[ 2558: 2558].
+ DisConnect FromList[ 2]:= 7432; Token[ 7433: 7433].
+ Vlists[7218] := 10000;
+
+ Delete for 501 parts;
+
+ Traverse Count= 0
+
+ TRAVERSE PartId[ 6487] and all Connections to 5 Levels
+
+ Traverse Count= 315
+ Traverse Asserts = 5. True Tests = 2
+ < 5> DrawObj objects DELETED.
+ < 39> are Named.
+ < 2> Point objects DELETED.
+
+ CREATE 500 Additional Parts
+
+ Create 500 New Parts
+ Create Part 10001. Token[ 4: 10002].
+
+ < 500> Parts Created. CurrentId= 10500
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 10001. Token[ 4: 10002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=10500
+ < 2145> Part images' Committed.
+ < 0> are Named.
+ < 1238> Point images' Committed.
+ < 204> Person images' Committed.
+
+ COMMIT Parts(* 10000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 4]. TestObj Committed.
+ < 127> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Committed.
+ < 128> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 4]. TestObj Deleted.
+ < 127> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Deleted.
+ < 128> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 1: 1].
+
+ INNER LOOP [ 1: 2] :
+
+ LOOK UP 250 Random Parts and Export each Part.
+ Set 100. Part# 3186 Handle= 3187.
+ Set 200. Part# 1778 Handle= 1779.
+
+ LookUp for 251 parts; Asserts = 73
+ <Part2 > Asserts = 9; NULL Asserts = 66.
+ <DrawObj > Asserts = 14; NULL Asserts = 35.
+ <NamedObj > Asserts = 0; NULL Asserts = 1.
+ <Person > Asserts = 0; NULL Asserts = 50.
+ <TestObj > Asserts = 4750; NULL Asserts = 0.
+
+ DELETE 500 Random Parts.
+
+ Delete for 501 parts;
+
+ Traverse Count= 315
+
+ TRAVERSE PartId[ 1227] and all Connections to 5 Levels
+
+ Traverse Count= 219
+ Traverse Asserts = 4. True Tests = 1
+ < 3> DrawObj objects DELETED.
+ < 47> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 500 Additional Parts
+
+ Create 500 New Parts
+ Create Part 10501. Token[ 4: 10502].
+
+ < 500> Parts Created. CurrentId= 11000
+
+ Connect each instantiated Part TO 3 unique Parts
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=11000
+ < 2003> Part images' Committed.
+ < 0> are Named.
+ < 1142> Point images' Committed.
+ < 214> Person images' Committed.
+
+ COMMIT Parts(* 10000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. TestObj Committed.
+ < 127> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Committed.
+ < 127> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. TestObj Deleted.
+ < 127> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Deleted.
+ < 127> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 1: 2].
+
+ INNER LOOP [ 1: 3] :
+
+ LOOK UP 250 Random Parts and Export each Part.
+ Set 100. Part# 2782 Handle= 2783.
+ Set 200. Part# 9761 Handle= 9762.
+
+ LookUp for 251 parts; Asserts = 87
+ <Part2 > Asserts = 16; NULL Asserts = 34.
+ <DrawObj > Asserts = 20; NULL Asserts = 30.
+ <NamedObj > Asserts = 0; NULL Asserts = 0.
+ <Person > Asserts = 1; NULL Asserts = 74.
+ <TestObj > Asserts = 4725; NULL Asserts = 0.
+
+ DELETE 500 Random Parts.
+
+ Delete for 501 parts;
+
+ Traverse Count= 219
+
+ TRAVERSE PartId[ 10654] and all Connections to 5 Levels
+
+ Traverse Count= 210
+ Traverse Asserts = 2. True Tests = 1
+ < 4> DrawObj objects DELETED.
+ < 47> are Named.
+ < 2> Point objects DELETED.
+
+ CREATE 500 Additional Parts
+
+ Create 500 New Parts
+ Create Part 11001. Token[ 4: 11002].
+
+ < 500> Parts Created. CurrentId= 11500
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 11001. Token[ 4: 11002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=11500
+ < 1944> Part images' Committed.
+ < 0> are Named.
+ < 894> Point images' Committed.
+ < 221> Person images' Committed.
+
+ COMMIT Parts(* 10000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. TestObj Committed.
+ < 126> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. CartesianPoint Committed.
+ < 126> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. TestObj Deleted.
+ < 126> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. CartesianPoint Deleted.
+ < 126> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 1: 3].
+
+ INNER LOOP [ 1: 4] :
+
+ LOOK UP 250 Random Parts and Export each Part.
+ Set 100. Part# 8810 Handle= 8811.
+ Set 200. Part# 5370 Handle= 5371.
+
+ LookUp for 251 parts; Asserts = 92
+ <Part2 > Asserts = 8; NULL Asserts = 42.
+ <DrawObj > Asserts = 33; NULL Asserts = 42.
+ <NamedObj > Asserts = 0; NULL Asserts = 0.
+ <Person > Asserts = 1; NULL Asserts = 49.
+ <TestObj > Asserts = 4850; NULL Asserts = 0.
+
+ DELETE 500 Random Parts.
+
+ Delete for 501 parts;
+
+ Traverse Count= 210
+
+ TRAVERSE PartId[ 11242] and all Connections to 5 Levels
+
+ Traverse Count= 192
+ Traverse Asserts = 4. True Tests = 2
+ < 3> DrawObj objects DELETED.
+ < 53> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 500 Additional Parts
+
+ Create 500 New Parts
+ Create Part 11501. Token[ 4: 11502].
+
+ < 500> Parts Created. CurrentId= 12000
+
+ Connect each instantiated Part TO 3 unique Parts
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=12000
+ < 1990> Part images' Committed.
+ < 0> are Named.
+ < 846> Point images' Committed.
+ < 223> Person images' Committed.
+
+ COMMIT Parts(* 10000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 7]. TestObj Committed.
+ < 127> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Committed.
+ < 127> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 7]. TestObj Deleted.
+ < 127> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Deleted.
+ < 127> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 1: 4].
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ < 0> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ < 0> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ OUTER LOOP [ 2] : NewParts = 5000 LookUps = 312 StuffParts = 1000.
+
+ Create 5000 New Parts
+ Create Part 12001. Token[ 4: 12002].
+ Create Part 13001. Token[ 4: 13002].
+ Create Part 14001. Token[ 4: 14002].
+ Create Part 15001. Token[ 4: 15002].
+ Create Part 16001. Token[ 4: 16002].
+
+ < 5000> Parts Created. CurrentId= 17000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 12001. Token[ 4: 12002]
+ Connect Part 13001. Token[ 4: 13002]
+ Connect Part 14001. Token[ 4: 14002]
+ Connect Part 15001. Token[ 4: 15002]
+ Connect Part 16001. Token[ 4: 16002]
+
+ SET <DrawObjs> entries::
+ 1. [ 5: 5] := <1 >; @[: 6]
+ 1001. [ 5: 3189] := <1214 >; @[: 3190]
+ 2001. [ 5: 6366] := <2424 >; @[: 6367]
+ 3001. [ 5: 9552] := <3638 >; @[: 9553]
+ 4001. [ 5: 12732] := <4849 >; @[: 12733]
+ 5001. [ 5: 15987] := <6089 >; @[: 15988]
+ 6001. [ 5: 19231] := <7325 >; @[: 19232]
+ 7001. [ 5: 22452] := <8552 >; @[: 22453]
+ 8001. [ 5: 25697] := <9788 >; @[: 25698]
+ 9001. [ 5: 13936] := <10985 >; @[: 18533]
+ 10001. [ 5: 17243] := <12014 >; @[: 17242]
+ 11001. [ 5: 29062] := <13014 >; @[: 29063]
+ 12001. [ 5: 31687] := <14014 >; @[: 31688]
+ 13001. [ 5: 34312] := <15014 >; @[: 34313]
+ 14001. [ 5: 36937] := <16014 >; @[: 36938]
+ Iteration count = 14987
+
+ SET <NamedDrawObjs> entries::
+ 1. [ 5: 26264] := <10004 >;
+ 1001. [ 5: 5667] := <2158 >;
+ Iteration count = 1939
+
+ SET <LibRectangles> entries::
+ 1. [ 5: 23] := <8 >; @[: 24]
+ 1001. [ 5: 24489] := <9328 >; @[: 24490]
+ Iteration count = 1926
+
+ LIST <DbRectangles> entries::
+ 1. [ 5: 23]
+ 1001. [ 5: 21024]
+ 2001. [ 5: 36905]
+ Iteration count = 2125
+
+ SET <PersonNames > entries::
+ Iteration count = 1000
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=17000
+ < 4999> Part images' Committed.
+ < 0> are Named.
+ < 2498> Point images' Committed.
+ < 1000> Person images' Committed.
+
+ COMMIT Parts(* 15000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 0: 0]. TestObj Committed.
+ < 0> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 0: 0]. CartesianPoint Committed.
+ < 0> CartesianPoint images' Committed.
+
+ BEGIN Inner Loop Sequence::.
+
+ INNER LOOP [ 2: 1] :
+
+ LOOK UP 312 Random Parts and Export each Part.
+ Set 100. Part# 14816 Handle= 14817.
+ Set 200. Part# 9496 Handle= 9497.
+ Set 300. Part# 15704 Handle= 15705.
+
+ LookUp for 313 parts; Asserts = 100
+ <Part2 > Asserts = 16; NULL Asserts = 47.
+ <DrawObj > Asserts = 22; NULL Asserts = 64.
+ <NamedObj > Asserts = 0; NULL Asserts = 7.
+ <Person > Asserts = 0; NULL Asserts = 63.
+ <TestObj > Asserts = 7378; NULL Asserts = 0.
+
+ DELETE 750 Random Parts.
+
+ Delete for 751 parts;
+
+ Traverse Count= 192
+
+ TRAVERSE PartId[ 11023] and all Connections to 5 Levels
+
+ Traverse Count= 186
+ Traverse Asserts = 2. True Tests = 1
+ < 3> DrawObj objects DELETED.
+ < 65> are Named.
+ < 2> Point objects DELETED.
+
+ CREATE 1000 Additional Parts
+
+ Create 1000 New Parts
+ Create Part 17001. Token[ 4: 17002].
+
+ < 1000> Parts Created. CurrentId= 18000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 17001. Token[ 4: 17002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=18000
+ < 3057> Part images' Committed.
+ < 0> are Named.
+ < 1586> Point images' Committed.
+ < 247> Person images' Committed.
+
+ COMMIT Parts(* 15250)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. TestObj Committed.
+ < 158> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. CartesianPoint Committed.
+ < 158> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. TestObj Deleted.
+ < 158> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. CartesianPoint Deleted.
+ < 158> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 2: 1].
+
+ INNER LOOP [ 2: 2] :
+
+ LOOK UP 312 Random Parts and Export each Part.
+ Set 100. Part# 9458 Handle= 9459.
+ Set 200. Part# 10907 Handle= 10908.
+ Set 300. Part# 4112 Handle= 4113.
+
+ LookUp for 313 parts; Asserts = 96
+ <Part2 > Asserts = 22; NULL Asserts = 71.
+ <DrawObj > Asserts = 11; NULL Asserts = 42.
+ <NamedObj > Asserts = 0; NULL Asserts = 9.
+ <Person > Asserts = 0; NULL Asserts = 63.
+ <TestObj > Asserts = 7473; NULL Asserts = 0.
+
+ DELETE 750 Random Parts.
+
+ Delete for 751 parts;
+
+ Traverse Count= 186
+
+ TRAVERSE PartId[ 7354] and all Connections to 5 Levels
+
+ Traverse Count= 168
+ Traverse Asserts = 3. True Tests = 1
+ < 3> DrawObj objects DELETED.
+ < 111> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 1000 Additional Parts
+
+ Create 1000 New Parts
+ Create Part 18001. Token[ 4: 18002].
+
+ < 1000> Parts Created. CurrentId= 19000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 18001. Token[ 4: 18002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=19000
+ < 3032> Part images' Committed.
+ < 0> are Named.
+ < 1422> Point images' Committed.
+ < 281> Person images' Committed.
+
+ COMMIT Parts(* 15500)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 7]. TestObj Committed.
+ < 157> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. CartesianPoint Committed.
+ < 157> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 7]. TestObj Deleted.
+ < 157> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. CartesianPoint Deleted.
+ < 157> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 2: 2].
+
+ INNER LOOP [ 2: 3] :
+
+ LOOK UP 312 Random Parts and Export each Part.
+ Set 100. Part# 14370 Handle= 14371.
+ Set 200. Part# 9943 Handle= 9944.
+ Set 300. Part# 1290 Handle= 1291.
+
+ LookUp for 313 parts; Asserts = 120
+ <Part2 > Asserts = 16; NULL Asserts = 47.
+ <DrawObj > Asserts = 11; NULL Asserts = 46.
+ <NamedObj > Asserts = 0; NULL Asserts = 5.
+ <Person > Asserts = 0; NULL Asserts = 63.
+ <TestObj > Asserts = 9796; NULL Asserts = 0.
+
+ DELETE 750 Random Parts.
+
+ Delete for 751 parts;
+
+ Traverse Count= 168
+
+ TRAVERSE PartId[ 3503] and all Connections to 5 Levels
+
+ Traverse Count= 132
+ Traverse Asserts = 1. True Tests = 0
+ < 2> DrawObj objects DELETED.
+ < 53> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 1000 Additional Parts
+
+ Create 1000 New Parts
+ Create Part 19001. Token[ 4: 19002].
+
+ < 1000> Parts Created. CurrentId= 20000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 19001. Token[ 4: 19002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=20000
+ < 3024> Part images' Committed.
+ < 0> are Named.
+ < 1616> Point images' Committed.
+ < 263> Person images' Committed.
+
+ COMMIT Parts(* 15750)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. TestObj Committed.
+ < 157> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 7]. CartesianPoint Committed.
+ < 157> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. TestObj Deleted.
+ < 157> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 7]. CartesianPoint Deleted.
+ < 157> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 2: 3].
+
+ INNER LOOP [ 2: 4] :
+
+ LOOK UP 312 Random Parts and Export each Part.
+ Set 100. Part# 13437 Handle= 13438.
+ Set 200. Part# 14737 Handle= 14738.
+ Set 300. Part# 18884 Handle= 18885.
+
+ LookUp for 313 parts; Asserts = 89
+ <Part2 > Asserts = 19; NULL Asserts = 75.
+ <DrawObj > Asserts = 8; NULL Asserts = 45.
+ <NamedObj > Asserts = 0; NULL Asserts = 9.
+ <Person > Asserts = 0; NULL Asserts = 63.
+ <TestObj > Asserts = 7409; NULL Asserts = 0.
+
+ DELETE 750 Random Parts.
+
+ Delete for 751 parts;
+
+ Traverse Count= 132
+
+ TRAVERSE PartId[ 16769] and all Connections to 5 Levels
+
+ Traverse Count= 123
+ Traverse Asserts = 2. True Tests = 0
+ < 2> DrawObj objects DELETED.
+ < 65> are Named.
+ < 2> Point objects DELETED.
+
+ CREATE 1000 Additional Parts
+
+ Create 1000 New Parts
+ Create Part 20001. Token[ 4: 20002].
+
+ < 1000> Parts Created. CurrentId= 21000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 20001. Token[ 4: 20002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=21000
+ < 2861> Part images' Committed.
+ < 0> are Named.
+ < 1366> Point images' Committed.
+ < 275> Person images' Committed.
+
+ COMMIT Parts(* 16000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 7]. TestObj Committed.
+ < 157> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. CartesianPoint Committed.
+ < 157> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 7]. TestObj Deleted.
+ < 157> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. CartesianPoint Deleted.
+ < 157> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 2: 4].
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ < 0> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ < 0> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ STATUS= -201
+V O R T E x 0 1!V O R T E x 0 1!V O R T E x 0 1!V O R T E x 0 1!V O R T E x 0 1!
Added: test-suite/trunk/External/SPEC/CINT2000/256.bzip2/256.bzip2.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/256.bzip2/256.bzip2.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/256.bzip2/256.bzip2.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2000/256.bzip2/256.bzip2.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,19 @@
+spec_init
+Loading Input Data
+Duplicating 1038922 bytes
+Duplicating 2077844 bytes
+Duplicating 4155688 bytes
+Duplicating 77232 bytes
+Input data 8388608 bytes in length
+Compressing Input Data, level 7
+Compressed data 7139067 bytes in length
+Uncompressing Data
+Uncompressed data 8388608 bytes in length
+Uncompressed data compared correctly
+Compressing Input Data, level 9
+Compressed data 6088533 bytes in length
+Uncompressing Data
+Uncompressed data 8388608 bytes in length
+Uncompressed data compared correctly
+Tested 8MB buffer: OK!
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2000/256.bzip2/256.bzip2.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/256.bzip2/256.bzip2.reference_output.small?rev=105213&view=auto
==============================================================================
(empty)
Added: test-suite/trunk/External/SPEC/CINT2000/300.twolf/300.twolf.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/300.twolf/300.twolf.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/300.twolf/300.twolf.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2000/300.twolf/300.twolf.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1 @@
+88c490ec09e17bc7028cb032c2d951f9
Added: test-suite/trunk/External/SPEC/CINT2000/300.twolf/300.twolf.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2000/300.twolf/300.twolf.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2000/300.twolf/300.twolf.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CINT2000/300.twolf/300.twolf.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1 @@
+f3419803d4d33540846dbeca5394ab2a
Added: test-suite/trunk/External/SPEC/CINT2006/400.perlbench/400.perlbench.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2006/400.perlbench/400.perlbench.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2006/400.perlbench/400.perlbench.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2006/400.perlbench/400.perlbench.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,11 @@
+zed --> zed
+yankeeist --> yankeeist
+band --> band
+april --> april
+april --> pilar
+april --> ripal
+acetylic --> acetylic
+abdomen --> abdomen
+abortive --> abortive
+abortive --> bravoite
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2006/401.bzip2/401.bzip2.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2006/401.bzip2/401.bzip2.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2006/401.bzip2/401.bzip2.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2006/401.bzip2/401.bzip2.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,20 @@
+spec_init
+Loading Input Data
+Input data 5242880 bytes in length
+Compressing Input Data, level 5
+Compressed data 1884648 bytes in length
+Uncompressing Data
+Uncompressed data 5242880 bytes in length
+Uncompressed data compared correctly
+Compressing Input Data, level 7
+Compressed data 1950538 bytes in length
+Uncompressing Data
+Uncompressed data 5242880 bytes in length
+Uncompressed data compared correctly
+Compressing Input Data, level 9
+Compressed data 1918820 bytes in length
+Uncompressing Data
+Uncompressed data 5242880 bytes in length
+Uncompressed data compared correctly
+Tested 5MB buffer: OK!
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2006/403.gcc/403.gcc.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2006/403.gcc/403.gcc.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2006/403.gcc/403.gcc.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2006/403.gcc/403.gcc.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1 @@
+49b65dd3c11c71db063ae2dad128cd23
Added: test-suite/trunk/External/SPEC/CINT2006/429.mcf/429.mcf.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2006/429.mcf/429.mcf.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2006/429.mcf/429.mcf.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2006/429.mcf/429.mcf.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,7038 @@
+
+MCF SPEC CPU2006 version 1.10
+Copyright (c) 1998-2000 Zuse Institut Berlin (ZIB)
+Copyright (c) 2000-2002 Andreas Loebel & ZIB
+Copyright (c) 2003-2005 Andreas Loebel
+
+nodes : 5985
+active arcs : 102404
+simplex iterations : 63475
+objective value : 3180065918
+new implicit arcs : 2393292
+active arcs : 2495696
+simplex iterations : 118645
+objective value : 2060055866
+erased arcs : 2387557
+checksum : 2997477
+done
+exit 0
+()
+1027
+1345
+1550
+1731
+1909
+2096
+2283
+2469
+2668
+***
+3278
+***
+3946
+()
+1005
+***
+2464
+2692
+***
+5593
+5716
+5856
+5946
+()
+999
+1290
+***
+2665
+2850
+3098
+3320
+3576
+3795
+4053
+4276
+4502
+4690
+4935
+5119
+5239
+5379
+5466
+5546
+5632
+5709
+5794
+5860
+()
+995
+1293
+***
+1726
+1932
+***
+2582
+2890
+***
+3445
+3708
+4080
+4381
+4717
+4969
+5170
+5310
+5443
+5568
+()
+992
+***
+2993
+3123
+3265
+3421
+3528
+3687
+3798
+***
+4395
+***
+5673
+5819
+()
+952
+***
+1556
+***
+3010
+3187
+***
+4107
+***
+4654
+***
+5076
+***
+5566
+()
+890
+1286
+1522
+1743
+1957
+2141
+2329
+2583
+2821
+***
+3677
+3965
+***
+4557
+4879
+5082
+5227
+5341
+5462
+5563
+5683
+5777
+5881
+()
+889
+1227
+1438
+***
+2747
+3022
+***
+3626
+4087
+4426
+4809
+()
+878
+1226
+1489
+1700
+1900
+2109
+2315
+2534
+2763
+***
+3620
+3809
+***
+4868
+5212
+()
+875
+1222
+1491
+1698
+1901
+2110
+2318
+2533
+2760
+3053
+***
+4194
+4392
+()
+866
+***
+1441
+1667
+***
+2555
+2659
+***
+3415
+3675
+4131
+4468
+4850
+5089
+5265
+5396
+***
+5923
+()
+831
+1078
+1283
+1465
+1607
+1749
+1872
+2017
+2147
+2298
+2430
+2590
+2726
+2917
+3108
+3321
+3514
+3731
+3932
+4143
+4325
+4527
+4685
+4857
+4994
+5121
+5221
+5314
+5404
+5485
+5572
+5650
+()
+822
+***
+1541
+1751
+***
+2967
+3188
+3427
+3666
+3916
+4146
+4379
+4582
+4787
+()
+819
+1130
+***
+2882
+3086
+3213
+3410
+3577
+3779
+3988
+()
+814
+1099
+***
+3260
+3495
+3673
+3908
+4084
+4371
+4530
+4727
+4867
+5024
+5159
+()
+807
+1239
+***
+2158
+***
+2891
+3118
+3363
+3605
+3842
+4079
+4310
+4526
+***
+5806
+5907
+()
+796
+1174
+1479
+1715
+1941
+2168
+2405
+2652
+2936
+3269
+3619
+3961
+***
+4876
+()
+794
+1237
+1584
+1879
+2172
+2427
+2701
+3061
+3450
+3872
+4247
+4634
+()
+791
+1181
+1576
+1806
+2120
+2360
+***
+2845
+3052
+3243
+3458
+3664
+3958
+***
+4532
+4990
+5282
+5445
+5624
+5772
+()
+786
+1346
+1710
+2055
+2399
+2775
+3254
+3773
+4285
+4737
+5145
+()
+781
+1166
+***
+2899
+3164
+3431
+3704
+3990
+4238
+4492
+4733
+4941
+5107
+5238
+5360
+5475
+5587
+5696
+5810
+5902
+()
+777
+1334
+1921
+2272
+2689
+3159
+3769
+3882
+4425
+4758
+4944
+5141
+()
+774
+1043
+1357
+***
+2660
+***
+3843
+3964
+4261
+()
+761
+1161
+1559
+1794
+2104
+2346
+2679
+2992
+3444
+3806
+4262
+4589
+4948
+5163
+5326
+5455
+()
+729
+***
+2980
+3087
+***
+3597
+***
+4235
+4418
+4521
+4661
+4762
+4885
+4964
+5063
+5122
+5201
+5251
+5321
+5374
+5440
+5484
+5550
+5595
+5657
+5705
+5763
+5808
+5866
+5897
+5931
+5955
+()
+726
+()
+717
+1282
+1672
+2005
+2348
+2721
+3200
+3697
+4213
+4670
+***
+5641
+()
+712
+1013
+***
+2949
+3096
+3205
+3327
+()
+711
+1217
+1520
+1831
+2068
+2383
+2645
+3044
+***
+4155
+4453
+***
+4818
+()
+707
+1221
+1614
+1922
+2249
+2576
+2988
+3448
+3945
+4391
+4801
+5112
+()
+698
+972
+1194
+1393
+1542
+***
+2972
+3261
+3384
+3524
+3660
+3799
+3936
+4078
+4198
+4337
+4456
+4579
+4699
+4810
+4914
+5005
+5085
+5161
+()
+692
+1103
+***
+1995
+2209
+***
+2960
+3147
+3288
+3489
+3643
+3854
+***
+4290
+4541
+4820
+()
+691
+1241
+1647
+1974
+2333
+2694
+3166
+3676
+4182
+***
+4960
+5127
+5319
+5496
+5651
+5818
+5928
+()
+679
+1163
+***
+1913
+2097
+***
+2773
+3033
+3301
+3574
+3838
+4112
+4369
+4615
+4839
+5029
+5175
+5317
+5435
+5548
+5653
+5760
+5848
+()
+678
+1023
+1387
+()
+676
+941
+***
+3788
+3944
+()
+670
+***
+1249
+1466
+***
+1830
+2073
+2681
+3005
+***
+3656
+***
+4192
+***
+5131
+5298
+()
+666
+1092
+1857
+2116
+2761
+2968
+3564
+3775
+4367
+4562
+5072
+()
+665
+1050
+1515
+1820
+2165
+2478
+2859
+3298
+3803
+4251
+4697
+5035
+5199
+()
+660
+955
+***
+3273
+3623
+3998
+4293
+4625
+4889
+5109
+()
+654
+1018
+***
+2772
+2991
+3222
+3459
+3705
+3942
+4187
+4405
+4614
+4802
+5030
+5190
+5293
+()
+652
+1022
+1470
+1720
+2027
+2266
+2598
+2873
+3329
+3681
+4149
+4480
+4869
+5094
+5262
+5421
+5549
+5699
+5816
+()
+651
+1118
+1471
+2131
+2401
+2666
+2881
+3097
+3223
+3493
+3887
+4246
+4482
+4675
+4785
+4978
+5229
+5605
+5741
+5867
+()
+648
+1212
+1619
+1959
+2305
+2670
+3129
+3636
+4151
+4608
+5006
+()
+643
+1196
+1586
+1747
+2086
+2406
+2588
+3018
+3479
+3733
+4303
+4645
+4844
+()
+641
+923
+1234
+1462
+1666
+1835
+2019
+2208
+2394
+2584
+2800
+3057
+3324
+3588
+3870
+4132
+4398
+4637
+4864
+5046
+5192
+()
+639
+960
+***
+2846
+***
+3394
+3635
+3805
+4046
+4211
+4496
+4651
+4834
+4967
+5102
+5253
+()
+629
+***
+1279
+***
+2931
+3084
+***
+3672
+3893
+4091
+4291
+4467
+4659
+4777
+()
+628
+1016
+1739
+1980
+2580
+2868
+***
+3505
+3654
+3969
+4313
+***
+4704
+4918
+5187
+5385
+5543
+5717
+5862
+()
+623
+1154
+1557
+1877
+2200
+2539
+2904
+3383
+3863
+4335
+4744
+5084
+()
+618
+1169
+1601
+1935
+2286
+2644
+3099
+3606
+4110
+4590
+()
+617
+1015
+1448
+1713
+2001
+2258
+2569
+2865
+3296
+3682
+4123
+()
+611
+861
+1233
+***
+2803
+3144
+3587
+3967
+4406
+4714
+5051
+5244
+5381
+5536
+5658
+5803
+5904
+()
+610
+***
+1058
+***
+1883
+2050
+2233
+2492
+2718
+3043
+3369
+3692
+4022
+4365
+4648
+4926
+5124
+5309
+5425
+5553
+5703
+()
+609
+1255
+1468
+1813
+2198
+2562
+3076
+3323
+3907
+()
+605
+789
+1040
+1244
+***
+2002
+2193
+***
+2779
+***
+3404
+3847
+()
+598
+754
+980
+1148
+1355
+1481
+1627
+1723
+1861
+1960
+2094
+2203
+2339
+2452
+2600
+2708
+2875
+3040
+3231
+3378
+3593
+3746
+3960
+4101
+4299
+4439
+4624
+4753
+4899
+***
+5544
+5648
+5710
+5805
+5863
+5926
+()
+597
+***
+1065
+1400
+1678
+1878
+2126
+2336
+2606
+2851
+3204
+3513
+***
+4124
+4318
+***
+4764
+5144
+5401
+5557
+5733
+5871
+()
+592
+721
+***
+1987
+2083
+2220
+2322
+2456
+2564
+2705
+2828
+***
+3311
+3475
+3864
+4220
+4946
+5165
+5502
+5610
+5724
+5821
+()
+591
+734
+904
+1073
+1252
+1380
+1499
+1609
+1734
+1836
+1962
+2059
+2192
+2292
+2424
+2536
+2673
+2795
+2976
+3114
+3302
+3452
+3612
+3766
+3919
+4073
+4223
+4363
+4509
+()
+590
+1068
+1424
+2011
+2261
+2906
+3270
+3655
+4028
+4388
+4709
+5214
+5328
+5666
+5770
+5875
+()
+588
+887
+***
+1447
+1652
+1826
+***
+2342
+2472
+2635
+2776
+2989
+***
+3534
+3877
+4236
+4742
+()
+579
+809
+1011
+1268
+1472
+1638
+1754
+1905
+2025
+2183
+2304
+2466
+2594
+2770
+2935
+3158
+3333
+3569
+3743
+3986
+4154
+()
+578
+***
+1165
+1442
+1545
+1724
+1811
+2235
+2416
+2698
+3026
+3276
+3503
+3640
+3901
+4282
+4613
+4828
+4988
+()
+577
+1139
+1577
+1914
+2256
+2622
+3070
+3571
+4085
+4555
+4966
+5269
+5460
+5609
+5785
+5909
+()
+573
+***
+1038
+***
+1553
+1777
+***
+2856
+3153
+***
+3717
+***
+4402
+4725
+5261
+5359
+5428
+5439
+5531
+5680
+5693
+5884
+()
+570
+1069
+1513
+1829
+2155
+2482
+***
+3132
+***
+4096
+4348
+4569
+()
+569
+817
+1080
+1341
+1514
+***
+2572
+2825
+3141
+***
+4650
+5077
+5344
+5501
+5677
+5822
+()
+567
+694
+802
+932
+()
+562
+***
+1112
+1405
+1635
+1834
+2040
+2246
+***
+3238
+3614
+4002
+4349
+()
+561
+752
+1277
+1437
+1604
+***
+2432
+2510
+2632
+2711
+2843
+***
+3259
+3604
+3934
+4278
+4577
+4855
+()
+560
+857
+1220
+1530
+1742
+1979
+2199
+2449
+2682
+3003
+3342
+3645
+3972
+4254
+4548
+4816
+5039
+()
+558
+1009
+1401
+1704
+1964
+2255
+2530
+2855
+3234
+3669
+4070
+4471
+4795
+5068
+5256
+5338
+5436
+5512
+5600
+5670
+5761
+5829
+5903
+5938
+()
+557
+***
+990
+1292
+***
+2815
+2909
+***
+3724
+***
+4288
+4593
+***
+5181
+()
+556
+939
+***
+2858
+3041
+3331
+3460
+3617
+3722
+3874
+4011
+***
+4457
+***
+4987
+()
+552
+697
+917
+1101
+1314
+1433
+1596
+1690
+1821
+1929
+2062
+2170
+2308
+2415
+2560
+2672
+2839
+2984
+3178
+3336
+3547
+3685
+3903
+4056
+4253
+4397
+4572
+4707
+4874
+4976
+5095
+***
+5899
+()
+546
+1248
+1691
+2121
+2526
+3072
+3634
+4286
+4789
+()
+545
+778
+1048
+1294
+1498
+***
+2872
+3064
+3365
+()
+543
+718
+961
+1167
+1439
+***
+2946
+***
+3828
+3940
+4068
+4265
+***
+5018
+()
+541
+929
+1267
+1573
+***
+2471
+2664
+2978
+3297
+3665
+3996
+4334
+4655
+***
+5168
+5208
+5236
+5264
+5297
+5324
+5355
+5386
+5416
+5442
+5472
+5498
+5527
+5552
+5583
+5606
+5635
+5662
+5690
+5715
+5744
+5768
+5796
+5820
+5844
+()
+540
+***
+1047
+***
+1446
+1665
+1819
+2016
+2185
+2393
+***
+3013
+3252
+()
+539
+949
+1386
+1682
+1949
+2224
+2519
+2818
+3214
+3616
+4034
+4423
+4784
+5064
+5274
+5458
+5615
+5784
+5920
+()
+538
+1003
+***
+2731
+***
+3303
+3680
+4067
+4417
+5111
+5267
+()
+537
+795
+1079
+***
+2892
+3249
+***
+3801
+()
+536
+896
+1270
+***
+1897
+1992
+2127
+2227
+2357
+2465
+2605
+2714
+2877
+3016
+3208
+3360
+3551
+3710
+3923
+4113
+4315
+4505
+4679
+()
+534
+958
+1385
+1684
+1945
+2231
+2511
+2827
+3207
+3622
+4035
+4422
+4776
+5069
+5281
+5449
+5622
+5776
+()
+533
+704
+874
+1086
+1260
+1409
+1534
+***
+1898
+2140
+2476
+2716
+***
+3293
+3504
+()
+531
+647
+783
+996
+***
+2833
+3172
+3483
+***
+4072
+***
+4794
+5015
+()
+530
+903
+1412
+1735
+2069
+2374
+2744
+3168
+3674
+4127
+4584
+4939
+***
+5949
+5958
+5964
+5967
+5972
+5975
+5981
+()
+529
+936
+***
+1613
+1894
+2143
+2404
+2736
+3137
+3595
+3992
+4400
+4766
+5038
+()
+528
+686
+838
+1017
+1187
+1343
+1459
+1581
+***
+1919
+2169
+2784
+3140
+3517
+3888
+4266
+4595
+()
+526
+674
+825
+994
+1179
+1325
+1450
+1566
+***
+3285
+3589
+3753
+3905
+()
+525
+856
+1253
+1528
+1762
+1984
+2219
+2451
+2702
+3006
+3341
+()
+524
+910
+1312
+***
+2621
+***
+3124
+3420
+***
+4218
+4409
+4542
+4799
+5022
+5146
+5285
+()
+520
+***
+1122
+2903
+***
+3318
+3565
+3871
+4111
+4393
+4610
+4856
+5025
+5186
+()
+516
+1053
+1517
+1867
+2215
+2573
+2998
+3508
+4024
+4493
+4913
+()
+514
+868
+1361
+1631
+1937
+2175
+2499
+2758
+3182
+3554
+4019
+4357
+4763
+5019
+()
+511
+747
+1002
+1274
+1463
+***
+2034
+2136
+2265
+2366
+2508
+2615
+2757
+***
+3347
+***
+3933
+4331
+()
+510
+808
+***
+3449
+()
+508
+776
+1087
+1362
+1570
+1744
+1931
+2111
+2297
+2487
+2691
+2915
+3192
+3446
+3728
+4003
+4272
+4512
+4754
+4953
+***
+5509
+5596
+5704
+5756
+()
+506
+657
+862
+1031
+1265
+1396
+1549
+1661
+1789
+1890
+2033
+2129
+2270
+2378
+2524
+2633
+2796
+2937
+3135
+3274
+3488
+3644
+3848
+4013
+4201
+4354
+4538
+4663
+4830
+4940
+5075
+***
+5877
+()
+500
+701
+858
+1102
+1258
+1435
+1548
+1693
+1788
+1928
+2032
+2167
+2268
+2413
+2527
+2678
+2790
+2985
+3138
+3334
+3487
+3694
+3851
+4061
+4204
+4399
+4539
+4705
+4827
+4979
+***
+5910
+()
+499
+740
+()
+498
+782
+1077
+1365
+1561
+1748
+1925
+2114
+2293
+2498
+2688
+2921
+3186
+3462
+3715
+4007
+4259
+4518
+4747
+4956
+5116
+5241
+5331
+5422
+5503
+5588
+5668
+5751
+()
+497
+1045
+1571
+1906
+2325
+2484
+2885
+3465
+4039
+***
+4922
+()
+495
+***
+1262
+***
+3455
+3699
+4010
+4237
+4515
+4730
+4951
+5101
+()
+494
+855
+***
+3015
+3193
+3315
+***
+3750
+4025
+4170
+***
+5788
+()
+492
+760
+1055
+***
+2793
+3025
+3209
+***
+3783
+()
+486
+1010
+1501
+1842
+2190
+2545
+2974
+3471
+3983
+4472
+4896
+()
+484
+690
+885
+1109
+1291
+***
+2566
+2802
+3031
+3248
+3502
+3735
+3989
+4209
+4435
+4647
+4838
+5049
+5178
+5318
+5410
+5487
+5579
+5654
+5739
+5812
+5887
+()
+483
+705
+967
+1232
+***
+2945
+3092
+3280
+3423
+3713
+***
+4792
+()
+479
+***
+2640
+2886
+3521
+3738
+4031
+4294
+4597
+4877
+()
+475
+***
+1026
+1276
+1773
+2023
+2656
+2831
+3563
+3706
+3826
+3991
+4106
+4245
+4364
+4500
+4603
+4726
+4825
+4931
+5021
+5100
+5383
+5526
+5817
+5921
+()
+474
+880
+1338
+1597
+1810
+2044
+2276
+2518
+2765
+3089
+3412
+3770
+4099
+4433
+4728
+4991
+()
+470
+788
+1191
+1476
+1697
+1910
+2092
+2278
+2532
+2762
+***
+3484
+()
+465
+***
+987
+***
+2489
+2771
+2887
+3103
+***
+3869
+***
+5060
+()
+462
+***
+1120
+1449
+1799
+2101
+2446
+2783
+3255
+3714
+4215
+4619
+()
+460
+653
+806
+1034
+1208
+1394
+1508
+1662
+1764
+1891
+1990
+2134
+2242
+2375
+2490
+2634
+2750
+2939
+3083
+3279
+3438
+3642
+3787
+4009
+4156
+4352
+4483
+4665
+4793
+4937
+***
+5791
+5891
+5951
+()
+459
+601
+804
+968
+1215
+1354
+1505
+1630
+1761
+1859
+1988
+2100
+2237
+2338
+2493
+2604
+2748
+2878
+3081
+3228
+3433
+3590
+3789
+3957
+4160
+4304
+4490
+4620
+4791
+4900
+5044
+***
+5942
+()
+458
+895
+1316
+1645
+1893
+2194
+2454
+2780
+3139
+3579
+4037
+4350
+()
+457
+602
+757
+919
+1106
+1257
+1392
+1507
+***
+3861
+4021
+4316
+4642
+4873
+5098
+()
+456
+***
+1036
+1370
+1658
+1844
+2000
+2186
+2422
+2620
+2902
+3229
+3560
+3885
+4207
+4503
+4862
+()
+454
+773
+1171
+1460
+1591
+1746
+1856
+2013
+2132
+2291
+2409
+2581
+2710
+2911
+3080
+3316
+3661
+4016
+4333
+4640
+4907
+()
+453
+974
+1473
+1825
+2162
+2523
+2932
+3436
+3954
+4431
+***
+5801
+()
+449
+730
+()
+447
+908
+1308
+1654
+1888
+2201
+2439
+2786
+3133
+3586
+3952
+4390
+4702
+5040
+5248
+5384
+5511
+***
+5827
+()
+445
+829
+1307
+1605
+1886
+2148
+2447
+2725
+3130
+3511
+3955
+4320
+4696
+4996
+()
+444
+906
+1408
+1740
+2063
+2385
+***
+3382
+***
+4038
+4216
+4424
+4588
+()
+441
+738
+1353
+1728
+2125
+2300
+2658
+3174
+3765
+4142
+4488
+4963
+5292
+5476
+5578
+5694
+()
+439
+***
+985
+1298
+1535
+1759
+1991
+2214
+2461
+2693
+3012
+3330
+3732
+4062
+4403
+4638
+***
+5047
+5155
+5257
+5322
+5393
+5477
+***
+5914
+()
+436
+463
+762
+1104
+***
+2531
+***
+2889
+3163
+3430
+3701
+3987
+4248
+4499
+4738
+4934
+5105
+5255
+5380
+5489
+5603
+5707
+5800
+5890
+()
+433
+850
+1284
+1620
+1870
+2163
+2429
+2741
+3104
+3536
+3931
+4343
+4684
+5004
+5217
+()
+432
+645
+***
+1117
+1280
+1428
+1587
+1719
+1852
+1953
+2077
+2179
+2313
+2420
+2556
+2663
+2814
+***
+3257
+3407
+3641
+3830
+4057
+4230
+4445
+4601
+***
+5937
+()
+431
+797
+***
+2470
+2690
+***
+3490
+3951
+4300
+4700
+4985
+5224
+()
+429
+***
+1067
+***
+3020
+***
+3786
+4000
+***
+4497
+***
+5179
+()
+427
+803
+1266
+1592
+1862
+2128
+2421
+2706
+3090
+3481
+3892
+4297
+4668
+4980
+5206
+5403
+5559
+5731
+5873
+()
+426
+847
+1269
+1618
+***
+3171
+3549
+3927
+4289
+5041
+5210
+()
+425
+1105
+1603
+2030
+2426
+2941
+3500
+4152
+4677
+5129
+5352
+5567
+5742
+5911
+()
+423
+749
+1304
+1651
+1976
+2284
+2638
+3037
+3539
+3994
+4466
+4845
+5062
+5246
+5400
+5473
+5564
+5637
+5728
+5797
+()
+422
+933
+1452
+1795
+2144
+2500
+2894
+3393
+3910
+4411
+4841
+5220
+5387
+5570
+5718
+***
+5945
+5959
+5963
+5968
+5971
+5977
+5979
+5983
+()
+421
+751
+1127
+***
+2842
+***
+3397
+3702
+3865
+4051
+4745
+5017
+5392
+5499
+5613
+5719
+5823
+()
+419
+742
+1186
+1543
+1775
+1994
+2230
+2463
+2715
+3023
+3356
+3684
+4050
+4358
+4671
+()
+418
+***
+928
+1030
+***
+2778
+2970
+3157
+3370
+3566
+3813
+***
+4475
+4716
+5036
+5266
+5433
+5607
+5757
+5908
+()
+417
+688
+969
+()
+413
+***
+1046
+***
+1636
+1729
+2087
+2608
+2930
+3764
+4153
+4882
+5140
+5551
+5687
+()
+411
+***
+954
+1199
+()
+409
+720
+1082
+***
+3367
+3523
+3678
+3831
+3997
+4136
+4287
+4428
+4565
+4687
+4842
+4955
+5078
+5156
+5243
+5312
+5367
+5429
+5490
+5569
+5656
+5732
+5815
+5879
+5929
+5954
+()
+405
+745
+***
+3067
+3435
+3922
+4116
+4319
+4494
+4729
+***
+5620
+5769
+()
+404
+***
+1081
+1376
+1625
+1850
+2074
+2309
+2549
+2810
+3136
+3476
+3816
+***
+4708
+***
+5861
+()
+403
+***
+1008
+1164
+***
+3125
+3271
+3507
+3690
+3921
+4102
+4314
+4484
+4678
+4824
+()
+402
+***
+897
+1211
+1451
+1644
+1823
+2004
+2187
+2373
+2567
+***
+3542
+3768
+3953
+4183
+4345
+4609
+4761
+4932
+5052
+()
+401
+710
+1075
+1413
+1663
+1771
+1924
+2042
+2205
+2317
+2488
+2609
+2797
+2955
+3183
+3533
+3876
+4199
+4524
+4814
+()
+400
+***
+1035
+***
+2966
+***
+3388
+3736
+4100
+4660
+4860
+5230
+()
+399
+727
+1230
+1532
+1841
+2079
+2398
+2654
+***
+3419
+4001
+4550
+()
+398
+616
+***
+1074
+***
+2579
+2767
+***
+3447
+3815
+4196
+4535
+4847
+5091
+()
+393
+607
+***
+1145
+1419
+1637
+1846
+2080
+2306
+2557
+2805
+***
+3434
+3800
+4128
+4523
+4751
+()
+391
+***
+905
+1416
+1780
+2119
+2479
+2861
+3366
+3886
+4373
+4808
+()
+389
+***
+845
+1348
+1622
+1923
+2164
+2483
+2738
+3170
+3541
+4005
+4341
+4741
+5008
+()
+388
+886
+1493
+1655
+1993
+2395
+2766
+3359
+3584
+4173
+***
+5065
+5329
+5515
+5664
+5834
+5936
+()
+385
+***
+1116
+1403
+1633
+1832
+2038
+2247
+2460
+2683
+***
+3472
+***
+4065
+4252
+4442
+4618
+4778
+4930
+()
+383
+630
+927
+1223
+1467
+1660
+1837
+2015
+2210
+2389
+2587
+2794
+3060
+3313
+3596
+3856
+4137
+4389
+4636
+4854
+5050
+5205
+5303
+5395
+5478
+5560
+5644
+5722
+()
+374
+613
+***
+1173
+***
+2910
+3112
+3314
+3615
+3894
+4224
+***
+5961
+()
+371
+700
+()
+370
+621
+***
+1160
+1309
+1415
+1516
+1615
+1705
+1792
+1884
+1978
+2070
+2159
+2253
+2349
+2445
+2546
+2648
+2745
+2862
+***
+3309
+***
+3875
+4159
+4421
+4711
+4970
+()
+369
+684
+()
+367
+799
+***
+1142
+***
+2006
+2232
+***
+2675
+***
+3263
+3522
+3917
+4329
+4710
+5001
+()
+366
+658
+1025
+***
+3000
+3131
+3264
+3396
+3568
+3667
+***
+4353
+4599
+4938
+5195
+5377
+5554
+5711
+5869
+()
+364
+733
+1192
+1495
+1727
+1950
+2182
+2417
+2662
+2963
+3282
+3633
+3966
+4305
+4604
+4893
+()
+361
+550
+***
+1028
+1243
+***
+1653
+1895
+2481
+2751
+***
+3432
+()
+360
+636
+1014
+1356
+***
+3198
+3428
+()
+359
+615
+()
+358
+640
+()
+357
+***
+977
+1351
+1580
+***
+2934
+3272
+3739
+4097
+4528
+4823
+5125
+5305
+5437
+5589
+5713
+5853
+5930
+()
+355
+619
+902
+***
+1429
+1685
+***
+2777
+3028
+3290
+3570
+3844
+4119
+4376
+4617
+4846
+5034
+5185
+5302
+5419
+5532
+5638
+5746
+()
+352
+553
+739
+997
+***
+3030
+()
+351
+716
+1146
+1523
+1784
+2066
+2335
+2642
+2979
+3395
+3784
+4217
+4570
+4910
+5151
+5279
+5376
+5457
+5545
+5616
+5708
+5781
+5864
+5912
+()
+349
+***
+810
+()
+346
+693
+1162
+1503
+1796
+2057
+2347
+2627
+3001
+3374
+3808
+4195
+4585
+4897
+5137
+5316
+5399
+5488
+5565
+5652
+5726
+5811
+5878
+5927
+5953
+()
+345
+517
+743
+937
+1195
+1372
+***
+2082
+2295
+***
+2756
+2925
+3160
+***
+3725
+4118
+4519
+4872
+5150
+5452
+5556
+***
+5841
+5924
+()
+343
+766
+1295
+1657
+1969
+2287
+2637
+3047
+3527
+4004
+4461
+4851
+5153
+()
+342
+650
+965
+1201
+1358
+()
+341
+***
+935
+1320
+1669
+1896
+2213
+2457
+***
+3105
+3242
+3555
+3820
+***
+4504
+4676
+4831
+***
+5200
+5308
+5378
+5438
+5491
+***
+5825
+()
+338
+604
+***
+1205
+***
+2281
+2436
+2570
+2732
+2893
+3119
+***
+3911
+4077
+4206
+4327
+4463
+4578
+4695
+4806
+4915
+5011
+5088
+5164
+()
+335
+***
+901
+***
+1382
+1671
+2226
+2503
+3350
+3740
+4552
+4870
+5323
+5467
+()
+334
+942
+1500
+1940
+2331
+2813
+3362
+4027
+4560
+5056
+5295
+5508
+5688
+5876
+()
+333
+620
+()
+329
+532
+***
+973
+1236
+***
+2561
+***
+3491
+3853
+4166
+4506
+4780
+5032
+5235
+5369
+5471
+5591
+5691
+5804
+5888
+()
+326
+608
+1033
+1444
+1687
+1903
+2137
+2362
+2619
+2888
+3217
+3556
+3912
+4227
+4559
+4886
+5139
+5332
+5514
+5667
+5832
+()
+322
+713
+1124
+1521
+***
+2746
+2920
+3162
+3289
+3510
+3695
+3962
+()
+317
+***
+877
+()
+314
+587
+***
+1263
+1555
+1885
+2195
+2544
+2896
+3398
+3855
+4340
+4734
+()
+313
+507
+940
+1367
+1676
+1971
+2262
+2528
+2812
+3191
+3572
+4008
+4378
+4755
+()
+312
+***
+882
+***
+1352
+1629
+2197
+2450
+***
+3074
+***
+3777
+3999
+***
+4540
+4770
+()
+306
+667
+1123
+1487
+1776
+2036
+2327
+2614
+2964
+3351
+3760
+4165
+4553
+4881
+5130
+5342
+5504
+5679
+5824
+5933
+()
+304
+568
+***
+1240
+***
+4063
+***
+4972
+()
+303
+***
+953
+1347
+1708
+2007
+2351
+2671
+3126
+3582
+4086
+4507
+4912
+5183
+5337
+5417
+5510
+5585
+5676
+5745
+()
+300
+450
+680
+849
+1131
+1305
+***
+4239
+4430
+()
+299
+***
+898
+***
+1485
+1757
+2369
+3014
+3220
+3825
+4054
+4607
+4786
+5202
+5351
+5714
+5838
+5932
+()
+292
+***
+673
+()
+291
+823
+1480
+1869
+2310
+2722
+3339
+3913
+4531
+4993
+5280
+5468
+5672
+5842
+()
+288
+582
+1062
+1411
+1741
+1977
+2288
+2542
+2905
+3262
+3721
+4089
+4513
+4812
+5114
+5277
+5427
+5539
+5660
+5779
+()
+287
+491
+***
+1126
+1238
+1642
+2048
+2112
+2467
+2959
+3062
+3629
+4015
+4366
+4887
+5059
+5211
+5354
+5529
+5685
+()
+281
+489
+***
+915
+1242
+1506
+1706
+1865
+2049
+2234
+2423
+2655
+2929
+3277
+3610
+3943
+4249
+4580
+4817
+()
+280
+***
+938
+1319
+1582
+1801
+2031
+2259
+2504
+2754
+3075
+3401
+3759
+4095
+()
+279
+428
+***
+912
+***
+3056
+3352
+3618
+3810
+3971
+***
+4501
+()
+278
+***
+1041
+***
+2541
+3212
+3609
+4427
+4760
+()
+276
+***
+851
+1395
+1760
+2093
+2448
+2835
+3328
+3836
+4339
+4790
+()
+275
+599
+()
+274
+468
+669
+787
+948
+***
+1904
+2113
+***
+2898
+***
+3506
+3829
+4150
+4460
+4688
+()
+273
+***
+873
+1088
+***
+3017
+3319
+3693
+4281
+()
+272
+***
+1006
+1210
+***
+2938
+3181
+3425
+3627
+***
+4264
+4591
+4718
+4950
+5132
+5252
+5345
+()
+270
+***
+759
+***
+1218
+1524
+2102
+2352
+3045
+3405
+3785
+4161
+4510
+4819
+()
+268
+503
+846
+1229
+***
+1646
+1864
+***
+2443
+3146
+3361
+3978
+4186
+4720
+4892
+5263
+5413
+5766
+5883
+()
+267
+946
+***
+2459
+2684
+2953
+3210
+3390
+3515
+3703
+3860
+4169
+4447
+4721
+4949
+5092
+5232
+()
+266
+408
+***
+836
+***
+2791
+2983
+3179
+3376
+3599
+3890
+4167
+4473
+4772
+()
+264
+***
+709
+()
+257
+***
+811
+1184
+1494
+***
+2809
+3051
+3283
+***
+3819
+4163
+4511
+4803
+5058
+5216
+5347
+5461
+5577
+5671
+5789
+()
+256
+544
+***
+1193
+1533
+1639
+2039
+2303
+2951
+3332
+4177
+4533
+5134
+5294
+5659
+5792
+5905
+()
+255
+***
+934
+1329
+1575
+1809
+2028
+2269
+2501
+2764
+3066
+3995
+***
+5016
+()
+253
+***
+944
+()
+252
+430
+***
+872
+1132
+***
+2184
+2396
+***
+3561
+***
+4135
+()
+249
+***
+818
+1136
+()
+248
+***
+1032
+1214
+1378
+***
+2480
+***
+3325
+3632
+3895
+()
+246
+***
+683
+926
+1202
+1410
+1643
+1839
+1998
+2211
+2368
+2592
+***
+3068
+3408
+3878
+4228
+4643
+4924
+5196
+5364
+5493
+5642
+5764
+5893
+()
+244
+580
+957
+1414
+***
+1967
+2041
+2151
+2223
+2340
+2411
+2535
+2610
+2729
+2820
+***
+5629
+5675
+5765
+()
+242
+382
+***
+848
+***
+2811
+***
+3348
+3804
+4175
+4586
+4890
+5162
+()
+237
+490
+***
+1091
+1430
+1755
+1986
+2307
+2554
+***
+3292
+3482
+3630
+3734
+***
+4202
+4573
+***
+5118
+5273
+5365
+5448
+5535
+5612
+5700
+5773
+()
+236
+476
+***
+1096
+1264
+1371
+1488
+1578
+1680
+1758
+1854
+1936
+2037
+2117
+2225
+2302
+2412
+2502
+2607
+2697
+2822
+***
+3400
+3862
+4219
+4631
+4911
+5194
+5340
+()
+233
+362
+***
+775
+1134
+1456
+1673
+1816
+1997
+2188
+2370
+2630
+2874
+***
+3437
+3591
+3747
+3906
+4058
+4203
+4351
+4485
+4621
+4749
+4894
+4998
+5108
+5189
+()
+231
+793
+1397
+1848
+2241
+2699
+3226
+3883
+4434
+4971
+()
+226
+392
+519
+646
+764
+930
+***
+2733
+3173
+3668
+4133
+4581
+4945
+5233
+()
+224
+496
+***
+1180
+2386
+2641
+2798
+3027
+3197
+***
+3683
+4098
+4508
+***
+5363
+5469
+5639
+5738
+5849
+5919
+()
+221
+***
+714
+()
+216
+331
+451
+576
+***
+1024
+***
+1434
+2884
+3065
+3284
+3468
+3698
+3884
+4114
+4284
+()
+214
+381
+***
+966
+***
+1871
+2150
+2431
+2727
+3107
+3519
+3929
+4328
+4682
+5000
+()
+210
+***
+724
+***
+1322
+***
+4768
+***
+5850
+()
+209
+461
+***
+1114
+1245
+1381
+1474
+1590
+1668
+1769
+1845
+1948
+2022
+2133
+2216
+2320
+2397
+2509
+2593
+2713
+2808
+***
+3546
+3817
+()
+207
+377
+722
+1155
+1525
+1778
+2029
+2343
+2650
+2990
+3402
+()
+206
+***
+865
+3093
+***
+3950
+()
+205
+***
+859
+1143
+***
+2328
+2520
+2789
+3082
+***
+3926
+4275
+4598
+4898
+5136
+5284
+5406
+5506
+5627
+5729
+5836
+()
+203
+***
+821
+1369
+1738
+2071
+2425
+2804
+3300
+3807
+4309
+***
+5880
+()
+201
+319
+***
+744
+876
+***
+1344
+2957
+3184
+***
+3920
+4122
+4308
+***
+5070
+()
+199
+328
+480
+649
+883
+1090
+1339
+***
+3613
+3889
+***
+4592
+***
+5126
+5234
+5333
+5424
+5521
+5594
+5655
+5753
+5814
+5896
+()
+197
+260
+410
+559
+671
+826
+***
+1273
+***
+2919
+***
+3585
+3963
+4321
+4656
+5174
+5361
+()
+194
+675
+***
+1066
+()
+193
+327
+434
+606
+770
+962
+1147
+1332
+1461
+1598
+1688
+1812
+1927
+2053
+2157
+2296
+2414
+2553
+2667
+2824
+2982
+3154
+3310
+3497
+3657
+3880
+4043
+4242
+4401
+4583
+4719
+4858
+4977
+5093
+5176
+5272
+5336
+5423
+5483
+5561
+5621
+5697
+5752
+5826
+()
+189
+466
+***
+1144
+1299
+1418
+1519
+1616
+1709
+1798
+1882
+1975
+2067
+2161
+2254
+2350
+2442
+2540
+2643
+2743
+2860
+2997
+3195
+3364
+3530
+3662
+***
+4450
+4712
+()
+187
+***
+627
+***
+1254
+***
+2908
+***
+3516
+3858
+4226
+***
+4743
+()
+186
+***
+976
+***
+1531
+1677
+1807
+***
+2913
+3150
+***
+3726
+3985
+4267
+4491
+4750
+4928
+5117
+5237
+5348
+5470
+5573
+5686
+5786
+5885
+5940
+()
+184
+347
+633
+***
+1204
+1404
+1492
+1610
+1679
+1787
+1855
+***
+2836
+3201
+3575
+3729
+3915
+4629
+4917
+5335
+5446
+5558
+5665
+5775
+5872
+()
+182
+323
+***
+805
+1209
+1623
+1918
+2251
+2574
+2995
+3442
+3949
+4385
+4811
+5110
+5276
+5358
+5453
+5530
+5619
+5692
+5778
+5845
+()
+180
+339
+555
+***
+1190
+1391
+***
+2359
+2617
+3032
+***
+3833
+4047
+***
+4536
+4821
+5106
+5325
+5492
+5661
+5813
+5935
+()
+179
+***
+703
+852
+1007
+***
+2441
+***
+3371
+3751
+4129
+4474
+()
+178
+406
+***
+1083
+***
+1926
+1996
+2108
+2139
+2207
+2273
+2358
+2418
+2486
+2517
+2585
+***
+2901
+***
+3592
+***
+4370
+***
+4732
+4962
+5103
+5258
+5350
+5434
+5522
+5601
+5689
+5762
+5840
+()
+177
+261
+414
+566
+736
+914
+1125
+1289
+1440
+1567
+1686
+1786
+1912
+2024
+2156
+2271
+2403
+2521
+2661
+2792
+2958
+3113
+3287
+3451
+3663
+3827
+4045
+4205
+4407
+4549
+4731
+4852
+4986
+()
+176
+387
+***
+913
+1231
+***
+1595
+1843
+2522
+2712
+3069
+3429
+3686
+3918
+4052
+4302
+4649
+4936
+5099
+5171
+()
+175
+283
+***
+827
+()
+172
+294
+376
+512
+624
+844
+***
+1287
+1383
+1510
+1593
+1699
+1774
+1873
+1946
+2061
+2135
+2245
+2319
+***
+2996
+3281
+3414
+3573
+3688
+3840
+3980
+4117
+4231
+4377
+4486
+4616
+4722
+4836
+5177
+()
+171
+321
+***
+1084
+***
+2830
+3063
+3294
+3531
+3774
+4020
+4244
+4464
+4674
+4861
+()
+170
+308
+574
+921
+1302
+1564
+1681
+1833
+1947
+2106
+2222
+2387
+2513
+2685
+2817
+3054
+3392
+3737
+4074
+4404
+4703
+4954
+()
+169
+301
+407
+572
+728
+924
+1115
+1296
+1432
+1572
+***
+2380
+2537
+2677
+2849
+3042
+3253
+***
+3976
+4139
+4295
+4394
+4547
+4644
+4774
+4866
+4981
+5054
+5133
+5191
+5254
+5313
+5375
+5430
+5486
+5542
+5597
+5649
+5706
+5755
+5809
+5858
+5898
+5934
+5952
+()
+166
+***
+867
+1285
+***
+1732
+1952
+2267
+2515
+2759
+***
+3600
+3762
+3982
+4138
+4336
+4489
+4672
+4797
+4933
+5048
+5147
+5228
+()
+165
+289
+***
+891
+1150
+***
+2883
+3189
+3557
+4179
+4387
+()
+163
+452
+813
+1310
+***
+3850
+4059
+***
+4529
+4833
+5135
+()
+160
+***
+741
+1019
+1363
+***
+2695
+3009
+3473
+3822
+4279
+4600
+4965
+5167
+5320
+5479
+5604
+5748
+5865
+5943
+()
+158
+284
+***
+756
+1172
+1551
+1800
+2095
+2355
+2674
+3002
+3439
+3821
+4258
+***
+4863
+5104
+5301
+()
+156
+***
+892
+1203
+1445
+1650
+1817
+1999
+2189
+2377
+2571
+***
+3218
+3671
+4040
+4470
+4782
+5090
+()
+155
+***
+504
+656
+800
+975
+1151
+1318
+1436
+1554
+1664
+1782
+1874
+2003
+2107
+2240
+2341
+2477
+2586
+2723
+2847
+3039
+3180
+3337
+3486
+3649
+3793
+3959
+4104
+4257
+4396
+4537
+()
+154
+353
+706
+1176
+1512
+1804
+2052
+2312
+2636
+3004
+3385
+3776
+4200
+4596
+4905
+()
+153
+485
+***
+1189
+()
+152
+356
+***
+1121
+1324
+1483
+1632
+1767
+***
+2928
+3071
+***
+3454
+3755
+4071
+()
+151
+***
+732
+***
+1157
+1333
+1527
+***
+2752
+***
+3241
+3349
+3520
+***
+3925
+4189
+***
+4653
+4875
+()
+150
+324
+551
+869
+1207
+1455
+1714
+1920
+2166
+2382
+2651
+2907
+3224
+3553
+3849
+4171
+4478
+4740
+5012
+5184
+5300
+5408
+5534
+5625
+5747
+5835
+()
+148
+316
+677
+1113
+1497
+1772
+2046
+2316
+2616
+2952
+3343
+3761
+4168
+4545
+()
+147
+240
+386
+502
+682
+834
+1042
+1228
+1388
+1509
+1648
+1756
+1876
+1989
+2124
+2236
+2363
+2495
+2625
+2742
+2918
+3085
+3251
+3413
+3631
+3792
+4017
+4176
+4372
+4517
+4692
+4826
+4961
+5073
+5172
+5249
+5330
+5397
+5480
+5540
+5614
+5674
+5749
+5807
+5874
+()
+146
+269
+***
+737
+956
+()
+145
+***
+655
+1281
+1763
+2146
+2602
+3101
+3742
+4306
+4871
+5231
+5456
+5634
+5828
+()
+143
+521
+1140
+1674
+2051
+2506
+2973
+3608
+4178
+4767
+5148
+5398
+5581
+5780
+5918
+()
+142
+354
+***
+909
+***
+1552
+1736
+***
+2799
+3088
+3463
+3824
+4292
+4525
+4929
+()
+141
+380
+***
+920
+***
+1453
+1717
+2290
+2550
+***
+3535
+()
+138
+396
+982
+1583
+1961
+2402
+2834
+3477
+4048
+4652
+5074
+5339
+5523
+5727
+5886
+()
+137
+***
+522
+***
+1051
+1328
+1563
+1770
+1966
+2177
+2388
+2613
+2844
+3148
+3457
+3718
+3914
+4120
+4260
+4543
+4796
+()
+135
+238
+482
+***
+1135
+***
+1640
+1838
+***
+2927
+3299
+3782
+3984
+4191
+4374
+4563
+4837
+()
+133
+285
+***
+950
+1368
+1683
+1934
+2512
+2806
+3624
+4023
+4775
+5055
+5495
+5633
+()
+132
+218
+350
+469
+644
+801
+998
+1188
+1366
+1486
+1612
+1721
+1849
+1956
+2084
+2202
+2332
+2440
+2591
+2709
+2867
+3011
+3190
+3354
+3529
+3689
+3909
+4076
+4280
+4429
+4612
+4746
+4888
+4999
+5120
+5203
+5304
+5371
+5450
+5507
+5590
+5647
+5721
+5782
+5852
+5906
+5948
+5957
+5965
+5966
+5973
+5974
+5980
+5982
+()
+131
+***
+748
+978
+()
+130
+277
+589
+1001
+1427
+1689
+1939
+2250
+2548
+2853
+3266
+3659
+4055
+4459
+4822
+5083
+5268
+5407
+5555
+5681
+()
+129
+***
+685
+798
+***
+1247
+***
+2975
+3307
+3646
+3977
+4283
+4606
+4865
+()
+128
+239
+***
+638
+824
+***
+1259
+1579
+1818
+2321
+2596
+3417
+3638
+4232
+4438
+4925
+5028
+()
+127
+265
+***
+637
+893
+1158
+1390
+1569
+1730
+1933
+2088
+2299
+***
+2879
+***
+3552
+3859
+***
+4415
+4658
+4923
+()
+125
+***
+715
+854
+()
+124
+243
+344
+509
+668
+843
+1029
+1235
+1384
+1511
+1634
+1752
+1858
+1983
+2089
+2228
+2337
+2475
+2597
+2735
+2876
+3058
+3211
+3387
+3559
+3771
+3935
+4148
+4301
+4495
+4639
+()
+123
+412
+***
+1089
+1539
+1853
+2021
+2367
+2704
+2923
+3492
+***
+4271
+***
+4919
+()
+122
+***
+681
+***
+1943
+2043
+2174
+2274
+2408
+2516
+2639
+2769
+***
+3308
+3461
+3778
+4105
+4413
+4693
+4921
+()
+121
+***
+523
+925
+1377
+1702
+1982
+2239
+2505
+***
+3358
+3711
+4032
+4384
+4669
+4942
+5143
+5307
+5415
+5537
+5636
+5750
+5843
+5925
+()
+120
+311
+***
+837
+1061
+1502
+***
+1899
+1951
+1985
+2081
+2173
+2229
+2294
+2326
+2390
+2462
+***
+3344
+3653
+3930
+***
+4815
+5020
+5193
+5370
+5482
+5608
+5730
+()
+119
+384
+***
+993
+***
+1558
+1803
+2384
+2649
+***
+3233
+3763
+3898
+4041
+4162
+4269
+()
+117
+336
+***
+970
+***
+1398
+***
+2801
+***
+3345
+3509
+3658
+3814
+3975
+4125
+4270
+4416
+4551
+4680
+4798
+4943
+5043
+5142
+5219
+5270
+5343
+5390
+5459
+5547
+5623
+5712
+5783
+5859
+5915
+5950
+()
+114
+282
+***
+945
+1321
+1585
+1783
+2035
+2248
+2507
+2734
+3077
+3372
+3720
+4083
+4420
+4715
+4974
+5158
+5288
+5405
+5520
+5617
+5735
+5831
+5916
+()
+113
+258
+464
+***
+1072
+***
+2196
+2419
+2871
+3219
+3580
+3896
+4256
+4546
+4840
+5066
+5245
+5356
+5481
+5584
+5698
+5795
+5895
+()
+112
+***
+542
+884
+***
+3007
+3116
+3295
+***
+3794
+***
+4322
+()
+111
+330
+662
+1063
+***
+2962
+3268
+***
+4222
+4476
+()
+110
+332
+626
+1004
+1457
+1707
+2010
+2257
+2577
+2864
+3304
+()
+107
+222
+***
+832
+1100
+1330
+***
+2646
+2832
+3078
+3470
+3841
+4103
+4311
+4436
+4662
+4968
+5441
+5580
+()
+105
+219
+325
+473
+632
+812
+989
+1198
+1359
+1496
+1611
+***
+2719
+2924
+3161
+3386
+3637
+3881
+4121
+4338
+4561
+4757
+()
+104
+215
+***
+911
+1443
+1840
+2181
+2618
+2787
+3286
+3900
+4147
+4666
+4959
+5149
+5357
+5525
+()
+102
+365
+***
+971
+1271
+()
+101
+213
+***
+959
+1168
+***
+2364
+2589
+2768
+***
+3389
+***
+4197
+4383
+4567
+4723
+()
+100
+208
+***
+661
+***
+1183
+***
+2969
+3094
+3441
+3756
+4126
+4419
+4739
+4983
+5182
+5296
+5420
+5528
+5643
+5743
+5854
+()
+99
+***
+659
+984
+1311
+1560
+1802
+2009
+2260
+2485
+2755
+3046
+3338
+3651
+()
+98
+228
+395
+***
+899
+1138
+()
+97
+229
+379
+***
+991
+1326
+1562
+1768
+1965
+2176
+2392
+2612
+2848
+3151
+3418
+***
+4014
+***
+4904
+()
+94
+241
+***
+864
+1342
+1628
+1917
+2171
+2474
+2749
+3169
+3550
+3993
+()
+93
+230
+***
+663
+***
+1301
+1417
+1518
+1621
+1711
+1797
+1880
+1972
+2065
+2160
+2252
+2345
+2444
+2543
+2647
+2737
+2857
+2999
+3128
+3258
+3391
+3537
+3670
+3811
+3956
+4090
+4212
+4342
+4469
+4587
+4701
+4813
+4909
+5010
+5086
+5160
+5225
+5289
+()
+92
+***
+725
+1110
+1484
+1703
+1942
+2153
+2407
+2628
+2943
+3235
+3621
+3973
+4324
+4628
+()
+90
+295
+***
+907
+1200
+***
+2971
+***
+3466
+()
+89
+***
+527
+***
+1137
+1306
+***
+2781
+3109
+***
+4250
+4446
+4622
+4779
+4891
+5026
+()
+88
+296
+***
+780
+1128
+3024
+3194
+3426
+3611
+3835
+4026
+4240
+4410
+()
+87
+200
+518
+871
+1246
+1565
+1753
+1911
+2090
+2280
+2468
+2728
+3036
+3373
+()
+86
+202
+293
+443
+600
+785
+951
+1156
+1331
+1469
+1588
+1716
+1815
+1954
+2058
+2191
+2301
+2435
+2559
+2700
+2829
+3019
+3185
+3357
+3518
+3730
+3902
+4115
+4273
+4465
+4605
+4783
+4902
+5037
+5123
+5222
+()
+85
+307
+***
+1012
+1336
+1808
+1907
+2014
+2045
+2078
+2180
+2264
+2365
+2458
+2563
+***
+2961
+3399
+3767
+4214
+4554
+4908
+()
+84
+227
+320
+448
+581
+708
+900
+()
+82
+191
+***
+841
+1152
+***
+2947
+3120
+3275
+3464
+3628
+3832
+4006
+4208
+4368
+4558
+4689
+4832
+4952
+()
+81
+192
+481
+746
+***
+1536
+***
+3095
+3540
+3904
+4346
+4673
+5007
+()
+80
+144
+271
+372
+535
+699
+881
+1070
+1272
+1402
+1538
+1659
+1781
+1887
+2020
+2130
+2263
+2372
+2514
+2629
+2782
+2914
+3091
+3245
+3424
+3594
+3802
+3981
+4181
+4330
+4522
+4664
+4800
+4927
+5067
+5152
+5242
+5311
+5391
+5454
+5538
+5592
+5669
+5725
+5802
+5857
+5913
+5944
+5960
+5962
+5969
+5970
+5976
+5978
+5984
+5985
+()
+79
+340
+***
+986
+1379
+1606
+1851
+2056
+2314
+2529
+2816
+3106
+***
+3834
+()
+78
+***
+442
+596
+***
+1000
+1454
+1791
+2103
+2437
+2785
+3250
+3719
+4210
+4627
+5003
+()
+77
+***
+549
+***
+1054
+***
+2942
+3232
+***
+3866
+4033
+4172
+()
+74
+223
+***
+695
+894
+1421
+***
+2933
+3115
+3312
+3532
+3812
+()
+72
+220
+***
+816
+1219
+1475
+1722
+1938
+2178
+2400
+2687
+***
+3494
+3741
+4145
+4444
+4756
+4973
+()
+71
+168
+***
+515
+***
+1256
+***
+3127
+3453
+3790
+4144
+4455
+4748
+5009
+()
+70
+198
+***
+593
+***
+1071
+1337
+1568
+***
+2965
+***
+3409
+***
+4452
+()
+69
+162
+416
+731
+1094
+1431
+1670
+1902
+2118
+2361
+2595
+2880
+3199
+3525
+3852
+***
+4516
+()
+68
+302
+***
+840
+1349
+1701
+2008
+2344
+2680
+3122
+3583
+4081
+4514
+4906
+5198
+5353
+5463
+5582
+5684
+5790
+5882
+5941
+()
+67
+212
+***
+790
+***
+2922
+3216
+3598
+3974
+4556
+4641
+5027
+5516
+()
+66
+***
+472
+772
+()
+65
+262
+477
+***
+922
+1197
+1458
+***
+2098
+2324
+***
+2852
+3305
+3796
+4263
+4694
+5042
+5291
+5409
+5524
+5628
+5740
+5837
+5922
+()
+64
+***
+390
+702
+1057
+1399
+1617
+2696
+***
+3355
+3700
+3970
+4277
+4602
+4975
+5169
+5414
+5533
+5631
+5798
+()
+63
+***
+563
+***
+1129
+()
+62
+183
+337
+***
+835
+1159
+***
+2956
+3149
+3469
+3879
+4193
+4487
+4765
+()
+61
+245
+438
+755
+1107
+1425
+1656
+1889
+2105
+2353
+2578
+2866
+3143
+3440
+3752
+4064
+4361
+4594
+4848
+5087
+5226
+5362
+5465
+5586
+5682
+5799
+()
+60
+195
+687
+1374
+1779
+2217
+2623
+3203
+3772
+4412
+4895
+5215
+5411
+5618
+5793
+5947
+()
+59
+***
+501
+***
+1076
+***
+2944
+3121
+3291
+()
+58
+***
+575
+***
+1178
+***
+2950
+3244
+***
+4018
+()
+57
+139
+***
+595
+1044
+1389
+1641
+1863
+2085
+2323
+2565
+2826
+3155
+3499
+3818
+4184
+4481
+4781
+()
+56
+***
+547
+1093
+1547
+1881
+2238
+2599
+3038
+3538
+4049
+***
+5128
+()
+54
+259
+***
+988
+()
+53
+298
+***
+931
+1225
+***
+2740
+***
+3602
+3837
+4140
+4375
+4635
+4835
+5045
+5173
+5286
+5412
+5517
+5630
+5736
+5839
+5917
+()
+51
+***
+586
+1052
+1422
+1733
+1981
+2282
+2551
+2895
+3267
+3709
+4225
+4623
+()
+50
+140
+***
+488
+758
+***
+1327
+***
+1814
+2018
+***
+3008
+3152
+3353
+3498
+3648
+***
+4180
+4380
+4568
+4724
+***
+5154
+5260
+5315
+5382
+5451
+5541
+5598
+5702
+5759
+5855
+()
+49
+286
+635
+()
+47
+235
+***
+853
+***
+1323
+1600
+1805
+2047
+***
+2954
+***
+3406
+3754
+4134
+4462
+4771
+4995
+()
+46
+159
+310
+471
+771
+()
+44
+181
+513
+***
+1153
+***
+3176
+3340
+3716
+4092
+4449
+4769
+5275
+5388
+()
+43
+188
+***
+1021
+1108
+***
+2494
+2669
+***
+3416
+3581
+3723
+3891
+4044
+4190
+4332
+4477
+4633
+4788
+4901
+5033
+5115
+5213
+5283
+5334
+5402
+()
+42
+225
+564
+***
+1175
+1335
+***
+2807
+2986
+3175
+3381
+3679
+3968
+4382
+***
+5870
+()
+41
+115
+375
+769
+1056
+()
+40
+305
+571
+1020
+1407
+1718
+1958
+2218
+2538
+2870
+3247
+3639
+4075
+4437
+4804
+5071
+5287
+5447
+5574
+5720
+5851
+()
+39
+96
+234
+397
+672
+()
+37
+***
+583
+983
+1420
+1695
+1973
+2243
+2547
+2841
+3256
+3652
+4088
+4451
+4807
+5079
+()
+36
+***
+603
+820
+1039
+1315
+***
+3059
+***
+3757
+3948
+4164
+4344
+4544
+()
+35
+***
+584
+***
+1049
+1275
+***
+2611
+***
+3029
+3221
+3346
+3496
+3601
+***
+4030
+4323
+()
+34
+***
+415
+815
+1261
+1599
+1860
+2138
+2410
+2717
+3079
+3478
+3897
+4296
+4667
+4984
+5218
+5394
+5571
+5723
+5889
+()
+33
+250
+***
+870
+2912
+3156
+***
+3873
+()
+32
+232
+***
+833
+***
+1875
+2149
+2433
+2724
+3111
+3512
+3939
+4326
+4686
+4997
+()
+31
+108
+***
+437
+***
+979
+1185
+***
+2275
+2496
+2657
+***
+3239
+***
+3823
+()
+30
+196
+***
+723
+1213
+1529
+1822
+2076
+2376
+2653
+3034
+3526
+3797
+4093
+4355
+4736
+()
+29
+185
+420
+765
+918
+1085
+1482
+1790
+2072
+2334
+2601
+2926
+3335
+3791
+4185
+4574
+4916
+5157
+5327
+5464
+5611
+5734
+5847
+()
+28
+***
+446
+735
+()
+27
+76
+174
+251
+378
+487
+631
+792
+947
+1141
+1288
+1423
+1537
+1649
+1745
+1868
+1968
+2099
+2206
+2330
+2434
+2575
+2686
+2838
+2981
+3167
+3317
+3474
+3625
+3780
+3937
+4094
+4233
+4386
+4520
+***
+5014
+()
+26
+254
+***
+830
+1251
+***
+4849
+5057
+5259
+5444
+5602
+5767
+5900
+()
+25
+204
+440
+863
+1297
+1624
+1866
+2122
+2438
+2753
+3117
+3501
+3938
+4312
+4691
+4989
+5223
+5389
+5518
+5663
+()
+24
+83
+161
+263
+363
+467
+622
+768
+943
+1111
+1278
+1406
+1526
+***
+2863
+3021
+3225
+3422
+3647
+3839
+4060
+4243
+4441
+4611
+()
+23
+103
+***
+750
+1300
+1694
+2026
+2379
+2739
+3230
+3744
+4241
+4698
+()
+22
+134
+348
+664
+981
+1350
+1626
+1828
+2075
+2289
+2552
+2788
+3134
+3443
+3749
+4066
+4347
+4632
+4920
+5113
+5240
+5346
+5474
+5575
+5695
+5787
+()
+21
+167
+***
+614
+839
+1133
+1364
+1546
+1750
+1908
+2115
+2279
+2497
+***
+2987
+3145
+3322
+3485
+3696
+3868
+4082
+4234
+4432
+4575
+4759
+4880
+5002
+5097
+5197
+5278
+5368
+5426
+5505
+5562
+5645
+5701
+5774
+5830
+5894
+()
+20
+106
+***
+548
+753
+916
+1149
+1313
+1477
+1594
+1725
+1827
+1963
+2060
+2204
+2311
+2453
+2558
+2707
+2837
+3035
+3177
+3375
+3544
+3748
+3899
+4109
+4255
+4443
+4571
+4752
+4878
+5013
+***
+5754
+5868
+()
+19
+173
+***
+888
+1303
+1540
+1944
+2212
+2819
+3196
+4042
+4408
+5061
+()
+18
+***
+478
+***
+1059
+1340
+1544
+1737
+1916
+2091
+2277
+2473
+2676
+***
+4414
+4681
+()
+17
+45
+157
+309
+***
+963
+***
+2948
+3110
+3206
+3377
+3480
+***
+3928
+4130
+4274
+4564
+4829
+5053
+5247
+5372
+5497
+5646
+()
+16
+75
+247
+493
+634
+784
+1250
+1574
+1847
+2154
+2455
+2720
+3073
+3467
+3845
+4268
+4657
+4958
+5209
+()
+15
+48
+126
+211
+318
+424
+565
+719
+879
+1060
+1224
+1375
+1490
+1602
+1696
+1824
+1930
+2054
+2152
+2285
+2391
+2525
+2631
+2774
+2916
+3102
+3246
+3403
+3558
+3712
+3867
+4029
+4174
+4317
+4454
+***
+5096
+5204
+5271
+5366
+5432
+5494
+5576
+()
+14
+***
+290
+594
+()
+13
+190
+***
+767
+1177
+***
+2823
+3055
+***
+3607
+3758
+4069
+4359
+4630
+4884
+5031
+5188
+()
+12
+***
+455
+842
+1317
+***
+3050
+3215
+3380
+3567
+3727
+3947
+4108
+4307
+4458
+4646
+4773
+4903
+5023
+()
+11
+109
+394
+***
+779
+1097
+1426
+1675
+1892
+2123
+2356
+2603
+2869
+3202
+3548
+3941
+4221
+4479
+4843
+()
+10
+118
+***
+828
+1216
+***
+2994
+3142
+3368
+3562
+3781
+3979
+4188
+4362
+4566
+4713
+()
+9
+136
+***
+689
+964
+***
+1712
+***
+2854
+3049
+3240
+3456
+3745
+()
+8
+55
+116
+217
+315
+435
+554
+696
+860
+1037
+1206
+1360
+1478
+1589
+1692
+1785
+1915
+2012
+2145
+2244
+2381
+2491
+2624
+2730
+2900
+3048
+3227
+3379
+3545
+3691
+3846
+4012
+4157
+4298
+4440
+4576
+4735
+4853
+4992
+5080
+5180
+5250
+5306
+5373
+5431
+5513
+5599
+5678
+5758
+5833
+5901
+5939
+5956
+()
+7
+91
+***
+642
+1098
+1464
+1765
+2064
+2354
+2626
+2940
+3326
+3707
+4141
+4498
+4859
+5138
+5349
+5500
+5626
+5771
+5892
+()
+6
+95
+***
+1064
+1373
+1608
+1793
+1955
+2142
+2371
+2568
+2840
+3165
+3603
+3924
+4229
+4534
+4805
+4982
+()
+5
+164
+***
+763
+1182
+1504
+1766
+1970
+2221
+2428
+2703
+2977
+3306
+3650
+4036
+4356
+4683
+4957
+()
+4
+149
+368
+505
+625
+***
+1095
+***
+3237
+3543
+3857
+4158
+4448
+4706
+4947
+5166
+5290
+5418
+5519
+5640
+5737
+5846
+()
+3
+38
+***
+585
+***
+1119
+***
+2897
+3236
+3578
+***
+4360
+4626
+4883
+5081
+5207
+5299
+()
+2
+73
+373
+***
+1170
+***
+3100
+3411
+()
+1
+52
+297
+612
Added: test-suite/trunk/External/SPEC/CINT2006/445.gobmk/445.gobmk.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2006/445.gobmk/445.gobmk.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2006/445.gobmk/445.gobmk.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2006/445.gobmk/445.gobmk.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,73 @@
+= black
+
+=1 1 T7
+
+= black
+
+=2 1 M1
+
+= black
+
+=3 0
+
+= black
+
+=4 0
+
+= black
+
+=5 0
+
+= black
+
+=6 1 N2
+
+= black
+
+=7 1 S2
+
+= black
+
+=8 3 G8
+
+= black
+
+=9 0
+
+= black
+
+=10 1 P11
+
+= black
+
+=11 0
+
+= black
+
+=12 0
+
+= black
+
+=13 0
+
+= black
+
+=14 0
+
+= black
+
+=15 0
+
+= black
+
+=16 1 A15
+
+= black
+
+=17 1 G6
+
+= black
+
+=18 1 F6
+
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2006/456.hmmer/456.hmmer.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2006/456.hmmer/456.hmmer.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2006/456.hmmer/456.hmmer.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2006/456.hmmer/456.hmmer.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,19 @@
+hmmcalibrate -- calibrate HMM search statistics
+HMMER 2.3 (May 2003)
+Copyright (C) 1992-2003 HHMI/Washington University School of Medicine
+Freely distributed under the GNU General Public License (GPL)
+- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+HMM file: bombesin.hmm
+Length distribution mean: 325
+Length distribution s.d.: 200
+Number of samples: 45000
+random seed: 0
+histogram(s) saved to: [not saved]
+- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+
+HMM : Bombesin
+mu : -5.959400
+lambda : 0.576502
+max : 7.707000
+//
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2006/458.sjeng/458.sjeng.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2006/458.sjeng/458.sjeng.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2006/458.sjeng/458.sjeng.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2006/458.sjeng/458.sjeng.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,100 @@
+
+Sjeng version SPEC 1.0, Copyright (C) 2000-2005 Gian-Carlo Pascutto
+
+SPEC Workload
+
+ +----+----+----+----+----+----+----+----+
+8 | *R | | | | *K | *B | | *R |
+ +----+----+----+----+----+----+----+----+
+7 | | | | *N | | *P | *P | |
+ +----+----+----+----+----+----+----+----+
+6 | *P | | | | | | | *P |
+ +----+----+----+----+----+----+----+----+
+5 | | | *P | P | *P | | | *Q |
+ +----+----+----+----+----+----+----+----+
+4 | P | *P | | | N | | | |
+ +----+----+----+----+----+----+----+----+
+3 | | | | B | | | P | P |
+ +----+----+----+----+----+----+----+----+
+2 | | P | Q | | | P | | |
+ +----+----+----+----+----+----+----+----+
+1 | R | | | | K | | | R |
+ +----+----+----+----+----+----+----+----+
+
+ a b c d e f g h
+
+EPD: r3kb1r/3n1pp1/p6p/2pPp2q/Pp2N3/3B2PP/1PQ2P2/R3K2R w KQkq - bm d6; id "LCT2-POS-01";
+
+Searching to 10 ply
+Opening phase.
+Time for move : 1000000
+ 2 -0.61 108 d6 ??
+ 2 -0.60 257 Qd1 !
+ 2 -0.48 490 Be2 !
+ 2 -0.39 615 Be2 Qg6
+ 3 -0.04 949 Be2 !!
+ 3 0.10 1232 Be2 Qg6 O-O
+ 3 0.10 2219 Be2 Qg6 O-O
+ 4 -0.07 3017 Be2 Qg6 O-O Be7
+ 4 -0.07 4689 Be2 Qg6 O-O Be7
+ 5 -0.16 7202 Be2 Qg6 O-O b3 Qc4 Be7
+ 5 -0.16 10503 Be2 Qg6 O-O b3 Qc4 Be7
+ 6 -0.16 15048 Be2 Qg6 O-O b3 <Qc4> <Be7>
+ 6 -0.16 28785 Be2 Qg6 O-O b3 <Qc4> <Be7>
+ 7 -0.09 42444 Be2 Qg6 O-O Nb6 Rfd1 b3 Qd3 Be7
+ 7 -0.09 74507 Be2 Qg6 O-O Nb6 Rfd1 b3 Qd3 Be7
+ 8 -0.09 175520 Be2 Qg6 O-O Nb6 Rfd1 b3 <Qd3> <Be7>
+ 8 -0.08 409470 d6 !
+ 8 0.21 551644 d6 Qf3 O-O f5 Nd2 Qd5 Nc4 Bxd6 Nxd6+ Qxd6 Bxf5
+ 9 0.38 1100719 d6 Qf3 O-O h5 Rfd1 h4 Ng5 Qb7 Be4
+ 9 0.38 1215246 d6 Qf3 O-O h5 Rfd1 h4 Ng5 Qb7 Be4
+10 0.43 2222565 d6 Qf3 O-O Qh5 Kh2 Qg6 Qc4 a5 Qd5 Rd8
+10 0.43 2481142 d6 Qf3 O-O Qh5 Kh2 Qg6 Qc4 a5 Qd5 Rd8
+
+ +----+----+----+----+----+----+----+----+
+8 | | *K | | *R | | | | *R |
+ +----+----+----+----+----+----+----+----+
+7 | *P | *P | | | *Q | *P | *P | |
+ +----+----+----+----+----+----+----+----+
+6 | | | | *B | | *N | | *P |
+ +----+----+----+----+----+----+----+----+
+5 | | | | *P | N | Q | | |
+ +----+----+----+----+----+----+----+----+
+4 | | | *P | P | | P | | |
+ +----+----+----+----+----+----+----+----+
+3 | | | N | | P | | | |
+ +----+----+----+----+----+----+----+----+
+2 | P | P | | | | | P | P |
+ +----+----+----+----+----+----+----+----+
+1 | | K | | R | R | | | |
+ +----+----+----+----+----+----+----+----+
+
+ a b c d e f g h
+
+EPD: 1k1r3r/pp2qpp1/3b1n1p/3pNQ2/2pP1P2/2N1P3/PP4PP/1K1RR3 b - - bm Bb4; id "LCT2-POS-02";
+
+Searching to 11 ply
+Middlegame phase.
+Time for move : 1000000
+ 2 -0.39 361 Ka8 e4
+ 2 -0.38 476 Bb4 !
+ 2 -0.29 956 Bb4 Qc2
+ 3 0.00 1348 Bb4 Qc2 Ka8
+ 3 0.00 1600 Bb4 Qc2 Ka8
+ 4 0.02 3394 Bb4 Qc2 Ka8 g4
+ 4 0.02 4026 Bb4 Qc2 Ka8 g4
+ 5 0.12 11880 Bb4 Qc2 Ka8 g4 Rhe8
+ 5 0.12 14615 Bb4 Qc2 Ka8 g4 Rhe8
+ 6 0.07 25013 Bb4 Qc2 Ka8 g4 Qe6 h3
+ 6 0.07 30237 Bb4 Qc2 Ka8 g4 Qe6 h3
+ 7 0.16 77597 Bb4 Qc2 Ka8 h3 Rhe8 g3 Qc7
+ 7 0.16 81580 Bb4 Qc2 Ka8 h3 Rhe8 g3 Qc7
+ 8 0.12 149727 Bb4 Qc2 Ka8 g4 h5 g5 Ng4 h4 Nxe5 dxe5
+ 8 0.12 169056 Bb4 Qc2 Ka8 g4 h5 g5 Ng4 h4 Nxe5 dxe5
+ 9 0.12 363431 Bb4 Qc2 Ka8 g4 h5 g5 Ng4 h4 Nxe5
+ 9 0.12 381811 Bb4 Qc2 Ka8 g4 h5 g5 Ng4 h4 Nxe5
+10 0.12 677790 Bb4 Qc2 Ka8 g4 h5 g5 Ng4 h4 Nxe5 dxe5
+10 0.12 799981 Bb4 Qc2 Ka8 g4 h5 g5 Ng4 h4 Nxe5 dxe5
+11 0.13 1863182 Bb4 Qc2 Ka8 g4 h5 g5 Ng4 g6 Bxc3 Qxc3 fxg6 Nxg6
+11 0.13 1939268 Bb4 Qc2 Ka8 g4 h5 g5 Ng4 g6 Bxc3 Qxc3 fxg6 Nxg6
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2006/462.libquantum/462.libquantum.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2006/462.libquantum/462.libquantum.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2006/462.libquantum/462.libquantum.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2006/462.libquantum/462.libquantum.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,6 @@
+N = 143, 41 qubits required
+Random seed: 25
+Measured 16384 (0.500000), fractional approximation is 1/2.
+Possible period is 2.
+143 = 13 * 11
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2006/464.h264ref/464.h264ref.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2006/464.h264ref/464.h264ref.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2006/464.h264ref/464.h264ref.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2006/464.h264ref/464.h264ref.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,83 @@
+Setting Default Parameters...
+Parsing Configfile foreman_test_encoder_baseline.cfg.....................................................................................................
+
+------------------------------- JM 9.3 (FRExt) --------------------------------
+ Input YUV file : foreman_qcif.yuv
+ Output H.264 bitstream : foreman_qcif.264
+ YUV Format : YUV 4:2:0
+ Frames to be encoded I-P/B : 25/0
+ PicInterlace / MbInterlace : 0/0
+ Transform8x8Mode : 0
+-------------------------------------------------------------------------------
+ Frame Bit/pic WP QP SnrY SnrU SnrV Time(ms) MET(ms) Frm/Fld I D
+-------------------------------------------------------------------------------
+0000(NVB) 176
+0000(IDR) 21952 0 28 37.383 41.260 42.850 0 0 FRM 99
+0001(P) 3024 0 28 36.868 41.036 42.720 0 0 FRM 0
+0002(P) 4120 0 28 36.875 40.936 42.683 0 0 FRM 2
+0003(P) 4552 0 28 36.851 40.950 42.670 0 0 FRM 2
+0004(P) 4944 0 28 36.848 40.815 42.407 0 0 FRM 2
+0005(P) 4448 0 28 36.775 40.691 42.386 0 0 FRM 1
+0006(P) 3944 0 28 36.689 40.740 42.206 0 0 FRM 1
+0007(P) 4040 0 28 36.698 40.821 42.262 0 0 FRM 0
+0008(P) 4104 0 28 36.751 40.824 42.114 0 0 FRM 0
+0009(P) 4576 0 28 36.724 40.773 41.954 0 0 FRM 1
+0010(P) 4504 0 28 36.701 40.618 41.919 0 0 FRM 1
+0011(P) 4120 0 28 36.695 40.745 41.882 0 0 FRM 0
+0012(P) 5120 0 28 36.709 40.792 42.289 0 0 FRM 0
+0013(P) 5680 0 28 36.651 40.754 42.503 0 0 FRM 1
+0014(P) 5784 0 28 36.617 40.751 42.436 0 0 FRM 1
+0015(P) 5528 0 28 36.598 40.758 42.418 0 0 FRM 0
+0016(P) 4608 0 28 36.413 40.683 42.375 0 0 FRM 0
+0017(P) 4384 0 28 36.410 40.609 42.341 0 0 FRM 0
+0018(P) 3840 0 28 36.437 40.610 42.225 0 0 FRM 2
+0019(P) 3432 0 28 36.484 40.704 42.084 0 0 FRM 0
+0020(P) 3048 0 28 36.505 40.650 42.206 0 0 FRM 0
+0021(P) 3304 0 28 36.571 40.518 42.277 0 0 FRM 1
+0022(P) 3880 0 28 36.568 40.456 42.220 0 0 FRM 1
+0023(P) 3640 0 28 36.518 40.410 42.155 0 0 FRM 2
+0024(P) 3928 0 28 36.469 40.600 42.122 0 0 FRM 0
+-------------------------------------------------------------------------------
+ Total Frames: 25 (25)
+ Leaky BucketRateFile does not have valid entries;
+ using rate calculated from avg. rate
+ Number Leaky Buckets: 8
+ Rmin Bmin Fmin
+ 149400 21952 21952
+ 186750 21952 21952
+ 224100 21952 21952
+ 261450 21952 21952
+ 298800 21952 21952
+ 336150 21952 21952
+ 373500 21952 21952
+ 410850 21952 21952
+-------------------------------------------------------------------------------
+ Freq. for encoded bitstream : 30
+ Hadamard transform : Used
+ Image format : 176x144
+ Error robustness : Off
+ Search range : 16
+ Total number of references : 10
+ References for P slices : 10
+ Total encoding time for the seq. : 0.000 sec
+ Total ME time for sequence : 0.000 sec
+ Sequence type : IPPP (QP: I 28, P 28)
+ Entropy coding method : CAVLC
+ Profile/Level IDC : (66,30)
+ Search range restrictions : none
+ RD-optimized mode decision : used
+ Data Partitioning Mode : 1 partition
+ Output File Format : H.264 Bit Stream File Format
+ Residue Color Transform : not used
+------------------ Average data all frames -----------------------------------
+ SNR Y(dB) : 36.67
+ SNR U(dB) : 40.74
+ SNR V(dB) : 42.31
+ Total bits : 124680 (I 21952, P 102552, NVB 176)
+ Bit rate (kbit/s) @ 30.00 Hz : 149.62
+ Bits to avoid Startcode Emulation : 0
+ Bits for parameter sets : 176
+-------------------------------------------------------------------------------
+Exit JM 9 (FRExt) encoder ver 9.3
+exit 0
+\ No newline at end of file
Added: test-suite/trunk/External/SPEC/CINT2006/471.omnetpp/471.omnetpp.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2006/471.omnetpp/471.omnetpp.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2006/471.omnetpp/471.omnetpp.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2006/471.omnetpp/471.omnetpp.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,124 @@
+OMNeT++ Discrete Event Simulation (C) 1992-2003 Andras Varga
+See the license for distribution terms and warranty disclaimer
+Setting up Cmdenv (command-line user interface)...
+
+Preparing for Run #1...
+Setting up network `twoHosts'...
+Running simulation...
+twoHosts.hostA.srv registering DSAP 241
+twoHosts.hostB.srv registering DSAP 241
+twoHosts.hostA.cli registering DSAP 240
+twoHosts.hostB.cli registering DSAP 240
+** Event #0 T=0.0000000 ( 0.00s)
+ Messages: created: 20
+** Event #100000 T=14.836799 (14.83s)
+ Messages: created: 48540
+** Event #200000 T=29.571801 (29.57s)
+ Messages: created: 97064
+** Event #300000 T=44.401886 (44.40s)
+ Messages: created: 145570
+** Event #400000 T=59.434241 (59.43s)
+ Messages: created: 194096
+** Event #500000 T=74.211485 ( 1m 14s)
+ Messages: created: 242608
+** Event #600000 T=89.306257 ( 1m 29s)
+ Messages: created: 291116
+** Event #700000 T=103.92283 ( 1m 43s)
+ Messages: created: 339640
+** Event #800000 T=119.27061 ( 1m 59s)
+ Messages: created: 388154
+** Event #900000 T=133.81414 ( 2m 13s)
+ Messages: created: 436666
+** Event #1000000 T=148.38048 ( 2m 28s)
+ Messages: created: 485196
+** Event #1100000 T=163.10847 ( 2m 43s)
+ Messages: created: 533702
+** Event #1200000 T=177.83484 ( 2m 57s)
+ Messages: created: 582219
+<!> Simulation time limit reached -- simulation stopped.
+
+Calling finish() at end of Run #1...
+
+End run of OMNeT++
+exit 0
+run 1 "twoHosts"
+scalar "twoHosts.hostA.cli" "packets sent" 18108
+scalar "twoHosts.hostA.cli" "packets rcvd" 56179
+scalar "twoHosts.hostA.cli" "end-to-end delay mean" 0.000291069198
+scalar "twoHosts.hostA.cli" "end-to-end delay stddev" 0.000177812406
+scalar "twoHosts.hostA.cli" "end-to-end delay min" 7.21999999e-06
+scalar "twoHosts.hostA.cli" "end-to-end delay max" 0.00148376281
+scalar "twoHosts.hostA.srv" "packets sent" 55000
+scalar "twoHosts.hostA.srv" "packets rcvd" 17889
+scalar "twoHosts.hostA.srv" "end-to-end delay mean" 6.98432319e-05
+scalar "twoHosts.hostA.srv" "end-to-end delay stddev" 6.16260191e-05
+scalar "twoHosts.hostA.srv" "end-to-end delay min" 7.77999999e-06
+scalar "twoHosts.hostA.srv" "end-to-end delay max" 0.00103038042
+scalar "twoHosts.hostA.llc" "dsaps registered" 2
+scalar "twoHosts.hostA.llc" "packets from higher layer" 73108
+scalar "twoHosts.hostA.llc" "frames from MAC" 74068
+scalar "twoHosts.hostA.llc" "packets passed up" 74068
+scalar "twoHosts.hostA.llc" "packets dropped - unknown DSAP" 0
+scalar "twoHosts.hostA.mac" "simulated time" 180.002956
+scalar "twoHosts.hostA.mac" "txrate (Mb)" 100
+scalar "twoHosts.hostA.mac" "full duplex" 1
+scalar "twoHosts.hostA.mac" "rx channel idle (%)" 96.2052369
+scalar "twoHosts.hostA.mac" "rx channel utilization (%)" 3.79476305
+scalar "twoHosts.hostA.mac" "rx channel collision (%)" 0
+scalar "twoHosts.hostA.mac" "frames sent" 73108
+scalar "twoHosts.hostA.mac" "frames rcvd" 74068
+scalar "twoHosts.hostA.mac" "bytes sent" 83349638
+scalar "twoHosts.hostA.mac" "bytes rcvd" 84791027
+scalar "twoHosts.hostA.mac" "frames from higher layer" 73108
+scalar "twoHosts.hostA.mac" "frames from higher layer dropped (queue full)" 0
+scalar "twoHosts.hostA.mac" "frames dropped (bit error)" 0
+scalar "twoHosts.hostA.mac" "frames dropped (not for us)" 0
+scalar "twoHosts.hostA.mac" "frames passed up to HL" 74068
+scalar "twoHosts.hostA.mac" "PAUSE frames sent" 0
+scalar "twoHosts.hostA.mac" "PAUSE frames rcvd" 0
+scalar "twoHosts.hostA.mac" "collisions" 0
+scalar "twoHosts.hostA.mac" "backoffs" 0
+scalar "twoHosts.hostA.mac" "frames/sec sent" 406.148885
+scalar "twoHosts.hostA.mac" "frames/sec rcvd" 411.482131
+scalar "twoHosts.hostA.mac" "bits/sec sent" 3704367.51
+scalar "twoHosts.hostA.mac" "bits/sec rcvd" 3768428.2
+scalar "twoHosts.hostB.cli" "packets sent" 17890
+scalar "twoHosts.hostB.cli" "packets rcvd" 55000
+scalar "twoHosts.hostB.cli" "end-to-end delay mean" 0.000290338354
+scalar "twoHosts.hostB.cli" "end-to-end delay stddev" 0.000179494988
+scalar "twoHosts.hostB.cli" "end-to-end delay min" 7.21999999e-06
+scalar "twoHosts.hostB.cli" "end-to-end delay max" 0.00170524069
+scalar "twoHosts.hostB.srv" "packets sent" 56179
+scalar "twoHosts.hostB.srv" "packets rcvd" 18108
+scalar "twoHosts.hostB.srv" "end-to-end delay mean" 6.91105286e-05
+scalar "twoHosts.hostB.srv" "end-to-end delay stddev" 5.82791727e-05
+scalar "twoHosts.hostB.srv" "end-to-end delay min" 7.77999999e-06
+scalar "twoHosts.hostB.srv" "end-to-end delay max" 0.00113029787
+scalar "twoHosts.hostB.llc" "dsaps registered" 2
+scalar "twoHosts.hostB.llc" "packets from higher layer" 74068
+scalar "twoHosts.hostB.llc" "frames from MAC" 73108
+scalar "twoHosts.hostB.llc" "packets passed up" 73108
+scalar "twoHosts.hostB.llc" "packets dropped - unknown DSAP" 0
+scalar "twoHosts.hostB.mac" "simulated time" 180.002956
+scalar "twoHosts.hostB.mac" "txrate (Mb)" 100
+scalar "twoHosts.hostB.mac" "full duplex" 1
+scalar "twoHosts.hostB.mac" "rx channel idle (%)" 96.269639
+scalar "twoHosts.hostB.mac" "rx channel utilization (%)" 3.73036104
+scalar "twoHosts.hostB.mac" "rx channel collision (%)" 0
+scalar "twoHosts.hostB.mac" "frames sent" 74068
+scalar "twoHosts.hostB.mac" "frames rcvd" 73108
+scalar "twoHosts.hostB.mac" "bytes sent" 84791027
+scalar "twoHosts.hostB.mac" "bytes rcvd" 83349638
+scalar "twoHosts.hostB.mac" "frames from higher layer" 74068
+scalar "twoHosts.hostB.mac" "frames from higher layer dropped (queue full)" 0
+scalar "twoHosts.hostB.mac" "frames dropped (bit error)" 0
+scalar "twoHosts.hostB.mac" "frames dropped (not for us)" 0
+scalar "twoHosts.hostB.mac" "frames passed up to HL" 73108
+scalar "twoHosts.hostB.mac" "PAUSE frames sent" 0
+scalar "twoHosts.hostB.mac" "PAUSE frames rcvd" 0
+scalar "twoHosts.hostB.mac" "collisions" 0
+scalar "twoHosts.hostB.mac" "backoffs" 0
+scalar "twoHosts.hostB.mac" "frames/sec sent" 411.482131
+scalar "twoHosts.hostB.mac" "frames/sec rcvd" 406.148885
+scalar "twoHosts.hostB.mac" "bits/sec sent" 3768428.2
+scalar "twoHosts.hostB.mac" "bits/sec rcvd" 3704367.51
Added: test-suite/trunk/External/SPEC/CINT2006/473.astar/473.astar.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2006/473.astar/473.astar.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2006/473.astar/473.astar.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2006/473.astar/473.astar.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,41 @@
+Small Path Finding Library
+Read configuration file
+Create ways
+lake.bin
+Create regional map time : 0
+
+Create ways time : 0
+Ways quantity : 2318
+Total way length : 607363
+
+Create reg ways time : 0
+Reg ways quantity : 21248
+Total reg way length : 1005982
+
+Create river ways time : 0
+River ways quantity : 250
+Total river way length : 39000
+Create land ways time : 0
+Land ways quantity : 250
+Total land way length : 54956
+
+Create ways
+Random map
+Create regional map time : 0
+
+Create ways time : 0
+Ways quantity : 3875
+Total way length : 612234
+
+Create reg ways time : 0
+Reg ways quantity : 29220
+Total reg way length : 1009379
+
+Create river ways time : 0
+River ways quantity : 0
+Total river way length : 0
+Create land ways time : 0
+Land ways quantity : 0
+Total land way length : 0
+
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2006/483.xalancbmk/483.xalancbmk.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2006/483.xalancbmk/483.xalancbmk.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2006/483.xalancbmk/483.xalancbmk.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT2006/483.xalancbmk/483.xalancbmk.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,419 @@
+<html xmlns:spec="http://www.schemaTest.org/100mb">
+<body>
+<h3>Country: africa</h3>
+<table border="1">
+<tr>
+<th>Item</th><th>Name</th><th>Location</th><th>Quantity</th><th>Payment</th><th>Description</th><th>Shipping</th><th>Mailing</th>
+</tr>
+<tr valign="top">
+<td>item0</td><td>duteous nine eighteen </td><td>United States</td><td>1</td><td>Creditcard</td><td>(0)
+ page rous lady idle authority capt professes stabs monster petition heave humbly removes rescue runs shady peace most piteous worser oak assembly holes patience but malice whoreson mirrors master tenants smocks yielded <i> officer embrace such fears distinction attires </i>
+ <p>Encrypted Version</p>
+ seritta noitcnitsid sraef hcus ecarbme reciffo dedleiy skcoms stnanet retsam srorrim noserohw ecilam tub ecneitap seloh ylbmessa kao resrow suoetip tsom ecaep ydahs snur eucser sevomer ylbmuh evaeh noititep retsnom sbats sesseforp tpac ytirohtua eldi ydal suor egap
+<br>
+<br>(I)
+ shepherd noble supposed dotage humble servilius bitch theirs venus dismal wounds gum merely raise red breaks earth god folds closet captain dying reek
+ <p>Encrypted Version</p>
+ keer gniyd niatpac tesolc sdlof dog htrae skaerb der esiar ylerem mug sdnuow lamsid sunev srieht hctib suilivres elbmuh egatod desoppus elbon drehpehs
+<br>
+<br>
+</td><td>Will ship internationally, See description for charges</td><td>
+<p>
+<b>To: </b>Mechthild Renear <a href="mailto:Renear at acm.org">Renear at acm.org</a>
+<br>
+<b>From: </b>Dominic Takano <a href="mailto:Takano at yahoo.com">Takano at yahoo.com</a>
+<br>
+<b>Date: </b>10/12/1999<br>
+<b>Note: </b>
+<br>
+ asses scruple learned crowns preventions half whisper logotype weapons doors factious already pestilent sacks dram atwain girdles deserts flood park lest graves discomfort sinful conceiv therewithal motion stained preventions greatly suit observe sinews enforcement <emph> armed </emph> gold gazing set almost catesby turned servilius cook doublet preventions shrunk
+ <p>Encrypted Version</p>
+ knurhs snoitneverp telbuod kooc suilivres denrut ybsetac tsomla tes gnizag dlog demra tnemecrofne swenis evresbo tius yltaerg snoitneverp deniats noitom lahtiwereht viecnoc lufnis trofmocsid sevarg tsel krap doolf stresed seldrig niawta mard skcas tnelitsep ydaerla suoitcaf srood snopaew epytogol repsihw flah snoitneverp snworc denrael elpurcs sessa
+</p>
+</td>
+</tr>
+</table>
+<h3>Stats on this continent</h3>
+<table border="1">
+<tr valign="top">
+<td>Number of nodes in this continent:</td><td>Categories Listed</td><td>Total Quantities</td>
+</tr>
+<tr valign="top">
+<td>1</td><td>
+<br>(0) category0<br>
+<br>(I) category0<br>
+<br>(II) category0<br>
+<br>(III) category0<br>
+<br>(IV) category0<br>
+</td><td>1</td>
+</tr>
+</table>
+<h3>Country: asia</h3>
+<table border="1">
+<tr>
+<th>Item</th><th>Name</th><th>Location</th><th>Quantity</th><th>Payment</th><th>Description</th><th>Shipping</th><th>Mailing</th>
+</tr>
+<tr valign="top">
+<td>item1</td><td>great </td><td>United States</td><td>1</td><td>Money order, Cash</td><td></td><td>Will ship internationally</td><td>
+<p>
+<b>To: </b>Lanju Takano <a href="mailto:Takano at itc.it">Takano at itc.it</a>
+<br>
+<b>From: </b>Fumitaka Cenzer <a href="mailto:Cenzer at savera.com">Cenzer at savera.com</a>
+<br>
+<b>Date: </b>02/24/2000<br>
+<b>Note: </b>
+<br>
+ entreaty hath fowl prescience bounds roof fiend intellect boughs caught add jests feelingly doubt trojans wisdom greatness tune worship doors fields reads canst france pay progeny wisdom stir mov impious promis clothes hangman trebonius choose men fits preparation <i> benefit since eclipse gates </i>
+ <p>Encrypted Version</p>
+ setag espilce ecnis tifeneb noitaraperp stif nem esoohc suinobert namgnah sehtolc simorp suoipmi vom rits modsiw ynegorp yap ecnarf tsnac sdaer sdleif srood pihsrow enut ssentaerg modsiw snajort tbuod ylgnileef stsej dda thguac shguob tcelletni dneif foor sdnuob ecneicserp lwof htah ytaertne
+</p>
+<p>
+<b>To: </b>Ioana Blumberg <a href="mailto:Blumberg at conclusivestrategies.com">Blumberg at conclusivestrategies.com</a>
+<br>
+<b>From: </b>Papa Godskesen <a href="mailto:Godskesen at uwindsor.ca">Godskesen at uwindsor.ca</a>
+<br>
+<b>Date: </b>08/02/2001<br>
+<b>Note: </b>
+<br>
+ jealousy back greg folded gauntlets conduct hardness across sickness peter enough royal herb embrace piteous die servilius avoid <i> laying chance dungeons pleasant thyself fellow purse steward heaven ambassador terrible doubtfully </i> milk sky clouds unbraced put sacrifices seas childish longer flout heavy pitch rosalind orderly music delivery appease
+ <p>Encrypted Version</p>
+ esaeppa yreviled cisum ylredro dnilasor hctip yvaeh tuolf regnol hsidlihc saes secifircas tup decarbnu sduolc yks klim ylluftbuod elbirret rodassabma nevaeh drawets esrup wollef flesyht tnasaelp snoegnud ecnahc gniyal diova suilivres eid suoetip ecarbme breh layor hguone retep ssenkcis ssorca ssendrah tcudnoc steltnuag dedlof gerg kcab ysuolaej
+</p>
+</td>
+</tr>
+</table>
+<h3>Stats on this continent</h3>
+<table border="1">
+<tr valign="top">
+<td>Number of nodes in this continent:</td><td>Categories Listed</td><td>Total Quantities</td>
+</tr>
+<tr valign="top">
+<td>1</td><td>
+<br>(0) category0<br>
+<br>(I) category0<br>
+<br>(II) category0<br>
+<br>(III) category0<br>
+<br>(IV) category0<br>
+<br>(V) category0<br>
+</td><td>1</td>
+</tr>
+</table>
+<h3>Country: australia</h3>
+<table border="1">
+<tr>
+<th>Item</th><th>Name</th><th>Location</th><th>Quantity</th><th>Payment</th><th>Description</th><th>Shipping</th><th>Mailing</th>
+</tr>
+<tr valign="top">
+<td>item2</td><td>scarce brook </td><td>United States</td><td>1</td><td></td><td>(0)
+ senses concave valiant star further instruments bankrupts countrymen horrid costard youth necessity tend curiously waken witness navy there honest interest perceive defendant chief traffic where nuptial descent travel prepare agreed voices swears remember peerless doing <i> preparation rejoice </i>
+ <p>Encrypted Version</p>
+ eciojer noitaraperp gniod sselreep rebmemer sraews seciov deerga eraperp levart tnecsed laitpun erehw ciffart feihc tnadnefed eviecrep tseretni tsenoh ereht yvan ssentiw nekaw ylsuoiruc dnet ytissecen htuoy dratsoc dirroh nemyrtnuoc stpurknab stnemurtsni rehtruf rats tnailav evacnoc sesnes
+<br>
+<br>(I)
+ swear canker barbarian parching coxcomb excess conspiring nobles sounded consider sayings fishified prime may spirit <emph> untruths misgives choughs mew here garments tenfold </emph> error discontent hung beatrice straight muse shame deep twice mann maecenas any conveyance fingers whereupon child case <i> season presently victory women beating </i> deprive almost wed dreams slew reveal
+ <p>Encrypted Version</p>
+ laever wels smaerd dew tsomla evirped gnitaeb nemow yrotciv yltneserp nosaes esac dlihc nopuerehw sregnif ecnayevnoc yna saneceam nnam eciwt peed emahs esum thgiarts ecirtaeb gnuh tnetnocsid rorre dlofnet stnemrag ereh wem shguohc sevigsim shturtnu tirips yam emirp deifihsif sgniyas redisnoc dednuos selbon gniripsnoc ssecxe bmocxoc gnihcrap nairabrab reknac raews
+<br>
+<br>(II)
+ spotted attend burden camillo field enlarge stead corporal ground tormenting <b> naturally sanctuary riddle exile coming awake senseless chance famous albans </b> service cricket limb from clouds amongst shore penker defend quantity dumb churlish uncover swung eros figur sulphur sky birth stare negligent unction shield instance ambition gate injury fort put infants find slavish hugh see afterwards slanders chides eyes minds alb loved endure combating voyage
+ <p>Encrypted Version</p>
+ egayov gnitabmoc erudne devol bla sdnim seye sedihc srednals sdrawretfa ees hguh hsivals dnif stnafni tup trof yrujni etag noitibma ecnatsni dleihs noitcnu tnegilgen erats htrib yks ruhplus rugif sore gnuws revocnu hsilruhc bmud ytitnauq dnefed reknep erohs tsgnoma sduolc morf bmil tekcirc ecivres snabla suomaf ecnahc sselesnes ekawa gnimoc elixe elddir yrautcnas yllarutan gnitnemrot dnuorg laroproc daets egralne dleif ollimac nedrub dnetta dettops
+<br>
+<br>(III) <p>Encrypted Version</p>
+<br>
+<br>(IV) <p>Encrypted Version</p>
+<br>
+<br>
+</td><td>Will ship internationally</td><td>
+<p>
+<b>To: </b>Lesley Jeris <a href="mailto:Jeris at zambeel.com">Jeris at zambeel.com</a>
+<br>
+<b>From: </b>Aspi L'Ecuyer <a href="mailto:L'Ecuyer at intersys.com">L'Ecuyer at intersys.com</a>
+<br>
+<b>Date: </b>10/09/1998<br>
+<b>Note: </b>
+<br>
+ necessities chains rosencrantz house heed course lawn diest unvirtuous supposed sees chough swor numbers game roman soundest wrestler sky lodovico beast shivers desolate norfolk forgot paulina wars george while beggar sheath thursday capable presently his protector father orchard enemies believe drains tokens prison charge cloud stab york mild scene true devotion confidence hundred those guiltless pricks sort himself mutiny officers directive wholesome edge acts dion ride draw brings custom chapless beside sex dowry casca goods priam blasphemy prick octavia brain curer thinkest idiot inward missing conspiracy tents scab inundation caesar officer dramatis
+ <p>Encrypted Version</p>
+ sitamard reciffo raseac noitadnuni bacs stnet ycaripsnoc gnissim drawni toidi tsekniht reruc niarb aivatco kcirp ymehpsalb mairp sdoog acsac yrwod xes ediseb sselpahc motsuc sgnirb ward edir noid stca egde emoselohw evitcerid sreciffo ynitum flesmih tros skcirp sseltliug esoht derdnuh ecnedifnoc noitoved eurt enecs dlim kroy bats duolc egrahc nosirp snekot sniard eveileb seimene drahcro rehtaf rotcetorp sih yltneserp elbapac yadsruht htaehs raggeb elihw egroeg sraw aniluap togrof klofron etalosed srevihs tsaeb ocivodol yks reltserw tsednuos namor emag srebmun rows hguohc sees desoppus suoutrivnu tseid nwal esruoc deeh esuoh ztnarcnesor sniahc seitissecen
+</p>
+</td>
+</tr>
+</table>
+<h3>Stats on this continent</h3>
+<table border="1">
+<tr valign="top">
+<td>Number of nodes in this continent:</td><td>Categories Listed</td><td>Total Quantities</td>
+</tr>
+<tr valign="top">
+<td>1</td><td>
+<br>(0) category0<br>
+<br>(I) category0<br>
+</td><td>1</td>
+</tr>
+</table>
+<h3>Country: europe</h3>
+<table border="1">
+<tr>
+<th>Item</th><th>Name</th><th>Location</th><th>Quantity</th><th>Payment</th><th>Description</th><th>Shipping</th><th>Mailing</th>
+</tr>
+<tr valign="top">
+<td>item3</td><td>abhorr execution beckon rue </td><td>Uzbekistan</td><td>1</td><td>Money order, Creditcard, Cash</td><td>(0)
+ <i> perjur kills insanie unfortunate conjuration deeper confounded belied first guard </i> pale profits height desir ashore france strength kept entrench poisons worth fought ignorance moody poniards speaks jack egg offspring victory food double emperor round jewel abbey apparel untainted lass protest start wings acquit lake lady battles further low thief try brook cake mounted officers dean shrunk lowness dew sandy prologue armies suspicion eighty advance thankfulness albany ended experience halt doubted wert kingdom fiend directed pair perhaps
+ <p>Encrypted Version</p>
+ spahrep riap detcerid dneif modgnik trew detbuod tlah ecneirepxe dedne ynabla ssenlufknaht ecnavda ythgie noicipsus seimra eugolorp ydnas wed ssenwol knurhs naed sreciffo detnuom ekac koorb yrt feiht wol rehtruf selttab ydal ekal tiuqca sgniw trats tsetorp ssal detniatnu lerappa yebba lewej dnuor rorepme elbuod doof yrotciv gnirpsffo gge kcaj skaeps sdrainop ydoom ecnarongi thguof htrow snosiop hcnertne tpek htgnerts ecnarf erohsa rised thgieh stiforp elap draug tsrif deileb dednuofnoc repeed noitarujnoc etanutrofnu einasni sllik rujrep
+<br>
+<br>(I)
+ prayer odds rend condemn conrade swearing dispos losses boar little from thought different couch respected human robe dictynna later pays edward babe distemper bards damned mayst sustain while self alcibiades listen weak soil <i> view presume loggets feed </i> afoot yields erection balthasar fathers datchet thankless lear cause evil cheerfully instance tarried because cough ancient testimony tarquin cousin reported porter beastly jade bark sex slack lear devil devoured amiable mason moss shoulders labour meanest feign eggs encount forbid enobarbus halters nam emilia fiends bearing food inheritor wiser <emph> hedge </emph> functions there capital greasy dark crush your sequest between devout thou strikes demand dost reverent conference least told ado modena jealousy nunnery mistrust nightly worthy closes tall proudly fierce receive nearness safer jacks shut dire mates wind unfortunate monsieur parcels sauced extremities throat dog empty treasury etc detested stand taxatio
ns edges mourner sue knavery unlook perseus diadem heartily peer tut compounded art reconcile study thought cockatrice money pity intend thing claud edmund throws torments ropes contrive story slain advise lecher ardea relics keeping treads buckingham defences lag neighbour ourself marshal disordered moderate venus afeard article rot hazards craft crowns <emph> plainness patient </emph> lying knowledge diseases meritorious medicine instead lid happy without them bands answer
+ <p>Encrypted Version</p>
+ rewsna sdnab meht tuohtiw yppah dil daetsni enicidem suoirotirem sesaesid egdelwonk gniyl tneitap ssennialp snworc tfarc sdrazah tor elcitra draefa sunev etaredom deredrosid lahsram flesruo ruobhgien gal secnefed mahgnikcub sdaert gnipeek sciler aedra rehcel esivda nials yrots evirtnoc sepor stnemrot sworht dnumde dualc gniht dnetni ytip yenom ecirtakcoc thguoht yduts elicnocer tra dednuopmoc tut reep ylitraeh medaid suesrep koolnu yrevank eus renruom segde snoitaxat dnats detseted cte yrusaert ytpme god taorht seitimertxe decuas slecrap rueisnom etanutrofnu dniw setam erid tuhs skcaj refas ssenraen eviecer ecreif ylduorp llat sesolc yhtrow ylthgin tsurtsim yrennun ysuolaej anedom oda dlot tsael ecnerefnoc tnerever tsod dnamed sekirts uoht tuoved neewteb tseuqes ruoy hsurc krad ysaerg latipac ereht snoitcnuf egdeh resiw rotirehni doof gniraeb sdneif ailime man sretlah subrabone dibrof tnuocne sgge ngief tsenaem ruobal sredluohs ssom nosam elbaima deruoved lived rael kca
ls xes krab edaj yltsaeb retrop detroper nisuoc niuqrat ynomitset tneicna hguoc esuaceb deirrat ecnatsni yllufreehc live esuac rael sselknaht tehctad srehtaf rasahtlab noitcere sdleiy toofa deef steggol emuserp weiv lios kaew netsil sedaibicla fles elihw niatsus tsyam denmad sdrab repmetsid ebab drawde syap retal annytcid ebor namuh detcepser hcuoc tnereffid thguoht morf elttil raob sessol sopsid gniraews edarnoc nmednoc dner sddo reyarp
+<br>
+<br>
+</td><td>Will ship only within country</td><td></td>
+</tr>
+</table>
+<h3>Stats on this continent</h3>
+<table border="1">
+<tr valign="top">
+<td>Number of nodes in this continent:</td><td>Categories Listed</td><td>Total Quantities</td>
+</tr>
+<tr valign="top">
+<td>1</td><td>
+<br>(0) category0<br>
+<br>(I) category0<br>
+<br>(II) category0<br>
+<br>(III) category0<br>
+<br>(IV) category0<br>
+<br>(V) category0<br>
+<br>(VI) category0<br>
+<br>(VII) category0<br>
+</td><td>1</td>
+</tr>
+</table>
+<h3>Country: namerica</h3>
+<table border="1">
+<tr>
+<th>Item</th><th>Name</th><th>Location</th><th>Quantity</th><th>Payment</th><th>Description</th><th>Shipping</th><th>Mailing</th>
+</tr>
+<tr valign="top">
+<td>item4</td><td>unsur brutish </td><td>United States</td><td>1</td><td>Money order, Creditcard</td><td>(0)
+ prepar likelihood eagle body walk borachio month writing left speed patents coach through protectorship congruent confusion favours following populous garden henceforth shoots function fourscore mangled favorably slain secretly vice distinguish bardolph content hence boy worse bring usurers stew beard longed creep hid pursuivant beholders senators son mercutio woo bestow trumpet excess muffler pick ugly felt causes remove adding tear often rounds underbearing tree purer kibes endless women benefit throw <emph> claim firmness <i> arrived sees wrestled multitude repent preventions infamy reproof shalt hearted prais knave doubtless </i> deny </emph> merely grave voluble late loath digest horn slave hunger stronger amazed salt killing ross cry dry tongue kiss yields auspicious quietness perpetual ways
+ <p>Encrypted Version</p>
+ syaw lauteprep ssenteiuq suoicipsua sdleiy ssik eugnot yrd yrc ssor gnillik tlas dezama regnorts regnuh evals nroh tsegid htaol etal elbulov evarg ylerem yned sseltbuod evank siarp detraeh tlahs foorper ymafni snoitneverp tneper edutitlum deltserw sees devirra ssenmrif mialc worht tifeneb nemow sseldne sebik rerup eert gniraebrednu sdnuor netfo raet gnidda evomer sesuac tlef ylgu kcip relffum ssecxe tepmurt wotseb oow oitucrem nos srotanes sredloheb tnaviusrup dih peerc degnol draeb wets srerusu gnirb esrow yob ecneh tnetnoc hplodrab hsiugnitsid eciv ylterces nials ylbarovaf delgnam erocsruof noitcnuf stoohs htrofecneh nedrag suolupop gniwollof sruovaf noisufnoc tneurgnoc pihsrotcetorp hguorht hcaoc stnetap deeps tfel gnitirw htnom oihcarob klaw ydob elgae doohilekil raperp
+<br>
+<br>(I)
+ court mean returning brook creatures appointed paunches henry sights west prunes flutes regiment seems bed musicians slumber post friendship prevention abreast wouldst words vexation builds unfelt holly walk inform moods deck bulk begin action school nobles antique people unkennel stomach into petitions jack assail yongrey ages betimes golden sink droop kernel hoppedance perfection weight <emph> whining safe english rod other featur </emph> betwixt orator across amiss mine guests guard yon willing remit longing goneril visitation honey
+ <p>Encrypted Version</p>
+ yenoh noitatisiv lirenog gnignol timer gnilliw noy draug stseug enim ssima ssorca rotaro txiwteb rutaef rehto dor hsilgne efas gninihw thgiew noitcefrep ecnadeppoh lenrek poord knis nedlog semiteb sega yergnoy liassa kcaj snoititep otni hcamots lenneknu elpoep euqitna selbon loohcs noitca nigeb klub kced sdoom mrofni klaw ylloh tlefnu sdliub noitaxev sdrow tsdluow tsaerba noitneverp pihsdneirf tsop rebmuls snaicisum deb smees tnemiger setulf senurp tsew sthgis yrneh sehcnuap detnioppa serutaerc koorb gninruter naem truoc
+<br>
+<br>
+</td><td>Will ship only within country, Buyer pays fixed shipping charges, See description for charges</td><td>
+<p>
+<b>To: </b>Maz Lucky <a href="mailto:Lucky at washington.edu">Lucky at washington.edu</a>
+<br>
+<b>From: </b>Honari Castan <a href="mailto:Castan at uni-muenchen.de">Castan at uni-muenchen.de</a>
+<br>
+<b>Date: </b>01/24/1998<br>
+<b>Note: </b>
+<br>
+ scene disposition substance prick counsel start temples
+ <p>Encrypted Version</p>
+ selpmet trats lesnuoc kcirp ecnatsbus noitisopsid enecs
+</p>
+</td>
+</tr>
+</table>
+<h3>Stats on this continent</h3>
+<table border="1">
+<tr valign="top">
+<td>Number of nodes in this continent:</td><td>Categories Listed</td><td>Total Quantities</td>
+</tr>
+<tr valign="top">
+<td>1</td><td>
+<br>(0) category0<br>
+<br>(I) category0<br>
+<br>(II) category0<br>
+</td><td>1</td>
+</tr>
+</table>
+<h3>Country: samerica</h3>
+<table border="1">
+<tr>
+<th>Item</th><th>Name</th><th>Location</th><th>Quantity</th><th>Payment</th><th>Description</th><th>Shipping</th><th>Mailing</th>
+</tr>
+<tr valign="top">
+<td>item5</td><td>nakedness </td><td>United States</td><td>1</td><td>Creditcard, Personal Check, Cash</td><td></td><td>Will ship only within country, Will ship internationally</td><td></td>
+</tr>
+</table>
+<h3>Stats on this continent</h3>
+<table border="1">
+<tr valign="top">
+<td>Number of nodes in this continent:</td><td>Categories Listed</td><td>Total Quantities</td>
+</tr>
+<tr valign="top">
+<td>1</td><td>
+<br>(0) category0<br>
+<br>(I) category0<br>
+<br>(II) category0<br>
+<br>(III) category0<br>
+</td><td>1</td>
+</tr>
+</table>
+<h3>Category List</h3>
+<table border="1">
+<tr>
+<th>Category #</th><th>Name</th><th>Description</th>
+</tr>
+<tr valign="top">
+<td>category0</td><td>dispatch reported dotard holofernes </td><td>(0)
+ shift carrion doubtful strangle sounding crowned troubled naked yesterday overthrow owe silent recount waters derive sans four
+ <p>Encrypted Version</p>
+ ruof snas evired sretaw tnuocer tnelis ewo worhtrevo yadretsey dekan delbuort denworc gnidnuos elgnarts luftbuod noirrac tfihs
+<br>
+<br>(I) <p>Encrypted Version</p>
+<br>
+<br>
+</td>
+</tr>
+</table>
+<h3>Customer Database</h3>
+<table border="1">
+<tr>
+<th>Id</th><th>Name</th><th>Email</th><th>Phone</th><th>homepage</th><th>Credit Card</th><th>Activity</th><th>Mailing</th><th>Income</th><th>Gender</th><th>Business</th><th>Age</th><th>Education></th>
+</tr>
+<tr valign="top">
+<td>person0</td><td>Jaak Tempesti</td><td><a href="mailto:Tempesti at labs.com">Tempesti at labs.com</a></td><td>+0 (873) 14873867</td><td><a href="http://www.labs.com/~Tempesti">http://www.labs.com/~Tempesti</a></td><td>5048 5813 2703 8253</td><td>(0) open_auction0<br>
+</td><td></td><td></td><td></td><td></td><td></td><td></td>
+</tr>
+<tr>
+<td><b>Totals</b></td><td><b>1</b></td><td>--</td><td>--</td><td>--</td><td>--</td><td>--</td><td>--</td><td><b>Ave: NaN</b></td><td><b># of Male: 0<br># of Female: 0</b></td><td><b># of Bus: 0</b></td><td><b>Ave: NaN</b></td><td>--</td>
+</tr>
+</table>
+<h2>Auctions Currently Open</h2>
+<p>
+<b>Item: </b>item0<br>
+<b>Seller: </b>person0<br>
+<b>Seller Rating: </b>6<br>
+<b>Description: </b>(I)
+ debauch corpse canons domain night forsake yea satisfy between fume were monsters ear players moreover ungentleness sorrows prouder tonight favours rome bastard unshown excellence journey loves swearing proceeds stone buck battle breathless kindness prophesy entomb urging rogues hector conquer provoke nothing raw wight places needy feasted romeo rivers worser occupation brook stoops brooch plucks level samp tent windsor rubs whereof beam signior built suff heavy dull husbands roman favour urge spear gone wolf cheeks execute resolv such horrid drives provide twice spoke trade friar taking pheasant sentenc scarf corrections brothers charge spur ass agamemnon truepenny saves roots practis impatient diest didest starv seeing beneath interpose gods home black forgot snuff dress dozen napkins <emph> countess northumberland headlong needless angry pleading </emph> better joy <emph> meagre </emph> reap enquire crab wales died violent rear past liberty <emph> braggart armour infe
r bankrupt winds teeth </emph> case wore pouch crows cognition <i> reports expedition free chief cressida hearsed </i> loath monuments silent congregation soon farm doct ross susan ready empty dedicate shilling whole soul foot beseech higher lifeless hay postmaster distress disposition <b> inherits </b> marcus betters pitch betray beam corse player quality ros conduct thersites greediness boast pilgrims startles contented belch hung thus captain early blood par brook jul gain needs above ensign grapes revelling glean thank
+ <p>Encrypted Version</p>
+ knaht naelg gnillever separg ngisne evoba sdeen niag luj koorb rap doolb ylrae niatpac suht gnuh hcleb detnetnoc seltrats smirglip tsaob ssenideerg setisreht tcudnoc sor ytilauq reyalp esroc maeb yarteb hctip sretteb sucram stirehni noitisopsid ssertsid retsamtsop yah sselefil rehgih hceeseb toof luos elohw gnillihs etacided ytpme ydaer nasus ssor tcod mraf noos noitagergnoc tnelis stnemunom htaol desraeh adisserc feihc eerf noitidepxe stroper noitingoc sworc hcuop erow esac hteet sdniw tpurknab refni ruomra traggarb ytrebil tsap raer tneloiv deid selaw barc eriuqne paer ergaem yoj retteb gnidaelp yrgna sseldeen gnoldaeh dnalrebmuhtron ssetnuoc snikpan nezod sserd ffuns togrof kcalb emoh sdog esopretni htaeneb gniees vrats tsedid tseid tneitapmi sitcarp stoor sevas ynnepeurt nonmemaga ssa rups egrahc srehtorb snoitcerroc fracs cnetnes tnasaehp gnikat rairf edart ekops eciwt edivorp sevird dirroh hcus vloser etucexe skeehc flow enog raeps egru ruovaf namor sdnabs
uh llud yvaeh ffus tliub roingis maeb foerehw sbur rosdniw tnet pmas level skculp hcoorb spoots koorb noitapucco resrow srevir oemor detsaef ydeen secalp thgiw war gnihton ekovorp reuqnoc rotceh seugor gnigru bmotne ysehporp ssendnik sselhtaerb elttab kcub enots sdeecorp gniraews sevol yenruoj ecnellecxe nwohsnu dratsab emor sruovaf thginot reduorp sworros sseneltnegnu revoerom sreyalp rae sretsnom erew emuf neewteb yfsitas aey ekasrof thgin niamod snonac esproc hcuabed
+<br>
+<br>
+<b>Opening bid: </b>13.56<br>
+<b>Current bid: </b>243.06<br>
+</p>
+<h3>Open Auction Activity: open_auction0</h3>
+<table border="1">
+<tr>
+<th>Date</th><th>Time</th><th>Bidder</th><th>Increment</th>
+</tr>
+<tr>
+<td>01/02/1998</td><td>22:18:07</td><td>person0</td><td>1.5</td>
+</tr>
+<tr>
+<td>04/01/1998</td><td>10:44:22</td><td>person0</td><td>7.5</td>
+</tr>
+<tr>
+<td>07/22/1998</td><td>10:34:11</td><td>person0</td><td>25.5</td>
+</tr>
+<tr>
+<td>07/12/1999</td><td>23:20:27</td><td>person0</td><td>13.5</td>
+</tr>
+<tr>
+<td>11/15/1999</td><td>14:23:15</td><td>person0</td><td>9</td>
+</tr>
+<tr>
+<td>02/14/2000</td><td>16:40:16</td><td>person0</td><td>19.5</td>
+</tr>
+<tr>
+<td>03/04/2000</td><td>20:46:15</td><td>person0</td><td>16.5</td>
+</tr>
+<tr>
+<td>08/12/2000</td><td>11:41:54</td><td>person0</td><td>3</td>
+</tr>
+<tr>
+<td>11/15/2000</td><td>15:53:40</td><td>person0</td><td>6</td>
+</tr>
+<tr>
+<td>05/09/2001</td><td>11:39:57</td><td>person0</td><td>30</td>
+</tr>
+<tr>
+<td>07/27/2001</td><td>12:36:50</td><td>person0</td><td>19.5</td>
+</tr>
+<tr>
+<td>09/28/2001</td><td>17:03:24</td><td>person0</td><td>6</td>
+</tr>
+<tr>
+<td>10/21/2001</td><td>01:19:47</td><td>person0</td><td>3</td>
+</tr>
+<tr>
+<td>10/22/2001</td><td>10:21:43</td><td>person0</td><td>55.5</td>
+</tr>
+<tr>
+<td>12/24/2001</td><td>16:46:32</td><td>person0</td><td>13.5</td>
+</tr>
+<tr>
+<td><b>Total Increase</b></td><td></td><td></td><td>229.5</td>
+</tr>
+</table>
+<h3>Closed Auction</h3>
+<table border="1">
+<tr>
+<th>Buyer</th><th>Seller</th><th>Item #</th><th>Price</th><th>Date</th><th>Quantity</th><th>Prev Bidder</th><th>Description</th><th>Satisfaction</th>
+</tr>
+<tr valign="top">
+<td>person0</td><td>person0</td><td>item2</td><td>96.92</td><td>12/05/2001</td><td>1</td><td>person0</td><td>(I)
+hitherto queen painted seat fords clay recall countryman divided delicate mocking active bills filth pledge surrender madness sufficiency moved converse goot claw show edmundsbury torment tough fish mediators tarquin pyrrhus <i> heathen </i>
+<p>Encrypted Version</p>
+ nehtaeh suhrryp niuqrat srotaidem hsif hguot tnemrot yrubsdnumde wohs walc toog esrevnoc devom ycneiciffus ssendam rednerrus egdelp htlif sllib evitca gnikcom etaciled dedivid namyrtnuoc llacer yalc sdrof taes detniap neeuq otrehtih
+<br>
+</td><td>6</td>
+</tr>
+<tr valign="top">
+<td>person0</td><td>person0</td><td>item1</td><td>113.87</td><td>06/06/2000</td><td>1</td><td>person0</td><td>(0) <p>Encrypted Version</p>
+<br>
+<br>(I)
+throng grandam awak helpless ventidius tread defeat teem durst wonderful attaint chaste sees fulfill mortality arme expedient attendants themselves performed leading sing villain skill store mischief see consciences sail text speed sons spleen die oft girl atomies commodity honor fall stopp they
+<p>Encrypted Version</p>
+ yeht ppots llaf ronoh ytidommoc seimota lrig tfo eid neelps snos deeps txet lias secneicsnoc ees feihcsim erots lliks nialliv gnis gnidael demrofrep sevlesmeht stnadnetta tneidepxe emra ytilatrom llifluf sees etsahc tniatta lufrednow tsrud meet taefed daert suiditnev sselpleh kawa madnarg gnorht
+<br>
+<br>(II)
+rain pays spilling rancour reasons grieves camp bachelor crow can whom soldiers growth invite less for vaughan properties <i> record penury herself reasons merits villainous whereupon wrote penny mar </i> preventions followed best eternity bestow blots rocks barnardine torn cassio tailor fame forfeit triumphant conceived deem cowardly merciful topgallant flint purgation whosoever ventidius befits forever bankrupt choughs stains certain violated burgundy shadows possesseth men repent predominant burns revelry swore prodigious next tyrant oath noses apart balth trade feasting field importunity expect experience kingly stay babe hopes liege astonished suspicion unmannerd alexander crown soil committed god stately incensed trance oracle slowness fast princes damned corn grandsire change tender end fields slain palm softly samp shore notion herod messengers horseman <b> riggish </b> quirks shut thence beware jewels sland preventions has sells assails influences oppression pow mag
got caught methought mechanical durst liker not seat <emph> assigns flesh made his third <i> seemeth </i> peril gain they stroke forsworn scape full determin professes commons </emph> lordship clear operation practice pyrrhus earnest broke devil posterity company text misbegotten oregon strike saw arthur earnestly brow popilius ugly serves presentation commandment metal comparing thereon true secretly gallows preventions horridly slack lieutenant hers stop clown rosalinde wed pretty wildly
+<p>Encrypted Version</p>
+ yldliw ytterp dew ednilasor nwolc pots sreh tnanetueil kcals yldirroh snoitneverp swollag ylterces eurt noereht gnirapmoc latem tnemdnammoc noitatneserp sevres ylgu suilipop worb yltsenrae ruhtra was ekirts nogero nettogebsim txet ynapmoc ytiretsop lived ekorb tsenrae suhrryp ecitcarp noitarepo raelc pihsdrol snommoc sesseforp nimreted lluf epacs nrowsrof ekorts yeht niag lirep htemees driht sih edam hself sngissa taes ton rekil tsrud lacinahcem thguohtem thguac toggam wop noisserppo secneulfni sliassa slles sah snoitneverp dnals slewej eraweb ecneht tuhs skriuq hsiggir namesroh sregnessem doreh noiton erohs pmas yltfos mlap nials sdleif dne rednet egnahc erisdnarg nroc denmad secnirp tsaf ssenwols elcaro ecnart desnecni yletats dog dettimmoc lios nworc rednaxela drennamnu noicipsus dehsinotsa egeil sepoh ebab yats ylgnik ecneirepxe tcepxe ytinutropmi dleif gnitsaef edart htlab trapa seson htao tnaryt txen suoigidorp erows yrlever snrub tnanimoderp tneper nem htessess
op swodahs ydnugrub detaloiv niatrec sniats shguohc tpurknab reverof stifeb suiditnev reveosohw noitagrup tnilf tnallagpot luficrem yldrawoc meed deviecnoc tnahpmuirt tiefrof emaf roliat oissac nrot enidranrab skcor stolb wotseb ytinrete tseb dewollof snoitneverp ram ynnep etorw nopuerehw suonialliv stirem snosaer flesreh yrunep drocer seitreporp nahguav rof ssel etivni htworg sreidlos mohw nac worc rolehcab pmac seveirg snosaer ruocnar gnillips syap niar
+<br>
+<br>
+</td><td>9</td>
+</tr>
+<tr valign="top">
+<td>person0</td><td>person0</td><td>item3</td><td>53.85</td><td>05/11/1999</td><td>1</td><td>person0</td><td>(I)
+strives occasion question sticks shall ingenious sinews liquid ashy gentlewomen authority assay hole selves living near doting modest wiltshire mocker eton profess forgeries butt wade lawful maccabaeus wert forced succeeding becomes wayward got
+<p>Encrypted Version</p>
+ tog drawyaw semoceb gnideeccus decrof trew sueabaccam lufwal edaw ttub seiregrof sseforp note rekcom erihstliw tsedom gnitod raen gnivil sevles eloh yassa ytirohtua nemoweltneg yhsa diuqil swenis suoinegni llahs skcits noitseuq noisacco sevirts
+<br>
+</td><td>6</td>
+</tr>
+<tr valign="top">
+<td>person0</td><td>person0</td><td>item5</td><td>96.06</td><td>04/24/1999</td><td>2</td><td>person0</td><td>(I)
+jove superiors prolong which conspirator crowns fellowship indisposition skins filthy divers fault apparell worthiness supposition parchment restitution rings rages remains lass dependent pelican contrive paradoxes unmask desdemona weak pleases shame wisely cheek poison avoid ulysses exeunt answer smoothing punishment much anointed bloody shook here armado supply four digestion unresisted consummate glou ding figure made unwrung worst repute envious meanest read nan stake shriek tower nights armed drinking instant scruple citizens rightful nonino shame hills dismal other fasting attends judge aspire hand putting repeal grounds bestrid commission crave mess tarries sport view freely lame done intend cast shun kills presented body landed question hem same burdens plenty esteem weak sigh sunday body preventions revenge horses cleomenes thrust what albeit foolishly mirror gently mock allow index evils should consider deeds suit damsons willoughby thousand number morn banish barr
icado unfolding perhaps gently stalk degree oblivion wars monsieur companies swords shifted clay strives frozen jour <emph> ajax states mark parcels advertised utterly virtue flatter sleeping ope </emph> lucilius tybalt glow killed account obdurate kindly <b> heart light bosom garden cog yet daughters tott </b> lifted offer
+<p>Encrypted Version</p>
+ reffo detfil ttot srethguad tey goc nedrag mosob thgil traeh yldnik etarudbo tnuocca dellik wolg tlabyt suilicul epo gnipeels rettalf eutriv ylrettu desitrevda slecrap kram setats xaja ruoj nezorf sevirts yalc detfihs sdrows seinapmoc rueisnom sraw noivilbo eerged klats yltneg spahrep gnidlofnu odacirrab hsinab nrom rebmun dnasuoht ybhguolliw snosmad tius sdeed redisnoc dluohs slive xedni wolla kcom yltneg rorrim ylhsiloof tiebla tahw tsurht senemoelc sesroh egnever snoitneverp ydob yadnus hgis kaew meetse ytnelp snedrub emas meh noitseuq dednal ydob detneserp sllik nuhs tsac dnetni enod emal yleerf weiv trops seirrat ssem evarc noissimmoc dirtseb sdnuorg laeper gnittup dnah eripsa egduj sdnetta gnitsaf rehto lamsid sllih emahs oninon lufthgir snezitic elpurcs tnatsni gniknird demra sthgin rewot keirhs ekats nan daer tsenaem suoivne etuper tsrow gnurwnu edam erugif gnid uolg etammusnoc detsisernu noitsegid ruof ylppus odamra ereh koohs ydoolb detniona hcum tnemhsinup gn
ihtooms rewsna tnuexe sessylu diova nosiop keehc ylesiw emahs sesaelp kaew anomedsed ksamnu sexodarap evirtnoc nacilep tnedneped ssal sniamer segar sgnir noitutitser tnemhcrap noitisoppus ssenihtrow llerappa tluaf srevid yhtlif sniks noitisopsidni pihswollef snworc rotaripsnoc hcihw gnolorp sroirepus evoj
+<br>
+</td><td>4</td>
+</tr>
+<tr valign="top">
+<td>person0</td><td>person0</td><td>item4</td><td>123.52</td><td>02/11/1999</td><td>1</td><td>person0</td><td>(I)
+vowed keys imperial were swinstead forsake cat aliena spies crave requite forfeit doctor <emph> possess </emph> aught demand ceremonies obscure engross hero restraint bolingbroke neighbour crimes dominions common turns conduct wav therewithal abandon yet hunger
+<p>Encrypted Version</p>
+ regnuh tey nodnaba lahtiwereht vaw tcudnoc snrut nommoc snoinimod semirc ruobhgien ekorbgnilob tniartser oreh ssorgne erucsbo seinomerec dnamed thgua ssessop rotcod tiefrof etiuqer evarc seips aneila tac ekasrof daetsniws erew lairepmi syek dewov
+<br>
+</td><td>5</td>
+</tr>
+<tr>
+<td><b>Totals</b></td><td></td><td></td><td><b>484.22</b></td><td></td><td><b>6</b></td><td></td><td></td><td>Average: 6</td>
+</tr>
+</table>
+</body>
+</html>
+exit 0
Added: test-suite/trunk/External/SPEC/CINT2006/483.xalancbmk/483.xalancbmk.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT2006/483.xalancbmk/483.xalancbmk.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT2006/483.xalancbmk/483.xalancbmk.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CINT2006/483.xalancbmk/483.xalancbmk.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,419 @@
+<html xmlns:spec="http://www.schemaTest.org/100mb">
+<body>
+<h3>Country: africa</h3>
+<table border="1">
+<tr>
+<th>Item</th><th>Name</th><th>Location</th><th>Quantity</th><th>Payment</th><th>Description</th><th>Shipping</th><th>Mailing</th>
+</tr>
+<tr valign="top">
+<td>item0</td><td>duteous nine eighteen </td><td>United States</td><td>1</td><td>Creditcard</td><td>(0)
+ smocks yielded <i> attires </i>
+ <p>Encrypted Version</p>
+ seritta dedleiy skcoms
+<br>
+<br>(I)
+ captain dying reek
+ <p>Encrypted Version</p>
+ keer gniyd niatpac
+<br>
+<br>
+</td><td>Will ship internationally, See description for charges</td><td>
+<p>
+<b>To: </b>Mechthild Renear <a href="mailto:Renear at acm.org">Renear at acm.org</a>
+<br>
+<b>From: </b>Dominic Takano <a href="mailto:Takano at yahoo.com">Takano at yahoo.com</a>
+<br>
+<b>Date: </b>10/12/1999<br>
+<b>Note: </b>
+<br>
+ suit observe sinews enforcement <emph> armed </emph> shrunk
+ <p>Encrypted Version</p>
+ knurhs demra tnemecrofne swenis evresbo tius
+</p>
+</td>
+</tr>
+</table>
+<h3>Stats on this continent</h3>
+<table border="1">
+<tr valign="top">
+<td>Number of nodes in this continent:</td><td>Categories Listed</td><td>Total Quantities</td>
+</tr>
+<tr valign="top">
+<td>1</td><td>
+<br>(0) category0<br>
+<br>(I) category0<br>
+<br>(II) category0<br>
+<br>(III) category0<br>
+<br>(IV) category0<br>
+</td><td>1</td>
+</tr>
+</table>
+<h3>Country: asia</h3>
+<table border="1">
+<tr>
+<th>Item</th><th>Name</th><th>Location</th><th>Quantity</th><th>Payment</th><th>Description</th><th>Shipping</th><th>Mailing</th>
+</tr>
+<tr valign="top">
+<td>item1</td><td>great </td><td>United States</td><td>1</td><td>Money order, Cash</td><td></td><td>Will ship internationally</td><td>
+<p>
+<b>To: </b>Lanju Takano <a href="mailto:Takano at itc.it">Takano at itc.it</a>
+<br>
+<b>From: </b>Fumitaka Cenzer <a href="mailto:Cenzer at savera.com">Cenzer at savera.com</a>
+<br>
+<b>Date: </b>02/24/2000<br>
+<b>Note: </b>
+<br>
+ men fits preparation <i> benefit since eclipse gates </i>
+ <p>Encrypted Version</p>
+ setag espilce ecnis tifeneb noitaraperp stif nem
+</p>
+<p>
+<b>To: </b>Ioana Blumberg <a href="mailto:Blumberg at conclusivestrategies.com">Blumberg at conclusivestrategies.com</a>
+<br>
+<b>From: </b>Papa Godskesen <a href="mailto:Godskesen at uwindsor.ca">Godskesen at uwindsor.ca</a>
+<br>
+<b>Date: </b>08/02/2001<br>
+<b>Note: </b>
+<br>
+ die servilius avoid <i> terrible doubtfully </i> delivery appease
+ <p>Encrypted Version</p>
+ esaeppa yreviled ylluftbuod elbirret diova suilivres eid
+</p>
+</td>
+</tr>
+</table>
+<h3>Stats on this continent</h3>
+<table border="1">
+<tr valign="top">
+<td>Number of nodes in this continent:</td><td>Categories Listed</td><td>Total Quantities</td>
+</tr>
+<tr valign="top">
+<td>1</td><td>
+<br>(0) category0<br>
+<br>(I) category0<br>
+<br>(II) category0<br>
+<br>(III) category0<br>
+<br>(IV) category0<br>
+<br>(V) category0<br>
+</td><td>1</td>
+</tr>
+</table>
+<h3>Country: australia</h3>
+<table border="1">
+<tr>
+<th>Item</th><th>Name</th><th>Location</th><th>Quantity</th><th>Payment</th><th>Description</th><th>Shipping</th><th>Mailing</th>
+</tr>
+<tr valign="top">
+<td>item2</td><td>scarce brook </td><td>United States</td><td>1</td><td></td><td>(0)
+ <i> preparation rejoice </i>
+ <p>Encrypted Version</p>
+ eciojer noitaraperp
+<br>
+<br>(I)
+ <emph> garments tenfold </emph> child case <i> </i> reveal
+ <p>Encrypted Version</p>
+ laever esac dlihc dlofnet stnemrag
+<br>
+<br>(II)
+ <b> </b> loved endure combating voyage
+ <p>Encrypted Version</p>
+ egayov gnitabmoc erudne devol
+<br>
+<br>(III) <p>Encrypted Version</p>
+<br>
+<br>(IV) <p>Encrypted Version</p>
+<br>
+<br>
+</td><td>Will ship internationally</td><td>
+<p>
+<b>To: </b>Lesley Jeris <a href="mailto:Jeris at zambeel.com">Jeris at zambeel.com</a>
+<br>
+<b>From: </b>Aspi L'Ecuyer <a href="mailto:L'Ecuyer at intersys.com">L'Ecuyer at intersys.com</a>
+<br>
+<b>Date: </b>10/09/1998<br>
+<b>Note: </b>
+<br>
+ officer dramatis
+ <p>Encrypted Version</p>
+ sitamard reciffo
+</p>
+</td>
+</tr>
+</table>
+<h3>Stats on this continent</h3>
+<table border="1">
+<tr valign="top">
+<td>Number of nodes in this continent:</td><td>Categories Listed</td><td>Total Quantities</td>
+</tr>
+<tr valign="top">
+<td>1</td><td>
+<br>(0) category0<br>
+<br>(I) category0<br>
+</td><td>1</td>
+</tr>
+</table>
+<h3>Country: europe</h3>
+<table border="1">
+<tr>
+<th>Item</th><th>Name</th><th>Location</th><th>Quantity</th><th>Payment</th><th>Description</th><th>Shipping</th><th>Mailing</th>
+</tr>
+<tr valign="top">
+<td>item3</td><td>abhorr execution beckon rue </td><td>Uzbekistan</td><td>1</td><td>Money order, Creditcard, Cash</td><td>(0)
+ <i> </i> perhaps
+ <p>Encrypted Version</p>
+ spahrep
+<br>
+<br>(I)
+ listen weak soil <i> view presume loggets feed </i> food inheritor wiser <emph> hedge </emph> rot hazards craft crowns <emph> plainness patient </emph> bands answer
+ <p>Encrypted Version</p>
+ rewsna sdnab tneitap ssennialp snworc tfarc sdrazah tor egdeh resiw rotirehni doof deef steggol emuserp weiv lios kaew netsil
+<br>
+<br>
+</td><td>Will ship only within country</td><td></td>
+</tr>
+</table>
+<h3>Stats on this continent</h3>
+<table border="1">
+<tr valign="top">
+<td>Number of nodes in this continent:</td><td>Categories Listed</td><td>Total Quantities</td>
+</tr>
+<tr valign="top">
+<td>1</td><td>
+<br>(0) category0<br>
+<br>(I) category0<br>
+<br>(II) category0<br>
+<br>(III) category0<br>
+<br>(IV) category0<br>
+<br>(V) category0<br>
+<br>(VI) category0<br>
+<br>(VII) category0<br>
+</td><td>1</td>
+</tr>
+</table>
+<h3>Country: namerica</h3>
+<table border="1">
+<tr>
+<th>Item</th><th>Name</th><th>Location</th><th>Quantity</th><th>Payment</th><th>Description</th><th>Shipping</th><th>Mailing</th>
+</tr>
+<tr valign="top">
+<td>item4</td><td>unsur brutish </td><td>United States</td><td>1</td><td>Money order, Creditcard</td><td>(0)
+ endless women benefit throw <emph> claim firmness <i> prais knave doubtless </i> deny </emph> quietness perpetual ways
+ <p>Encrypted Version</p>
+ syaw lauteprep ssenteiuq yned sseltbuod evank siarp ssenmrif mialc worht tifeneb nemow sseldne
+<br>
+<br>(I)
+ kernel hoppedance perfection weight <emph> featur </emph> longing goneril visitation honey
+ <p>Encrypted Version</p>
+ yenoh noitatisiv lirenog gnignol rutaef thgiew noitcefrep ecnadeppoh lenrek
+<br>
+<br>
+</td><td>Will ship only within country, Buyer pays fixed shipping charges, See description for charges</td><td>
+<p>
+<b>To: </b>Maz Lucky <a href="mailto:Lucky at washington.edu">Lucky at washington.edu</a>
+<br>
+<b>From: </b>Honari Castan <a href="mailto:Castan at uni-muenchen.de">Castan at uni-muenchen.de</a>
+<br>
+<b>Date: </b>01/24/1998<br>
+<b>Note: </b>
+<br>
+ start temples
+ <p>Encrypted Version</p>
+ selpmet trats
+</p>
+</td>
+</tr>
+</table>
+<h3>Stats on this continent</h3>
+<table border="1">
+<tr valign="top">
+<td>Number of nodes in this continent:</td><td>Categories Listed</td><td>Total Quantities</td>
+</tr>
+<tr valign="top">
+<td>1</td><td>
+<br>(0) category0<br>
+<br>(I) category0<br>
+<br>(II) category0<br>
+</td><td>1</td>
+</tr>
+</table>
+<h3>Country: samerica</h3>
+<table border="1">
+<tr>
+<th>Item</th><th>Name</th><th>Location</th><th>Quantity</th><th>Payment</th><th>Description</th><th>Shipping</th><th>Mailing</th>
+</tr>
+<tr valign="top">
+<td>item5</td><td>nakedness </td><td>United States</td><td>1</td><td>Creditcard, Personal Check, Cash</td><td></td><td>Will ship only within country, Will ship internationally</td><td></td>
+</tr>
+</table>
+<h3>Stats on this continent</h3>
+<table border="1">
+<tr valign="top">
+<td>Number of nodes in this continent:</td><td>Categories Listed</td><td>Total Quantities</td>
+</tr>
+<tr valign="top">
+<td>1</td><td>
+<br>(0) category0<br>
+<br>(I) category0<br>
+<br>(II) category0<br>
+<br>(III) category0<br>
+</td><td>1</td>
+</tr>
+</table>
+<h3>Category List</h3>
+<table border="1">
+<tr>
+<th>Category #</th><th>Name</th><th>Description</th>
+</tr>
+<tr valign="top">
+<td>category0</td><td>dispatch reported dotard holofernes </td><td>(0)
+ sans four
+ <p>Encrypted Version</p>
+ ruof snas
+<br>
+<br>(I) <p>Encrypted Version</p>
+<br>
+<br>
+</td>
+</tr>
+</table>
+<h3>Customer Database</h3>
+<table border="1">
+<tr>
+<th>Id</th><th>Name</th><th>Email</th><th>Phone</th><th>homepage</th><th>Credit Card</th><th>Activity</th><th>Mailing</th><th>Income</th><th>Gender</th><th>Business</th><th>Age</th><th>Education></th>
+</tr>
+<tr valign="top">
+<td>person0</td><td>Jaak Tempesti</td><td><a href="mailto:Tempesti at labs.com">Tempesti at labs.com</a></td><td>+0 (873) 14873867</td><td><a href="http://www.labs.com/~Tempesti">http://www.labs.com/~Tempesti</a></td><td>5048 5813 2703 8253</td><td>(0) open_auction0<br>
+</td><td></td><td></td><td></td><td></td><td></td><td></td>
+</tr>
+<tr>
+<td><b>Totals</b></td><td><b>1</b></td><td>--</td><td>--</td><td>--</td><td>--</td><td>--</td><td>--</td><td><b>Ave: NaN</b></td><td><b># of Male: 0<br># of Female: 0</b></td><td><b># of Bus: 0</b></td><td><b>Ave: NaN</b></td><td>--</td>
+</tr>
+</table>
+<h2>Auctions Currently Open</h2>
+<p>
+<b>Item: </b>item0<br>
+<b>Seller: </b>person0<br>
+<b>Seller Rating: </b>6<br>
+<b>Description: </b>(I)
+ dress dozen napkins <emph> pleading </emph> better joy <emph> meagre </emph> violent rear past liberty <emph> teeth </emph> <i> hearsed </i> postmaster distress disposition <b> inherits </b> revelling glean thank
+ <p>Encrypted Version</p>
+ knaht naelg gnillever stirehni noitisopsid ssertsid retsamtsop desraeh hteet ytrebil tsap raer tneloiv ergaem yoj retteb gnidaelp snikpan nezod sserd
+<br>
+<br>
+<b>Opening bid: </b>13.56<br>
+<b>Current bid: </b>243.06<br>
+</p>
+<h3>Open Auction Activity: open_auction0</h3>
+<table border="1">
+<tr>
+<th>Date</th><th>Time</th><th>Bidder</th><th>Increment</th>
+</tr>
+<tr>
+<td>01/02/1998</td><td>22:18:07</td><td>person0</td><td>1.5</td>
+</tr>
+<tr>
+<td>04/01/1998</td><td>10:44:22</td><td>person0</td><td>7.5</td>
+</tr>
+<tr>
+<td>07/22/1998</td><td>10:34:11</td><td>person0</td><td>25.5</td>
+</tr>
+<tr>
+<td>07/12/1999</td><td>23:20:27</td><td>person0</td><td>13.5</td>
+</tr>
+<tr>
+<td>11/15/1999</td><td>14:23:15</td><td>person0</td><td>9</td>
+</tr>
+<tr>
+<td>02/14/2000</td><td>16:40:16</td><td>person0</td><td>19.5</td>
+</tr>
+<tr>
+<td>03/04/2000</td><td>20:46:15</td><td>person0</td><td>16.5</td>
+</tr>
+<tr>
+<td>08/12/2000</td><td>11:41:54</td><td>person0</td><td>3</td>
+</tr>
+<tr>
+<td>11/15/2000</td><td>15:53:40</td><td>person0</td><td>6</td>
+</tr>
+<tr>
+<td>05/09/2001</td><td>11:39:57</td><td>person0</td><td>30</td>
+</tr>
+<tr>
+<td>07/27/2001</td><td>12:36:50</td><td>person0</td><td>19.5</td>
+</tr>
+<tr>
+<td>09/28/2001</td><td>17:03:24</td><td>person0</td><td>6</td>
+</tr>
+<tr>
+<td>10/21/2001</td><td>01:19:47</td><td>person0</td><td>3</td>
+</tr>
+<tr>
+<td>10/22/2001</td><td>10:21:43</td><td>person0</td><td>55.5</td>
+</tr>
+<tr>
+<td>12/24/2001</td><td>16:46:32</td><td>person0</td><td>13.5</td>
+</tr>
+<tr>
+<td><b>Total Increase</b></td><td></td><td></td><td>229.5</td>
+</tr>
+</table>
+<h3>Closed Auction</h3>
+<table border="1">
+<tr>
+<th>Buyer</th><th>Seller</th><th>Item #</th><th>Price</th><th>Date</th><th>Quantity</th><th>Prev Bidder</th><th>Description</th><th>Satisfaction</th>
+</tr>
+<tr valign="top">
+<td>person0</td><td>person0</td><td>item2</td><td>96.92</td><td>12/05/2001</td><td>1</td><td>person0</td><td>(I)
+<i> heathen </i>
+<p>Encrypted Version</p>
+ nehtaeh
+<br>
+</td><td>6</td>
+</tr>
+<tr valign="top">
+<td>person0</td><td>person0</td><td>item1</td><td>113.87</td><td>06/06/2000</td><td>1</td><td>person0</td><td>(0) <p>Encrypted Version</p>
+<br>
+<br>(I)
+stopp they
+<p>Encrypted Version</p>
+ yeht ppots
+<br>
+<br>(II)
+for vaughan properties <i> </i> herod messengers horseman <b> riggish </b> seat <emph> <i> seemeth </i> </emph>
+<p>Encrypted Version</p>
+ htemees taes hsiggir namesroh sregnessem doreh seitreporp nahguav rof
+<br>
+<br>
+</td><td>9</td>
+</tr>
+<tr valign="top">
+<td>person0</td><td>person0</td><td>item3</td><td>53.85</td><td>05/11/1999</td><td>1</td><td>person0</td><td>(I)
+becomes wayward got
+<p>Encrypted Version</p>
+ tog drawyaw semoceb
+<br>
+</td><td>6</td>
+</tr>
+<tr valign="top">
+<td>person0</td><td>person0</td><td>item5</td><td>96.06</td><td>04/24/1999</td><td>2</td><td>person0</td><td>(I)
+jour <emph> </emph> obdurate kindly <b> yet daughters tott </b> lifted offer
+<p>Encrypted Version</p>
+ reffo detfil ttot srethguad tey yldnik etarudbo ruoj
+<br>
+</td><td>4</td>
+</tr>
+<tr valign="top">
+<td>person0</td><td>person0</td><td>item4</td><td>123.52</td><td>02/11/1999</td><td>1</td><td>person0</td><td>(I)
+requite forfeit doctor <emph> possess </emph> therewithal abandon yet hunger
+<p>Encrypted Version</p>
+ regnuh tey nodnaba lahtiwereht ssessop rotcod tiefrof etiuqer
+<br>
+</td><td>5</td>
+</tr>
+<tr>
+<td><b>Totals</b></td><td></td><td></td><td><b>484.22</b></td><td></td><td><b>6</b></td><td></td><td></td><td>Average: 6</td>
+</tr>
+</table>
+</body>
+</html>
+exit 0
Added: test-suite/trunk/External/SPEC/CINT95/099.go/099.go.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT95/099.go/099.go.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT95/099.go/099.go.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT95/099.go/099.go.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,67 @@
+ 1 B D7
+ 2 W C4
+ 3 B F3
+ 4 W B7
+ 5 B C3
+ 6 W C6
+ 7 B B4
+ 8 W B5
+ 9 B D4
+ 10 W G3
+ 11 B C8
+ 12 W B8
+ 13 B F4
+ 14 W F2
+ 15 B G4
+ 16 W C5
+ 17 B G7
+ 18 W B3
+ 19 B C2
+ 20 W B2
+ 21 B D5
+ 22 W C9
+ 23 B D9
+ 24 W E8
+ 25 B B9
+ 26 W F7
+ 27 B F6
+ 28 W F8
+ 29 B D8
+ 30 W E6
+ 31 B G8
+ 32 W G6
+ 33 B H3
+ 34 W D6
+ 35 B H6
+ 36 W E5
+ 37 B E4
+ 38 W F5
+ 39 B F9
+ 40 W E9
+ 41 B G5
+ 42 W G2
+ 43 B H2
+ 44 W G9
+ 45 B H8
+ 46 W H9
+ 47 B F6
+ 48 W E2
+ 49 B D3
+ 50 W G6
+ 51 B J9
+ 52 W J8
+ 53 B H7
+ 54 W F9
+ 55 B G1
+ 56 W C1
+ 57 B D1
+ 58 W B1
+ 59 B D2
+ 60 W F6
+ 61 B J7
+ 62 W J9
+ 63 B H5
+ 64 W pass
+ 65 B pass
+Game over
+exit 0
Added: test-suite/trunk/External/SPEC/CINT95/099.go/099.go.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT95/099.go/099.go.reference_output.small?rev=105213&view=auto
==============================================================================
(empty)
Added: test-suite/trunk/External/SPEC/CINT95/124.m88ksim/124.m88ksim.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT95/124.m88ksim/124.m88ksim.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT95/124.m88ksim/124.m88ksim.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT95/124.m88ksim/124.m88ksim.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,154 @@
+ DCMMU & ICMMU RESET
+sim>> Loading section ".text" at address $000100B8, bytes to load $000073D0
+Loading section ".data" at address $00407488, bytes to load $00005F90
+Loading section ".bss" at address $0040D418, bytes to load $00120F58
+Setting stack space at EFFF0000 to EFFFFFFF
+Execution address = $000110C8
+SysV IO vectors: Enabled
+
+sim>>
+sim>>
+sim>>
+sim>>
+sim>> Effective address: 000110C8
+Program "EXIT", exit value 5100984
+ r00: 00000000 r01: 000169B0 r02: 004DD5B8 r03: 00000000
+ r04: 004DD5C0 r05: 0040D850 r06: 4023B81D r07: 7DBF4880
+ r08: 4023B81D r09: 00000009 r10: 00000AA4 r11: 00400000
+ r12: 00000000 r13: 00000998 r14: 00000000 r15: 00000000
+ r16: 00000000 r17: 00000000 r18: 00000000 r19: 00000000
+ r20: 00000000 r21: 00000000 r22: 00000000 r23: 00000000
+ r24: 004DD5B8 r25: 00000000 r26: 00000000 r27: 00000000
+ r28: 00000000 r29: 00000000 r30: 00000000 r31: 00409410
+ ip: 0x000169CC vbr: 0x00000000 psr: 0x800003FF
+ sbd: 0x00000000
+ fpsr: 0x00000001 fpcr: 0x00000000
+
+sim>> Instructions: 36490
+Clocks: 58628
+arithmetic 5199 14.25 percent
+logical 11000 30.15 percent
+load address 0 0.00 percent
+load 6975 19.11 percent
+store 2932 8.04 percent
+xmem 0 0.00 percent
+control register 0 0.00 percent
+bit field 3458 9.48 percent
+jumps not taken 617 1.69 percent
+jumps taken 4580 12.55 percent
+traps 1 0.00 percent
+floating point 1728 4.74 percent
+error count 0 0.00 percent
+ NON-Execution Clocks:
+ Clocks due to Mbus Arbitration = 9938
+ Clocks due to Pbus Arbitration = 19
+
+sim>>
+cmmu function statistics:
+ -----------------
+ | Icmmu | Dcmmu |
+ ----------------------------------------|
+|tablewalks | 0 | 0 |
+-----------------------------------------|
+|tablewalks w/U,M bit set| 0 | 0 |
+-----------------------------------------|
+|write once | 0 | 588 |
+-----------------------------------------|
+|cache writes w/ copyback| 0 | 2 |
+-----------------------------------------|
+|cache reads w/ copyback | 0 | 71 |
+-----------------------------------------|
+|probes | 0 | 0 |
+-----------------------------------------|
+
+ CONTINUE - PRESS <return>
+ ----------------------------------------------
+ | # of | # of | Hit | Miss |
+ | checks | hits | Ratio | Ratio |
+---------------------------------------------------------------
+| BATC - ICMMU | 0 | 0 | 0.00 | 0.00 |
+|----------------|-----------|----------|----------|----------|
+| PATC - ICMMU | 0 | 0 | 0.00 | 0.00 |
+|----------------|-----------|----------|----------|----------|
+| BATC - DCMMU | 0 | 0 | 0.00 | 0.00 |
+|----------------|-----------|----------|----------|----------|
+| PATC - DCMMU | 0 | 0 | 0.00 | 0.00 |
+---------------------------------------------------------------
+ ----------------------------------------------
+ | # of | # of | Hit | Miss |
+ | accesses | hits | Ratio | Ratio |
+---------------------------------------------------------------
+| Instr. fetches | 36490 | 36439 | 99.86 | 0.14 |
+|----------------|-----------|----------|----------|----------|
+| Data loads | 8710 | 7829 | 89.89 | 10.11 |
+|----------------|-----------|----------|----------|----------|
+| Data stores | 4091 | 4085 | 99.85 | 0.15 |
+---------------------------------------------------------------
+
+sim>> Unknown command or option for command 'd'
+sim>> I CACHE (SET # 109) :
+ vv kill address tag data0 data1 data2 data3 order
+ --- ---- ----------- ---------- ---------- ---------- ---------- -----
+ 2 0 0x00011000 0xf0479801 0x5d200040 0x1509a778 0x152da774 3
+ 3 0 0x00000000 0x00000000 0x00000000 0x00000000 0x00000000 0
+ 3 0 0x00000000 0x00000000 0x00000000 0x00000000 0x00000000 1
+ 3 0 0x00000000 0x00000000 0x00000000 0x00000000 0x00000000 2
+
+sim>> I CACHE (SET # 158) :
+ vv kill address tag data0 data1 data2 data3 order
+ --- ---- ----------- ---------- ---------- ---------- ---------- -----
+ 2 0 0x00013000 0xcc000030 0xf4405819 0x15b8d2fc 0x63390080 3
+ 3 0 0x00000000 0x00000000 0x00000000 0x00000000 0x00000000 0
+ 3 0 0x00000000 0x00000000 0x00000000 0x00000000 0x00000000 1
+ 3 0 0x00000000 0x00000000 0x00000000 0x00000000 0x00000000 2
+
+sim>> I CACHE (SET # 180) :
+ vv kill address tag data0 data1 data2 data3 order
+ --- ---- ----------- ---------- ---------- ---------- ---------- -----
+ 2 0 0x00013000 0xf4405819 0x15b9000c 0x49ad0006 0x7dad0002 3
+ 3 0 0x00000000 0x00000000 0x00000000 0x00000000 0x00000000 0
+ 3 0 0x00000000 0x00000000 0x00000000 0x00000000 0x00000000 1
+ 3 0 0x00000000 0x00000000 0x00000000 0x00000000 0x00000000 2
+
+sim>> D CACHE (SET # 2) :
+ vv kill address tag data0 data1 data2 data3 order
+ --- ---- ----------- ---------- ---------- ---------- ---------- -----
+ 1 0 0x00486000 0x4023b81d 0x7dbf4880 0x00000000 0x00000000 2
+ 1 0 0x0040f000 0x00000000 0x00000000 0x4023b81d 0x7dbf4880 3
+ 3 0 0x00000000 0x00000000 0x00000000 0x00000000 0x00000000 0
+ 3 0 0x00000000 0x00000000 0x00000000 0x00000000 0x00000000 1
+
+sim>> D CACHE (SET # 3) :
+ vv kill address tag data0 data1 data2 data3 order
+ --- ---- ----------- ---------- ---------- ---------- ---------- -----
+ 1 0 0x00479000 0x4023b81d 0x7dbf4880 0x00000000 0x00000000 1
+ 2 0 0x0040f000 0x00000000 0x00000000 0x00000000 0x00000000 2
+ 1 0 0x004b5000 0x4023b81d 0x7dbf4880 0x00000000 0x00000000 3
+ 3 0 0x00000000 0x00000000 0x00000000 0x00000000 0x00000000 0
+
+sim>> D CACHE (SET # 5) :
+ vv kill address tag data0 data1 data2 data3 order
+ --- ---- ----------- ---------- ---------- ---------- ---------- -----
+ 1 0 0x004cf000 0x4023b81d 0x7dbf4880 0x00000000 0x00000000 2
+ 1 0 0x00429000 0x00000000 0x00000000 0x4023b81d 0x7dbf4880 3
+ 3 0 0x00000000 0x00000000 0x00000000 0x00000000 0x00000000 0
+ 3 0 0x00000000 0x00000000 0x00000000 0x00000000 0x00000000 1
+
+sim>> D CACHE (SET # 48) :
+ vv kill address tag data0 data1 data2 data3 order
+ --- ---- ----------- ---------- ---------- ---------- ---------- -----
+ 1 0 0x004f1000 0x4023b81d 0x7dbf4880 0x00000000 0x00000000 2
+ 2 0 0x0040b000 0x00000000 0x00000001 0x00000000 0x00000000 3
+ 1 0 0x00478000 0x00000000 0x00000000 0x4023b81d 0x7dbf4880 0
+ 1 0 0x00483000 0x4023b81d 0x7dbf4880 0x00000000 0x00000000 1
+
+sim>> D CACHE (SET # 187) :
+ vv kill address tag data0 data1 data2 data3 order
+ --- ---- ----------- ---------- ---------- ---------- ---------- -----
+ 2 0 0x004d2000 0x00000000 0x00000000 0x00000000 0x00000000 3
+ 2 0 0x0047f000 0x00000000 0x00000000 0x00000000 0x00000000 0
+ 1 0 0x004cd000 0x00000000 0x00000000 0x4023b81d 0x7dbf4880 1
+ 1 0 0x00420000 0x00000000 0x00000000 0x4023b81d 0x7dbf4880 2
+
+sim>>
+exit 0
Added: test-suite/trunk/External/SPEC/CINT95/124.m88ksim/124.m88ksim.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT95/124.m88ksim/124.m88ksim.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT95/124.m88ksim/124.m88ksim.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CINT95/124.m88ksim/124.m88ksim.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,117 @@
+
+Dhrystone Benchmark, Version 2.1 (Language: C)
+
+Program compiled without 'register' attribute
+
+Execution starts, 1000 runs through Dhrystone
+Execution ends
+
+Final values of the variables used in the benchmark:
+
+Int_Glob: 5
+ should be: 5
+Bool_Glob: 1
+ should be: 1
+Ch_1_Glob: A
+ should be: A
+Ch_2_Glob: B
+ should be: B
+Arr_1_Glob[8]: 7
+ should be: 7
+Arr_2_Glob[8][7]: 1010
+ should be: Number_Of_Runs + 10
+Ptr_Glob->
+ Ptr_Comp: 4264752
+ should be: (implementation-dependent)
+ Discr: 0
+ should be: 0
+ Enum_Comp: 2
+ should be: 2
+ Int_Comp: 17
+ should be: 17
+ Str_Comp: DHRYSTONE PROGRAM, SOME STRING
+ should be: DHRYSTONE PROGRAM, SOME STRING
+Next_Ptr_Glob->
+ Ptr_Comp: 4264752
+ should be: (implementation-dependent), same as above
+ Discr: 0
+ should be: 0
+ Enum_Comp: 1
+ should be: 1
+ Int_Comp: 18
+ should be: 18
+ Str_Comp: DHRYSTONE PROGRAM, SOME STRING
+ should be: DHRYSTONE PROGRAM, SOME STRING
+Int_1_Loc: 5
+ should be: 5
+Int_2_Loc: 13
+ should be: 13
+Int_3_Loc: 7
+ should be: 7
+Enum_Loc: 1
+ should be: 1
+Str_1_Loc: DHRYSTONE PROGRAM, 1'ST STRING
+ should be: DHRYSTONE PROGRAM, 1'ST STRING
+Str_2_Loc: DHRYSTONE PROGRAM, 2'ND STRING
+ should be: DHRYSTONE PROGRAM, 2'ND STRING
+
+Microseconds for one run through Dhrystone: 33.3
+Dhrystones per Second: 30000.0
+
+ DCMMU & ICMMU RESET
+sim>> Loading section ".text" at address $000100B8, bytes to load $00007780
+Loading section ".data" at address $00407838, bytes to load $000062F0
+Loading section ".bss" at address $0040DB28, bytes to load $000037B8
+Setting stack space at EFFF0000 to EFFFFFFF
+Execution address = $000110C8
+SysV IO vectors: Enabled
+
+sim>>
+sim>> BREAKPOINTS
+00011C88
+sim>> Effective address: 000110C8
+At Breakpoint
+ r00: 00000000 r01: 00011100 r02: 00000001 r03: 00410DD0
+ r04: 00000001 r05: 0000000A r06: 00000AA4 r07: 0000000A
+ r08: 00000001 r09: 00000044 r10: 00000998 r11: 00000001
+ r12: 00000001 r13: 00400000 r14: 00000000 r15: 00000000
+ r16: 00000000 r17: 00000000 r18: 00000000 r19: 00000000
+ r20: 00000000 r21: 00000000 r22: 00000000 r23: 00000000
+ r24: 00000000 r25: 00000000 r26: 00000000 r27: 00000000
+ r28: 00000000 r29: 00000000 r30: 00000000 r31: 00409800
+ ip: 0x00011C88 vbr: 0x00000000 psr: 0x800003FF
+ sbd: 0x00000000
+ fpsr: 0x00000001 fpcr: 0x00000000
+
+sim>> Effective address: 00011C88
+Program "EXIT", exit value 1
+ r00: 00000000 r01: 00016CA0 r02: 00000001 r03: 00410DD0
+ r04: 00000001 r05: 0000000A r06: 00000AA4 r07: 0000000A
+ r08: 00000001 r09: 00000009 r10: 00000998 r11: 00410DD0
+ r12: 0040BB08 r13: 00400000 r14: 00000000 r15: 00000000
+ r16: 00000000 r17: 00000000 r18: 00000000 r19: 00000000
+ r20: 00000000 r21: 00000000 r22: 00000000 r23: 00000000
+ r24: 00000001 r25: 00000000 r26: 00000000 r27: 00000000
+ r28: 00000000 r29: 00000000 r30: 00000000 r31: 004097C0
+ ip: 0x00016CBC vbr: 0x00000000 psr: 0x800003FF
+ sbd: 0x00000000
+ fpsr: 0x00000001 fpcr: 0x00000000
+
+sim>> Instructions: 452459
+Clocks: 582105
+arithmetic 78440 17.34 percent
+logical 117438 25.96 percent
+load address 3116 0.69 percent
+load 84743 18.73 percent
+store 64422 14.24 percent
+xmem 0 0.00 percent
+control register 0 0.00 percent
+bit field 11196 2.47 percent
+jumps not taken 26593 5.88 percent
+jumps taken 66368 14.67 percent
+traps 66 0.01 percent
+floating point 77 0.02 percent
+error count 0 0.00 percent
+
+sim>>
+exit 0
Added: test-suite/trunk/External/SPEC/CINT95/126.gcc/126.gcc.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT95/126.gcc/126.gcc.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT95/126.gcc/126.gcc.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT95/126.gcc/126.gcc.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1 @@
+f402851724ca26cece014e666a168b4c
Added: test-suite/trunk/External/SPEC/CINT95/126.gcc/126.gcc.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT95/126.gcc/126.gcc.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT95/126.gcc/126.gcc.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CINT95/126.gcc/126.gcc.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1 @@
+b48d86890c854b18d70fcf92d99499a7
Added: test-suite/trunk/External/SPEC/CINT95/129.compress/129.compress.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT95/129.compress/129.compress.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT95/129.compress/129.compress.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT95/129.compress/129.compress.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,153 @@
+SPEC 129.compress harness
+Initial File Size:10000 Start character:q
+The starting size is: 10002
+The compressed size is: 6346
+The compressed/uncompressed size is: 10002
+Files both have length 10002
+First character (u) and Last Character (
+) match.
+The starting size is: 10005
+The compressed size is: 6347
+The compressed/uncompressed size is: 10005
+Files both have length 10005
+First character (u) and Last Character (
+) match.
+The starting size is: 10009
+The compressed size is: 6352
+The compressed/uncompressed size is: 10009
+Files both have length 10009
+First character (u) and Last Character (
+) match.
+The starting size is: 10014
+The compressed size is: 6354
+The compressed/uncompressed size is: 10014
+Files both have length 10014
+First character (u) and Last Character (
+) match.
+The starting size is: 10020
+The compressed size is: 6359
+The compressed/uncompressed size is: 10020
+Files both have length 10020
+First character (u) and Last Character (
+) match.
+The starting size is: 10027
+The compressed size is: 6360
+The compressed/uncompressed size is: 10027
+Files both have length 10027
+First character (u) and Last Character (
+) match.
+The starting size is: 10035
+The compressed size is: 6365
+The compressed/uncompressed size is: 10035
+Files both have length 10035
+First character (u) and Last Character (
+) match.
+The starting size is: 10044
+The compressed size is: 6367
+The compressed/uncompressed size is: 10044
+Files both have length 10044
+First character (u) and Last Character (
+) match.
+The starting size is: 10054
+The compressed size is: 6372
+The compressed/uncompressed size is: 10054
+Files both have length 10054
+First character (u) and Last Character (
+) match.
+The starting size is: 10065
+The compressed size is: 6373
+The compressed/uncompressed size is: 10065
+Files both have length 10065
+First character (u) and Last Character (
+) match.
+The starting size is: 10077
+The compressed size is: 6378
+The compressed/uncompressed size is: 10077
+Files both have length 10077
+First character (u) and Last Character (
+) match.
+The starting size is: 10090
+The compressed size is: 6380
+The compressed/uncompressed size is: 10090
+Files both have length 10090
+First character (u) and Last Character (
+) match.
+The starting size is: 10104
+The compressed size is: 6385
+The compressed/uncompressed size is: 10104
+Files both have length 10104
+First character (u) and Last Character (
+) match.
+The starting size is: 10119
+The compressed size is: 6386
+The compressed/uncompressed size is: 10119
+Files both have length 10119
+First character (u) and Last Character (
+) match.
+The starting size is: 10135
+The compressed size is: 6391
+The compressed/uncompressed size is: 10135
+Files both have length 10135
+First character (u) and Last Character (
+) match.
+The starting size is: 10152
+The compressed size is: 6393
+The compressed/uncompressed size is: 10152
+Files both have length 10152
+First character (u) and Last Character (
+) match.
+The starting size is: 10170
+The compressed size is: 6398
+The compressed/uncompressed size is: 10170
+Files both have length 10170
+First character (u) and Last Character (
+) match.
+The starting size is: 10189
+The compressed size is: 6399
+The compressed/uncompressed size is: 10189
+Files both have length 10189
+First character (u) and Last Character (
+) match.
+The starting size is: 10209
+The compressed size is: 6404
+The compressed/uncompressed size is: 10209
+Files both have length 10209
+First character (u) and Last Character (
+) match.
+The starting size is: 10230
+The compressed size is: 6406
+The compressed/uncompressed size is: 10230
+Files both have length 10230
+First character (u) and Last Character (
+) match.
+The starting size is: 10252
+The compressed size is: 6411
+The compressed/uncompressed size is: 10252
+Files both have length 10252
+First character (u) and Last Character (
+) match.
+The starting size is: 10275
+The compressed size is: 6412
+The compressed/uncompressed size is: 10275
+Files both have length 10275
+First character (u) and Last Character (
+) match.
+The starting size is: 10299
+The compressed size is: 6417
+The compressed/uncompressed size is: 10299
+Files both have length 10299
+First character (u) and Last Character (
+) match.
+The starting size is: 10324
+The compressed size is: 6419
+The compressed/uncompressed size is: 10324
+Files both have length 10324
+First character (u) and Last Character (
+) match.
+The starting size is: 10350
+The compressed size is: 6424
+The compressed/uncompressed size is: 10350
+Files both have length 10350
+First character (u) and Last Character (
+) match.
+exit 0
Added: test-suite/trunk/External/SPEC/CINT95/129.compress/129.compress.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT95/129.compress/129.compress.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT95/129.compress/129.compress.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CINT95/129.compress/129.compress.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,153 @@
+SPEC 129.compress harness
+Initial File Size:100 Start character:q
+The starting size is: 102
+The compressed size is: 105
+The compressed/uncompressed size is: 102
+Files both have length 102
+First character (u) and Last Character (
+) match.
+The starting size is: 105
+The compressed size is: 106
+The compressed/uncompressed size is: 105
+Files both have length 105
+First character (u) and Last Character (
+) match.
+The starting size is: 109
+The compressed size is: 109
+The compressed/uncompressed size is: 109
+Files both have length 109
+First character (u) and Last Character (
+) match.
+The starting size is: 114
+The compressed size is: 110
+The compressed/uncompressed size is: 114
+Files both have length 114
+First character (u) and Last Character (
+) match.
+The starting size is: 120
+The compressed size is: 114
+The compressed/uncompressed size is: 120
+Files both have length 120
+First character (u) and Last Character (
+) match.
+The starting size is: 127
+The compressed size is: 115
+The compressed/uncompressed size is: 127
+Files both have length 127
+First character (u) and Last Character (
+) match.
+The starting size is: 135
+The compressed size is: 118
+The compressed/uncompressed size is: 135
+Files both have length 135
+First character (u) and Last Character (
+) match.
+The starting size is: 144
+The compressed size is: 119
+The compressed/uncompressed size is: 144
+Files both have length 144
+First character (u) and Last Character (
+) match.
+The starting size is: 154
+The compressed size is: 123
+The compressed/uncompressed size is: 154
+Files both have length 154
+First character (u) and Last Character (
+) match.
+The starting size is: 165
+The compressed size is: 124
+The compressed/uncompressed size is: 165
+Files both have length 165
+First character (u) and Last Character (
+) match.
+The starting size is: 177
+The compressed size is: 127
+The compressed/uncompressed size is: 177
+Files both have length 177
+First character (u) and Last Character (
+) match.
+The starting size is: 190
+The compressed size is: 128
+The compressed/uncompressed size is: 190
+Files both have length 190
+First character (u) and Last Character (
+) match.
+The starting size is: 204
+The compressed size is: 132
+The compressed/uncompressed size is: 204
+Files both have length 204
+First character (u) and Last Character (
+) match.
+The starting size is: 219
+The compressed size is: 133
+The compressed/uncompressed size is: 219
+Files both have length 219
+First character (u) and Last Character (
+) match.
+The starting size is: 235
+The compressed size is: 136
+The compressed/uncompressed size is: 235
+Files both have length 235
+First character (u) and Last Character (
+) match.
+The starting size is: 252
+The compressed size is: 137
+The compressed/uncompressed size is: 252
+Files both have length 252
+First character (u) and Last Character (
+) match.
+The starting size is: 270
+The compressed size is: 141
+The compressed/uncompressed size is: 270
+Files both have length 270
+First character (u) and Last Character (
+) match.
+The starting size is: 289
+The compressed size is: 142
+The compressed/uncompressed size is: 289
+Files both have length 289
+First character (u) and Last Character (
+) match.
+The starting size is: 309
+The compressed size is: 145
+The compressed/uncompressed size is: 309
+Files both have length 309
+First character (u) and Last Character (
+) match.
+The starting size is: 330
+The compressed size is: 146
+The compressed/uncompressed size is: 330
+Files both have length 330
+First character (u) and Last Character (
+) match.
+The starting size is: 352
+The compressed size is: 150
+The compressed/uncompressed size is: 352
+Files both have length 352
+First character (u) and Last Character (
+) match.
+The starting size is: 375
+The compressed size is: 151
+The compressed/uncompressed size is: 375
+Files both have length 375
+First character (u) and Last Character (
+) match.
+The starting size is: 399
+The compressed size is: 154
+The compressed/uncompressed size is: 399
+Files both have length 399
+First character (u) and Last Character (
+) match.
+The starting size is: 424
+The compressed size is: 155
+The compressed/uncompressed size is: 424
+Files both have length 424
+First character (u) and Last Character (
+) match.
+The starting size is: 450
+The compressed size is: 159
+The compressed/uncompressed size is: 450
+Files both have length 450
+First character (u) and Last Character (
+) match.
+exit 0
Added: test-suite/trunk/External/SPEC/CINT95/130.li/130.li.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT95/130.li/130.li.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT95/130.li/130.li.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT95/130.li/130.li.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,53 @@
+XLISP version 1.6, Copyright (c) 1985, by David Betz
+> 1> 2> 3> 3> 2> MAKE-ARRAY-2D
+> > 1> 2> MAKE-ARRAY-INIT
+> > 1> 2> MAKE-ARRAY-LIST
+> > 1> 2> 2> 1> ARRAY-INIT-ELEM
+> > 1> 2> 2> 1> ARRAY-INIT-LIST
+> > 1> PROCLAIM
+> > FORMAT
+> > DECLARE
+> > TIME
+> > THE
+> > 2> PUSH
+> > UNLESS
+> > DEFVAR
+> DEFCONSTANT
+> > AREF2D
+> > FIRST
+> SECOND
+> > SVREF
+> > 2> 3> 3> 2> FLOOR
+> > FLOORD
+> > FLOATD
+> > 1> 2> 3> 3> 2> MEXPT
+> > 1> INCF
+> > 1> 2> 2> COPY-TREE
+> > 1> SCHAR
+> > 1> GENTEMP
+> > > > > > > > > > FOO
+> > 1> 4> 5> 4> 3> 4> 2> ADD-LEMMA
+> > 1> 3> 2> 3> ADD-LEMMA-LST
+> > 1> 3> 5> 4> 2> 4> APPLY-SUBST
+> > 1> 3> 2> 4> APPLY-SUBST-LST
+> > 1> 2> FALSEP
+> > 1> 2> ONE-WAY-UNIFY
+> > 1> 3> 5> 4> 7> 5> 2> 3> 2> 4> 3> 4> 2> ONE-WAY-UNIFY1
+> > 1> 3> 2> 4> 3> 4> 2> ONE-WAY-UNIFY1-&LST
+> > 1> 1> 3> 2> 5> 4> 5> 5> REWRITE
+> > 1> 3> 2> 4> REWRITE-ARGS
+> > 1> 3> 2> 3> 2> REWRITE-WITH-LEMMAS
+> > 1> 2> 5> 7> 4> 5> 6> 4> 5> 4> 5> 4> 5> 4> 5> 6> 4> 5> 6> 4> 5> 6> 6> 1> 1> 2> 5> 4> 5> 4> 5> 4> 5> 4> 5> 6> 4> 5> 6> 4> 5> 6> 4> 5> 6> 4> 5> 6> 6> 1> 1> 2> 5> 7> 6> 4> 5> 6> 7> 6> 4> 5> 6> 4> 5> 7> 6> 4> 5> 6> 6> 4> 6> 5> 6> 4> 5> 6> 4> 6> 5> 4> 6> 5> 6> 4> 5> 1> 1> 1> 2> 6> 5> 6> 4> 6> 5> 4> 5> 6> 7> 4> 6> 5> 7> 6> 7> 4> 6> 5> 4> 6> 5> 4> 5> 6> 4> 5> 6> 4> 6> 5> 4> 6> 5> 6> 4> 6> 5> 6> 1> 1> 2> 5> 6> 4> 5> 6> 4> 5> 4> 5> 4> 5> 6> 4> 6> 5> 4> 5> 6> 4> 5> 6> 4> 5> 6> 4> 5> 4> 5> 6> 4> 6> 5> 4> 6> 5> 4> 6> 5> 6> 1> 1> 2> 6> 5> 7> 4> 5> 4> 6> 5> 4> 5> 4> 6> 5> 6> 7> 4> 6> 5> 6> 6> 4> 6> 5> 4> 7> 7> 7> 6> 5> 4> 5> 4> 6> 5> 6> 4> 6> 5> 4> 6> 5> 1> 1> 1> 2> 6> 5> 4> 5> 6> 4> 6> 5> 4> 6> 5> 4> 6> 5> 4> 6> 5> 4> 6> 5> 6> 4> 5> 4> 6> 5> 4> 6> 5> 4> 6> 5> 6> 4> 5> 4> 5> 6> 4> 6> 5> 7> 6> 1> 1> 1> 2> 6> 5> 4> 5> 8> 7> 4> 5> 6> 4> 5> 6> 4> 5> 6> 7> 4> 5> 4> 5> 6> 7> 4> 6> 5> 4> 6> 5> 6> 6> 6> 6> 7> 6> 7> 4> 6> 5> 4> 5> 4> 5> 1> 1> 2> 7> 8> 10> 11> 5> 4> 6> 5> 4> 6> 5> 4> 6> 5> 6> 4>
5> 6> 6> 4> 6> 5> 6> 6> 7> 7> 8> 4> 6> 5> 6> 8> 7> 6> 7> 1> 1> 1> 1> 2> 5> 6> 6> 4> 6> 5> 6> 6> 4> 5> 6> 6> 7> 8> 7> 4> 6> 5> 6> 6> 4> 5> 6> 6> 4> 5> 6> 6> 4> 5> 6> 6> 7> 4> 6> 5> 6> 6> 4> 5> 6> 6> BOYER-SETUP
+> > > > 1> 3> 2> 3> 2> 3> 2> 4> 3> 6> 5> 6> 4> 6> 5> 6> 4> 7> 8> 7> 6> 7> 7> 8> 2> TAUTOLOGYP
+> > 1> 2> TAUTP
+> > 1> 2> 3> 4> 8> 6> 8> 6> 9> 6> 7> 6> 7> 4> 7> 6> 2> 2> 2> BOYER-TEST
+> > > > > > > > > > > > > > > > > > > > 1> 2> TRUEP
+> > T
+> (IMPLIES (AND (IMPLIES (F (PLUS (PLUS A B) (PLUS C (ZERO)))) (F (TIMES (TIMES A B) (PLUS C D)))) (IMPLIES (F (TIMES (TIMES A B) (PLUS C D))) (F (REVERSE (APPEND (APPEND A B) (NIL)))))) (IMPLIES (F (PLUS (PLUS A B) (PLUS C (ZERO)))) (F (REVERSE (APPEND (APPEND A B) (NIL))))))
+NIL
+NIL
+> (DONE BOYER-TEST)
+(DONE BOYER-TEST)
+> (ALL DONE)
+(ALL DONE)
+> exit 0
Added: test-suite/trunk/External/SPEC/CINT95/130.li/130.li.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT95/130.li/130.li.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT95/130.li/130.li.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CINT95/130.li/130.li.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,99 @@
+XLISP version 1.6, Copyright (c) 1985, by David Betz
+> > > > > > > > > 1> CADAR
+> > > 1> 2> 2> 2> THREAT
+> > > 1> 2> 2> CONFLICT
+> > > > 1> 2> 2> 2> 2> 2> 2> 2> 2> 4> 2> 2> 2> 3> 4> 4> 2> 2> 2> 4> 3> QUEENS
+> ((1 1) (2 5) (3 8) (4 6) (5 3) (6 7) (7 2) (8 4))
+((1 1) (2 6) (3 8) (4 3) (5 7) (6 4) (7 2) (8 5))
+((1 1) (2 7) (3 4) (4 6) (5 8) (6 2) (7 5) (8 3))
+((1 1) (2 7) (3 5) (4 8) (5 2) (6 4) (7 6) (8 3))
+((1 2) (2 4) (3 6) (4 8) (5 3) (6 1) (7 7) (8 5))
+((1 2) (2 5) (3 7) (4 1) (5 3) (6 8) (7 6) (8 4))
+((1 2) (2 5) (3 7) (4 4) (5 1) (6 8) (7 6) (8 3))
+((1 2) (2 6) (3 1) (4 7) (5 4) (6 8) (7 3) (8 5))
+((1 2) (2 6) (3 8) (4 3) (5 1) (6 4) (7 7) (8 5))
+((1 2) (2 7) (3 3) (4 6) (5 8) (6 5) (7 1) (8 4))
+((1 2) (2 7) (3 5) (4 8) (5 1) (6 4) (7 6) (8 3))
+((1 2) (2 8) (3 6) (4 1) (5 3) (6 5) (7 7) (8 4))
+((1 3) (2 1) (3 7) (4 5) (5 8) (6 2) (7 4) (8 6))
+((1 3) (2 5) (3 2) (4 8) (5 1) (6 7) (7 4) (8 6))
+((1 3) (2 5) (3 2) (4 8) (5 6) (6 4) (7 7) (8 1))
+((1 3) (2 5) (3 7) (4 1) (5 4) (6 2) (7 8) (8 6))
+((1 3) (2 5) (3 8) (4 4) (5 1) (6 7) (7 2) (8 6))
+((1 3) (2 6) (3 2) (4 5) (5 8) (6 1) (7 7) (8 4))
+((1 3) (2 6) (3 2) (4 7) (5 1) (6 4) (7 8) (8 5))
+((1 3) (2 6) (3 2) (4 7) (5 5) (6 1) (7 8) (8 4))
+((1 3) (2 6) (3 4) (4 1) (5 8) (6 5) (7 7) (8 2))
+((1 3) (2 6) (3 4) (4 2) (5 8) (6 5) (7 7) (8 1))
+((1 3) (2 6) (3 8) (4 1) (5 4) (6 7) (7 5) (8 2))
+((1 3) (2 6) (3 8) (4 1) (5 5) (6 7) (7 2) (8 4))
+((1 3) (2 6) (3 8) (4 2) (5 4) (6 1) (7 7) (8 5))
+((1 3) (2 7) (3 2) (4 8) (5 5) (6 1) (7 4) (8 6))
+((1 3) (2 7) (3 2) (4 8) (5 6) (6 4) (7 1) (8 5))
+((1 3) (2 8) (3 4) (4 7) (5 1) (6 6) (7 2) (8 5))
+((1 4) (2 1) (3 5) (4 8) (5 2) (6 7) (7 3) (8 6))
+((1 4) (2 1) (3 5) (4 8) (5 6) (6 3) (7 7) (8 2))
+((1 4) (2 2) (3 5) (4 8) (5 6) (6 1) (7 3) (8 7))
+((1 4) (2 2) (3 7) (4 3) (5 6) (6 8) (7 1) (8 5))
+((1 4) (2 2) (3 7) (4 3) (5 6) (6 8) (7 5) (8 1))
+((1 4) (2 2) (3 7) (4 5) (5 1) (6 8) (7 6) (8 3))
+((1 4) (2 2) (3 8) (4 5) (5 7) (6 1) (7 3) (8 6))
+((1 4) (2 2) (3 8) (4 6) (5 1) (6 3) (7 5) (8 7))
+((1 4) (2 6) (3 1) (4 5) (5 2) (6 8) (7 3) (8 7))
+((1 4) (2 6) (3 8) (4 2) (5 7) (6 1) (7 3) (8 5))
+((1 4) (2 6) (3 8) (4 3) (5 1) (6 7) (7 5) (8 2))
+((1 4) (2 7) (3 1) (4 8) (5 5) (6 2) (7 6) (8 3))
+((1 4) (2 7) (3 3) (4 8) (5 2) (6 5) (7 1) (8 6))
+((1 4) (2 7) (3 5) (4 2) (5 6) (6 1) (7 3) (8 8))
+((1 4) (2 7) (3 5) (4 3) (5 1) (6 6) (7 8) (8 2))
+((1 4) (2 8) (3 1) (4 3) (5 6) (6 2) (7 7) (8 5))
+((1 4) (2 8) (3 1) (4 5) (5 7) (6 2) (7 6) (8 3))
+((1 4) (2 8) (3 5) (4 3) (5 1) (6 7) (7 2) (8 6))
+((1 5) (2 1) (3 4) (4 6) (5 8) (6 2) (7 7) (8 3))
+((1 5) (2 1) (3 8) (4 4) (5 2) (6 7) (7 3) (8 6))
+((1 5) (2 1) (3 8) (4 6) (5 3) (6 7) (7 2) (8 4))
+((1 5) (2 2) (3 4) (4 6) (5 8) (6 3) (7 1) (8 7))
+((1 5) (2 2) (3 4) (4 7) (5 3) (6 8) (7 6) (8 1))
+((1 5) (2 2) (3 6) (4 1) (5 7) (6 4) (7 8) (8 3))
+((1 5) (2 2) (3 8) (4 1) (5 4) (6 7) (7 3) (8 6))
+((1 5) (2 3) (3 1) (4 6) (5 8) (6 2) (7 4) (8 7))
+((1 5) (2 3) (3 1) (4 7) (5 2) (6 8) (7 6) (8 4))
+((1 5) (2 3) (3 8) (4 4) (5 7) (6 1) (7 6) (8 2))
+((1 5) (2 7) (3 1) (4 3) (5 8) (6 6) (7 4) (8 2))
+((1 5) (2 7) (3 1) (4 4) (5 2) (6 8) (7 6) (8 3))
+((1 5) (2 7) (3 2) (4 4) (5 8) (6 1) (7 3) (8 6))
+((1 5) (2 7) (3 2) (4 6) (5 3) (6 1) (7 4) (8 8))
+((1 5) (2 7) (3 2) (4 6) (5 3) (6 1) (7 8) (8 4))
+((1 5) (2 7) (3 4) (4 1) (5 3) (6 8) (7 6) (8 2))
+((1 5) (2 8) (3 4) (4 1) (5 3) (6 6) (7 2) (8 7))
+((1 5) (2 8) (3 4) (4 1) (5 7) (6 2) (7 6) (8 3))
+((1 6) (2 1) (3 5) (4 2) (5 8) (6 3) (7 7) (8 4))
+((1 6) (2 2) (3 7) (4 1) (5 3) (6 5) (7 8) (8 4))
+((1 6) (2 2) (3 7) (4 1) (5 4) (6 8) (7 5) (8 3))
+((1 6) (2 3) (3 1) (4 7) (5 5) (6 8) (7 2) (8 4))
+((1 6) (2 3) (3 1) (4 8) (5 4) (6 2) (7 7) (8 5))
+((1 6) (2 3) (3 1) (4 8) (5 5) (6 2) (7 4) (8 7))
+((1 6) (2 3) (3 5) (4 7) (5 1) (6 4) (7 2) (8 8))
+((1 6) (2 3) (3 5) (4 8) (5 1) (6 4) (7 2) (8 7))
+((1 6) (2 3) (3 7) (4 2) (5 4) (6 8) (7 1) (8 5))
+((1 6) (2 3) (3 7) (4 2) (5 8) (6 5) (7 1) (8 4))
+((1 6) (2 3) (3 7) (4 4) (5 1) (6 8) (7 2) (8 5))
+((1 6) (2 4) (3 1) (4 5) (5 8) (6 2) (7 7) (8 3))
+((1 6) (2 4) (3 2) (4 8) (5 5) (6 7) (7 1) (8 3))
+((1 6) (2 4) (3 7) (4 1) (5 3) (6 5) (7 2) (8 8))
+((1 6) (2 4) (3 7) (4 1) (5 8) (6 2) (7 5) (8 3))
+((1 6) (2 8) (3 2) (4 4) (5 1) (6 7) (7 5) (8 3))
+((1 7) (2 1) (3 3) (4 8) (5 6) (6 4) (7 2) (8 5))
+((1 7) (2 2) (3 4) (4 1) (5 8) (6 5) (7 3) (8 6))
+((1 7) (2 2) (3 6) (4 3) (5 1) (6 4) (7 8) (8 5))
+((1 7) (2 3) (3 1) (4 6) (5 8) (6 5) (7 2) (8 4))
+((1 7) (2 3) (3 8) (4 2) (5 5) (6 1) (7 6) (8 4))
+((1 7) (2 4) (3 2) (4 5) (5 8) (6 1) (7 3) (8 6))
+((1 7) (2 4) (3 2) (4 8) (5 6) (6 1) (7 3) (8 5))
+((1 7) (2 5) (3 3) (4 1) (5 6) (6 8) (7 2) (8 4))
+((1 8) (2 2) (3 4) (4 1) (5 7) (6 5) (7 3) (8 6))
+((1 8) (2 2) (3 5) (4 3) (5 1) (6 7) (7 4) (8 6))
+((1 8) (2 3) (3 1) (4 6) (5 2) (6 5) (7 7) (8 4))
+((1 8) (2 4) (3 1) (4 3) (5 6) (6 2) (7 7) (8 5))
+DONE
+> exit 0
Added: test-suite/trunk/External/SPEC/CINT95/132.ijpeg/132.ijpeg.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT95/132.ijpeg/132.ijpeg.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT95/132.ijpeg/132.ijpeg.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT95/132.ijpeg/132.ijpeg.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,2433 @@
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 7764
+compression parameters:
+ quality : 90
+ optimize_coding : 0
+ smoothing_factor: 90
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4623
+L2 norm = 42563
+checksum: 196
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 7333
+compression parameters:
+ quality : 90
+ optimize_coding : 1
+ smoothing_factor: 90
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4623
+L2 norm = 42563
+checksum: 196
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 7881
+compression parameters:
+ quality : 90
+ optimize_coding : 0
+ smoothing_factor: 80
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4531
+L2 norm = 40837
+checksum: 18
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 7457
+compression parameters:
+ quality : 90
+ optimize_coding : 1
+ smoothing_factor: 80
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4531
+L2 norm = 40837
+checksum: 18
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 8043
+compression parameters:
+ quality : 90
+ optimize_coding : 0
+ smoothing_factor: 70
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4442
+L2 norm = 39010
+checksum: 111
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 7597
+compression parameters:
+ quality : 90
+ optimize_coding : 1
+ smoothing_factor: 70
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4442
+L2 norm = 39010
+checksum: 111
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 8239
+compression parameters:
+ quality : 90
+ optimize_coding : 0
+ smoothing_factor: 60
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4277
+L2 norm = 35917
+checksum: 202
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 7767
+compression parameters:
+ quality : 90
+ optimize_coding : 1
+ smoothing_factor: 60
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4277
+L2 norm = 35917
+checksum: 202
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 8469
+compression parameters:
+ quality : 90
+ optimize_coding : 0
+ smoothing_factor: 50
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4322
+L2 norm = 35880
+checksum: 105
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 7978
+compression parameters:
+ quality : 90
+ optimize_coding : 1
+ smoothing_factor: 50
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4322
+L2 norm = 35880
+checksum: 105
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 8793
+compression parameters:
+ quality : 90
+ optimize_coding : 0
+ smoothing_factor: 40
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4185
+L2 norm = 33935
+checksum: 52
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 8257
+compression parameters:
+ quality : 90
+ optimize_coding : 1
+ smoothing_factor: 40
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4185
+L2 norm = 33935
+checksum: 52
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 9205
+compression parameters:
+ quality : 90
+ optimize_coding : 0
+ smoothing_factor: 30
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4132
+L2 norm = 33516
+checksum: 5
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 8626
+compression parameters:
+ quality : 90
+ optimize_coding : 1
+ smoothing_factor: 30
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4132
+L2 norm = 33516
+checksum: 5
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 9578
+compression parameters:
+ quality : 90
+ optimize_coding : 0
+ smoothing_factor: 20
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4043
+L2 norm = 33223
+checksum: 86
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 8964
+compression parameters:
+ quality : 90
+ optimize_coding : 1
+ smoothing_factor: 20
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4043
+L2 norm = 33223
+checksum: 86
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5665
+compression parameters:
+ quality : 80
+ optimize_coding : 0
+ smoothing_factor: 90
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4871
+L2 norm = 45361
+checksum: 152
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5349
+compression parameters:
+ quality : 80
+ optimize_coding : 1
+ smoothing_factor: 90
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4871
+L2 norm = 45361
+checksum: 152
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5743
+compression parameters:
+ quality : 80
+ optimize_coding : 0
+ smoothing_factor: 80
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4779
+L2 norm = 43215
+checksum: 138
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5425
+compression parameters:
+ quality : 80
+ optimize_coding : 1
+ smoothing_factor: 80
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4779
+L2 norm = 43215
+checksum: 138
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5847
+compression parameters:
+ quality : 80
+ optimize_coding : 0
+ smoothing_factor: 70
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4671
+L2 norm = 41253
+checksum: 126
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5549
+compression parameters:
+ quality : 80
+ optimize_coding : 1
+ smoothing_factor: 70
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4671
+L2 norm = 41253
+checksum: 126
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5931
+compression parameters:
+ quality : 80
+ optimize_coding : 0
+ smoothing_factor: 60
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4559
+L2 norm = 39597
+checksum: 68
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5610
+compression parameters:
+ quality : 80
+ optimize_coding : 1
+ smoothing_factor: 60
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4559
+L2 norm = 39597
+checksum: 68
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 6023
+compression parameters:
+ quality : 80
+ optimize_coding : 0
+ smoothing_factor: 50
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4502
+L2 norm = 39136
+checksum: 55
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5712
+compression parameters:
+ quality : 80
+ optimize_coding : 1
+ smoothing_factor: 50
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4502
+L2 norm = 39136
+checksum: 55
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 6097
+compression parameters:
+ quality : 80
+ optimize_coding : 0
+ smoothing_factor: 40
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4388
+L2 norm = 37316
+checksum: 57
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5781
+compression parameters:
+ quality : 80
+ optimize_coding : 1
+ smoothing_factor: 40
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4388
+L2 norm = 37316
+checksum: 57
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 6183
+compression parameters:
+ quality : 80
+ optimize_coding : 0
+ smoothing_factor: 30
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4296
+L2 norm = 35626
+checksum: 125
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5848
+compression parameters:
+ quality : 80
+ optimize_coding : 1
+ smoothing_factor: 30
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4296
+L2 norm = 35626
+checksum: 125
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 6266
+compression parameters:
+ quality : 80
+ optimize_coding : 0
+ smoothing_factor: 20
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4304
+L2 norm = 34860
+checksum: 81
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5939
+compression parameters:
+ quality : 80
+ optimize_coding : 1
+ smoothing_factor: 20
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4304
+L2 norm = 34860
+checksum: 81
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4763
+compression parameters:
+ quality : 70
+ optimize_coding : 0
+ smoothing_factor: 90
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5255
+L2 norm = 51907
+checksum: 152
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4427
+compression parameters:
+ quality : 70
+ optimize_coding : 1
+ smoothing_factor: 90
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5255
+L2 norm = 51907
+checksum: 152
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4843
+compression parameters:
+ quality : 70
+ optimize_coding : 0
+ smoothing_factor: 80
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5217
+L2 norm = 50011
+checksum: 240
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4511
+compression parameters:
+ quality : 70
+ optimize_coding : 1
+ smoothing_factor: 80
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5217
+L2 norm = 50011
+checksum: 240
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4910
+compression parameters:
+ quality : 70
+ optimize_coding : 0
+ smoothing_factor: 70
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5089
+L2 norm = 47797
+checksum: 162
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4575
+compression parameters:
+ quality : 70
+ optimize_coding : 1
+ smoothing_factor: 70
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5089
+L2 norm = 47797
+checksum: 162
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5005
+compression parameters:
+ quality : 70
+ optimize_coding : 0
+ smoothing_factor: 60
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4958
+L2 norm = 46258
+checksum: 77
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4665
+compression parameters:
+ quality : 70
+ optimize_coding : 1
+ smoothing_factor: 60
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4958
+L2 norm = 46258
+checksum: 77
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5106
+compression parameters:
+ quality : 70
+ optimize_coding : 0
+ smoothing_factor: 50
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4953
+L2 norm = 44915
+checksum: 164
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4783
+compression parameters:
+ quality : 70
+ optimize_coding : 1
+ smoothing_factor: 50
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4953
+L2 norm = 44915
+checksum: 164
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5198
+compression parameters:
+ quality : 70
+ optimize_coding : 0
+ smoothing_factor: 40
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4935
+L2 norm = 44367
+checksum: 172
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4877
+compression parameters:
+ quality : 70
+ optimize_coding : 1
+ smoothing_factor: 40
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4935
+L2 norm = 44367
+checksum: 172
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5289
+compression parameters:
+ quality : 70
+ optimize_coding : 0
+ smoothing_factor: 30
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4867
+L2 norm = 43933
+checksum: 116
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4965
+compression parameters:
+ quality : 70
+ optimize_coding : 1
+ smoothing_factor: 30
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4867
+L2 norm = 43933
+checksum: 116
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5363
+compression parameters:
+ quality : 70
+ optimize_coding : 0
+ smoothing_factor: 20
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4753
+L2 norm = 41711
+checksum: 126
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 5034
+compression parameters:
+ quality : 70
+ optimize_coding : 1
+ smoothing_factor: 20
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 4753
+L2 norm = 41711
+checksum: 126
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4115
+compression parameters:
+ quality : 60
+ optimize_coding : 0
+ smoothing_factor: 90
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5532
+L2 norm = 58790
+checksum: 141
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3761
+compression parameters:
+ quality : 60
+ optimize_coding : 1
+ smoothing_factor: 90
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5532
+L2 norm = 58790
+checksum: 141
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4167
+compression parameters:
+ quality : 60
+ optimize_coding : 0
+ smoothing_factor: 80
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5526
+L2 norm = 58858
+checksum: 143
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3812
+compression parameters:
+ quality : 60
+ optimize_coding : 1
+ smoothing_factor: 80
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5526
+L2 norm = 58858
+checksum: 143
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4230
+compression parameters:
+ quality : 60
+ optimize_coding : 0
+ smoothing_factor: 70
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5545
+L2 norm = 57705
+checksum: 26
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3875
+compression parameters:
+ quality : 60
+ optimize_coding : 1
+ smoothing_factor: 70
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5545
+L2 norm = 57705
+checksum: 26
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4288
+compression parameters:
+ quality : 60
+ optimize_coding : 0
+ smoothing_factor: 60
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5506
+L2 norm = 58010
+checksum: 193
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3940
+compression parameters:
+ quality : 60
+ optimize_coding : 1
+ smoothing_factor: 60
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5506
+L2 norm = 58010
+checksum: 193
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4357
+compression parameters:
+ quality : 60
+ optimize_coding : 0
+ smoothing_factor: 50
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5462
+L2 norm = 56422
+checksum: 95
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4008
+compression parameters:
+ quality : 60
+ optimize_coding : 1
+ smoothing_factor: 50
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5462
+L2 norm = 56422
+checksum: 95
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4455
+compression parameters:
+ quality : 60
+ optimize_coding : 0
+ smoothing_factor: 40
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5285
+L2 norm = 52035
+checksum: 44
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4106
+compression parameters:
+ quality : 60
+ optimize_coding : 1
+ smoothing_factor: 40
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5285
+L2 norm = 52035
+checksum: 44
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4554
+compression parameters:
+ quality : 60
+ optimize_coding : 0
+ smoothing_factor: 30
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5143
+L2 norm = 49905
+checksum: 138
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4210
+compression parameters:
+ quality : 60
+ optimize_coding : 1
+ smoothing_factor: 30
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5143
+L2 norm = 49905
+checksum: 138
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4667
+compression parameters:
+ quality : 60
+ optimize_coding : 0
+ smoothing_factor: 20
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5220
+L2 norm = 51008
+checksum: 1
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4315
+compression parameters:
+ quality : 60
+ optimize_coding : 1
+ smoothing_factor: 20
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5220
+L2 norm = 51008
+checksum: 1
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3663
+compression parameters:
+ quality : 50
+ optimize_coding : 0
+ smoothing_factor: 90
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5963
+L2 norm = 65627
+checksum: 44
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3294
+compression parameters:
+ quality : 50
+ optimize_coding : 1
+ smoothing_factor: 90
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5963
+L2 norm = 65627
+checksum: 44
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3701
+compression parameters:
+ quality : 50
+ optimize_coding : 0
+ smoothing_factor: 80
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5895
+L2 norm = 63221
+checksum: 40
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3332
+compression parameters:
+ quality : 50
+ optimize_coding : 1
+ smoothing_factor: 80
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5895
+L2 norm = 63221
+checksum: 40
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3739
+compression parameters:
+ quality : 50
+ optimize_coding : 0
+ smoothing_factor: 70
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5767
+L2 norm = 60529
+checksum: 180
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3379
+compression parameters:
+ quality : 50
+ optimize_coding : 1
+ smoothing_factor: 70
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5767
+L2 norm = 60529
+checksum: 180
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3786
+compression parameters:
+ quality : 50
+ optimize_coding : 0
+ smoothing_factor: 60
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5734
+L2 norm = 60098
+checksum: 21
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3419
+compression parameters:
+ quality : 50
+ optimize_coding : 1
+ smoothing_factor: 60
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5734
+L2 norm = 60098
+checksum: 21
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3824
+compression parameters:
+ quality : 50
+ optimize_coding : 0
+ smoothing_factor: 50
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5623
+L2 norm = 57883
+checksum: 32
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3457
+compression parameters:
+ quality : 50
+ optimize_coding : 1
+ smoothing_factor: 50
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5623
+L2 norm = 57883
+checksum: 32
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3881
+compression parameters:
+ quality : 50
+ optimize_coding : 0
+ smoothing_factor: 40
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5692
+L2 norm = 59966
+checksum: 215
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3525
+compression parameters:
+ quality : 50
+ optimize_coding : 1
+ smoothing_factor: 40
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5692
+L2 norm = 59966
+checksum: 215
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3922
+compression parameters:
+ quality : 50
+ optimize_coding : 0
+ smoothing_factor: 30
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5761
+L2 norm = 62029
+checksum: 204
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3562
+compression parameters:
+ quality : 50
+ optimize_coding : 1
+ smoothing_factor: 30
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5761
+L2 norm = 62029
+checksum: 204
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 4007
+compression parameters:
+ quality : 50
+ optimize_coding : 0
+ smoothing_factor: 20
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5561
+L2 norm = 57239
+checksum: 52
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3654
+compression parameters:
+ quality : 50
+ optimize_coding : 1
+ smoothing_factor: 20
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5561
+L2 norm = 57239
+checksum: 52
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3277
+compression parameters:
+ quality : 40
+ optimize_coding : 0
+ smoothing_factor: 90
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6057
+L2 norm = 70985
+checksum: 18
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2881
+compression parameters:
+ quality : 40
+ optimize_coding : 1
+ smoothing_factor: 90
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6057
+L2 norm = 70985
+checksum: 18
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3301
+compression parameters:
+ quality : 40
+ optimize_coding : 0
+ smoothing_factor: 80
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5946
+L2 norm = 67658
+checksum: 253
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2905
+compression parameters:
+ quality : 40
+ optimize_coding : 1
+ smoothing_factor: 80
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5946
+L2 norm = 67658
+checksum: 253
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3329
+compression parameters:
+ quality : 40
+ optimize_coding : 0
+ smoothing_factor: 70
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5830
+L2 norm = 65674
+checksum: 85
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2937
+compression parameters:
+ quality : 40
+ optimize_coding : 1
+ smoothing_factor: 70
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5830
+L2 norm = 65674
+checksum: 85
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3359
+compression parameters:
+ quality : 40
+ optimize_coding : 0
+ smoothing_factor: 60
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5796
+L2 norm = 64524
+checksum: 3
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2965
+compression parameters:
+ quality : 40
+ optimize_coding : 1
+ smoothing_factor: 60
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5796
+L2 norm = 64524
+checksum: 3
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3391
+compression parameters:
+ quality : 40
+ optimize_coding : 0
+ smoothing_factor: 50
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5688
+L2 norm = 63068
+checksum: 143
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3005
+compression parameters:
+ quality : 40
+ optimize_coding : 1
+ smoothing_factor: 50
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5688
+L2 norm = 63068
+checksum: 143
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3436
+compression parameters:
+ quality : 40
+ optimize_coding : 0
+ smoothing_factor: 40
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5769
+L2 norm = 63617
+checksum: 136
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3053
+compression parameters:
+ quality : 40
+ optimize_coding : 1
+ smoothing_factor: 40
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5769
+L2 norm = 63617
+checksum: 136
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3461
+compression parameters:
+ quality : 40
+ optimize_coding : 0
+ smoothing_factor: 30
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5703
+L2 norm = 61471
+checksum: 124
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3076
+compression parameters:
+ quality : 40
+ optimize_coding : 1
+ smoothing_factor: 30
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5703
+L2 norm = 61471
+checksum: 124
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3486
+compression parameters:
+ quality : 40
+ optimize_coding : 0
+ smoothing_factor: 20
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5636
+L2 norm = 60450
+checksum: 1
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3108
+compression parameters:
+ quality : 40
+ optimize_coding : 1
+ smoothing_factor: 20
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 5636
+L2 norm = 60450
+checksum: 1
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2897
+compression parameters:
+ quality : 30
+ optimize_coding : 0
+ smoothing_factor: 90
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6467
+L2 norm = 77629
+checksum: 148
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2462
+compression parameters:
+ quality : 30
+ optimize_coding : 1
+ smoothing_factor: 90
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6467
+L2 norm = 77629
+checksum: 148
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2917
+compression parameters:
+ quality : 30
+ optimize_coding : 0
+ smoothing_factor: 80
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6418
+L2 norm = 75190
+checksum: 139
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2481
+compression parameters:
+ quality : 30
+ optimize_coding : 1
+ smoothing_factor: 80
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6418
+L2 norm = 75190
+checksum: 139
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2938
+compression parameters:
+ quality : 30
+ optimize_coding : 0
+ smoothing_factor: 70
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6350
+L2 norm = 72920
+checksum: 5
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2509
+compression parameters:
+ quality : 30
+ optimize_coding : 1
+ smoothing_factor: 70
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6350
+L2 norm = 72920
+checksum: 5
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2961
+compression parameters:
+ quality : 30
+ optimize_coding : 0
+ smoothing_factor: 60
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6290
+L2 norm = 71144
+checksum: 61
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2530
+compression parameters:
+ quality : 30
+ optimize_coding : 1
+ smoothing_factor: 60
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6290
+L2 norm = 71144
+checksum: 61
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2981
+compression parameters:
+ quality : 30
+ optimize_coding : 0
+ smoothing_factor: 50
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6289
+L2 norm = 71519
+checksum: 16
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2556
+compression parameters:
+ quality : 30
+ optimize_coding : 1
+ smoothing_factor: 50
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6289
+L2 norm = 71519
+checksum: 16
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3014
+compression parameters:
+ quality : 30
+ optimize_coding : 0
+ smoothing_factor: 40
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6256
+L2 norm = 70870
+checksum: 207
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2587
+compression parameters:
+ quality : 30
+ optimize_coding : 1
+ smoothing_factor: 40
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6256
+L2 norm = 70870
+checksum: 207
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3054
+compression parameters:
+ quality : 30
+ optimize_coding : 0
+ smoothing_factor: 30
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6211
+L2 norm = 69945
+checksum: 28
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2631
+compression parameters:
+ quality : 30
+ optimize_coding : 1
+ smoothing_factor: 30
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6211
+L2 norm = 69945
+checksum: 28
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 3086
+compression parameters:
+ quality : 30
+ optimize_coding : 0
+ smoothing_factor: 20
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6188
+L2 norm = 71604
+checksum: 201
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2670
+compression parameters:
+ quality : 30
+ optimize_coding : 1
+ smoothing_factor: 20
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 6188
+L2 norm = 71604
+checksum: 201
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2415
+compression parameters:
+ quality : 20
+ optimize_coding : 0
+ smoothing_factor: 90
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 7121
+L2 norm = 94315
+checksum: 2
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 1923
+compression parameters:
+ quality : 20
+ optimize_coding : 1
+ smoothing_factor: 90
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 7121
+L2 norm = 94315
+checksum: 2
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2434
+compression parameters:
+ quality : 20
+ optimize_coding : 0
+ smoothing_factor: 80
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 7162
+L2 norm = 95482
+checksum: 125
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 1945
+compression parameters:
+ quality : 20
+ optimize_coding : 1
+ smoothing_factor: 80
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 7162
+L2 norm = 95482
+checksum: 125
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2456
+compression parameters:
+ quality : 20
+ optimize_coding : 0
+ smoothing_factor: 70
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 7120
+L2 norm = 93500
+checksum: 187
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 1962
+compression parameters:
+ quality : 20
+ optimize_coding : 1
+ smoothing_factor: 70
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 7120
+L2 norm = 93500
+checksum: 187
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2470
+compression parameters:
+ quality : 20
+ optimize_coding : 0
+ smoothing_factor: 60
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 7171
+L2 norm = 93911
+checksum: 202
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 1977
+compression parameters:
+ quality : 20
+ optimize_coding : 1
+ smoothing_factor: 60
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 7171
+L2 norm = 93911
+checksum: 202
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2476
+compression parameters:
+ quality : 20
+ optimize_coding : 0
+ smoothing_factor: 50
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 7216
+L2 norm = 94350
+checksum: 239
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 1982
+compression parameters:
+ quality : 20
+ optimize_coding : 1
+ smoothing_factor: 50
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 7216
+L2 norm = 94350
+checksum: 239
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2496
+compression parameters:
+ quality : 20
+ optimize_coding : 0
+ smoothing_factor: 40
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 7167
+L2 norm = 92579
+checksum: 244
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2007
+compression parameters:
+ quality : 20
+ optimize_coding : 1
+ smoothing_factor: 40
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 7167
+L2 norm = 92579
+checksum: 244
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2524
+compression parameters:
+ quality : 20
+ optimize_coding : 0
+ smoothing_factor: 30
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 7157
+L2 norm = 92067
+checksum: 166
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2032
+compression parameters:
+ quality : 20
+ optimize_coding : 1
+ smoothing_factor: 30
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 7157
+L2 norm = 92067
+checksum: 166
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2539
+compression parameters:
+ quality : 20
+ optimize_coding : 0
+ smoothing_factor: 20
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 7182
+L2 norm = 92028
+checksum: 245
+
+image filename: "vigo.ppm"
+compression statistics:
+ uncompressed data size: 101469
+ compressed data size: 2051
+compression parameters:
+ quality : 20
+ optimize_coding : 1
+ smoothing_factor: 20
+ subimage : ul(0,0) lr(1,1)
+decompression parameters:
+ quantize_colors : 0
+ do_fancy_upsampling : 0
+ desired_number_of_colors: 0
+ two_pass_quantize : 0
+ dither_mode : 0
+L1 norm = 7182
+L2 norm = 92028
+checksum: 245
+exit 0
Added: test-suite/trunk/External/SPEC/CINT95/132.ijpeg/132.ijpeg.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT95/132.ijpeg/132.ijpeg.reference_output.small?rev=105213&view=auto
==============================================================================
(empty)
Added: test-suite/trunk/External/SPEC/CINT95/134.perl/134.perl.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT95/134.perl/134.perl.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT95/134.perl/134.perl.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT95/134.perl/134.perl.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,21 @@
+1513158 is not prime.
+1308481 is not prime.
+1947154 is not prime.
+1702203 is not prime.
+1494112 is not prime.
+1083350 is not prime.
+1277331 is not prime.
+1983481 is not prime.
+1765581 is not prime.
+1767702 is not prime.
+1822136 is not prime.
+1625283 is not prime.
+1346825 is not prime.
+1519361 is not prime.
+1606706 is not prime.
+1931782 is not prime.
+1866607 is not prime.
+1758523 is not prime.
+1389320 is not prime.
+1200744 is not prime.
+exit 0
Added: test-suite/trunk/External/SPEC/CINT95/147.vortex/147.vortex.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT95/147.vortex/147.vortex.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT95/147.vortex/147.vortex.reference_output (added)
+++ test-suite/trunk/External/SPEC/CINT95/147.vortex/147.vortex.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,782 @@
+ CREATE Db Header and Db Primal ...
+ NEW DB [ 3] Created.
+
+VORTEX INPUT PARAMETERS::
+ MESSAGE FileName: vortex.msg
+ OUTPUT FileName: vortex.out
+ DISK CACHE FileName: NULL
+ PART DB FileName: parts.db
+ DRAW DB FileName: draw.db
+ PERSON DB FileName: emp.db
+ PERSONS Data FileName: persons.250
+ PARTS Count : 1000
+ OUTER Loops : 2
+ INNER Loops : 4
+ LOOKUP Parts : 250
+ DELETE Parts : 100
+ STUFF Parts : 100
+ DEPTH Traverse: 5
+ % DECREASE Parts : 50
+ % INCREASE LookUps : 25
+ % INCREASE Deletes : 50
+ % INCREASE Stuffs : 100
+ FREEZE_PACKETS : 1
+ ALLOC_CHUNKS : 10000
+ EXTEND_CHUNKS : 5000
+ DELETE Draw objects : True
+ DELETE Part objects : False
+ QUE_BUG : 1000
+ VOID_BOUNDARY : 67108864
+ VOID_RESERVE : 1048576
+
+ COMMIT_DBS : False
+
+
+
+ BMT TEST :: files...
+ EdbName := PartLib
+ EdbFileName := parts.db
+ DrwName := DrawLib
+ DrwFileName := draw.db
+ EmpName := PersonLib
+ EmpFileName := emp.db
+
+ Swap to DiskCache := False
+ Freeze the cache := True
+
+
+ BMT TEST :: parms...
+ DeBug modulo := 1000
+ Create Parts count:= 1000
+ Outer Loops := 2
+ Inner Loops := 4
+ Look Ups := 250
+ Delete Parts := 100
+ Stuff Parts := 100
+ Traverse Limit := 5
+ Delete Draws := True
+ Delete Parts := False
+ Delete ALL Parts := after every <mod 0>Outer Loop
+
+ INITIALIZE LIBRARY ::
+
+ INITIALIZE SCHEMA ::
+ Primal_CreateDb Accessed !!!
+ CREATE Db Header and Db Primal ...
+ NEW DB [ 4] Created.
+ PartLibCreate:: Db[ 4]; VpartsDir= 1
+
+ Part Count= 1
+
+ Initialize the Class maps
+ LIST HEADS loaded ... DbListHead_Class = 207
+ DbListNode_Class = 206
+
+...NOTE... ShellLoadCode:: Class[ 228] will NOT be Activated.
+
+
+...NOTE... ShellLoadCode:: Class[ 229] will NOT be Activated.
+
+ Primal_CreateDb Accessed !!!
+ CREATE Db Header and Db Primal ...
+ NEW DB [ 5] Created.
+ DrawLibCreate:: Db[ 5]; VpartsDir= 1
+
+ Initialize the Class maps of this schema.
+ Primal_CreateDb Accessed !!!
+ CREATE Db Header and Db Primal ...
+ NEW DB [ 6] Created.
+
+ ***NOTE*** Persons Library Extended!
+
+ Create <131072> Persons.
+ ItNum 0. Person[ 6: 5]. Name= Riddell , Robert V. ;
+
+ LAST Person Read::
+ ItNum 250. Person[ 6: 503]. Name= Gonzales , Warren X. ;
+
+ BUILD <Query0> for <Part2> class::
+
+ if (link[1].length >= 5) ::
+
+ Build Query2 for <Address> class::
+
+ if (State == CA || State == T*)
+
+ Build Query1 for <Person> class::
+
+ if (LastName >= H* && LastName <= P* && Query0(Residence)) ::
+
+ BUILD <Query3> for <DrawObj> class::
+
+ if (Id >= 3000
+ && (Id >= 3000 && Id <= 3001)
+ && Id >= 3002)
+
+ BUILD <Query4> for <NamedDrawObj> class::
+
+ if (Nam == Pre*
+ || (Nam == ??Mid??? || == Pre??Mid?? || == ??Post
+ || == Pre??Post || == ??Mid???Post || == Pre??Mid???Post)
+ && Id <= 7)
+ SEED := 1008; Swap = False; RgnEntries = 4800
+
+ OUTER LOOP [ 1] : NewParts = 1000 LookUps = 250 StuffParts = 100.
+
+ Create 1000 New Parts
+ Create Part 1. Token[ 4: 2].
+
+ < 1000> Parts Created. CurrentId= 1000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 1. Token[ 4: 2]
+ Connect Part 837. Token[ 4: 838] FromList= 838.
+ Connect Part 640. Token[ 4: 641] FromList= 641.
+ Connect Part 463. Token[ 4: 464] FromList= 464.
+
+ SET <DrawObjs> entries::
+ 1. [ 5: 5] := <1 >; @[: 6]
+ Iteration count = 1000
+
+ SET <NamedDrawObjs> entries::
+ 1. [ 5: 270] := <102 >;
+ Iteration count = 125
+
+ SET <LibRectangles> entries::
+ 1. [ 5: 23] := <8 >; @[: 24]
+ Iteration count = 125
+
+ LIST <DbRectangles> entries::
+ 1. [ 5: 23]
+ Iteration count = 125
+
+ SET <PersonNames > entries::
+ Iteration count = 250
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=1000
+ < 1000> Part images' Committed.
+ < 0> are Named.
+ < 500> Point images' Committed.
+ < 248> Person images' Committed.
+
+ COMMIT Parts(* 1000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 0: 0]. TestObj Committed.
+ < 0> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 0: 0]. CartesianPoint Committed.
+ < 0> CartesianPoint images' Committed.
+
+ BEGIN Inner Loop Sequence::.
+
+ INNER LOOP [ 1: 1] :
+
+ LOOK UP 250 Random Parts and Export each Part.
+ Set 100. Part# 148 Handle= 149.
+ Set 200. Part# 356 Handle= 357.
+
+ LookUp for 251 parts; Asserts = 86
+ <Part2 > Asserts = 12; NULL Asserts = 38.
+ <DrawObj > Asserts = 0; NULL Asserts = 49.
+ <NamedObj > Asserts = 0; NULL Asserts = 0.
+ <Person > Asserts = 0; NULL Asserts = 50.
+ <TestObj > Asserts = 6351; NULL Asserts = 0.
+
+ DELETE 100 Random Parts.
+
+ PartDelete :: Token[ 4: 852].
+ PartDisconnect:: Token[ 4: 852] id:= 851 for each link.
+ DisConnect link [ 0]:= 459; PartToken[ 460: 460].
+ DisConnect link [ 1]:= 590; PartToken[ 591: 591].
+ DisConnect link [ 2]:= 789; PartToken[ 790: 790].
+ DeleteFromList:: Vchunk[ 4: 852]. (* 1)
+ DisConnect FromList[ 0]:= 869; Token[ 870: 870].
+ Vlists[ 850] := 1000;
+
+ Delete for 101 parts;
+
+ Traverse Count= 0
+
+ TRAVERSE PartId[ 151] and all Connections to 5 Levels
+ SEED In Traverse Part [ 4: 152] @ Level = 0.
+
+ Traverse Count= 1
+ Traverse Asserts = 0. True Tests = 0
+ < 0> DrawObj objects DELETED.
+ < 8> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 100 Additional Parts
+
+ Create 100 New Parts
+ Create Part 1001. Token[ 4: 1002].
+
+ < 100> Parts Created. CurrentId= 1100
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 1001. Token[ 4: 1002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=1100
+ < 490> Part images' Committed.
+ < 0> are Named.
+ < 256> Point images' Committed.
+ < 149> Person images' Committed.
+
+ COMMIT Parts(* 1000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 4]. TestObj Committed.
+ < 124> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Committed.
+ < 125> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 4]. TestObj Deleted.
+ < 124> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Deleted.
+ < 125> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 1: 1].
+
+ INNER LOOP [ 1: 2] :
+
+ LOOK UP 250 Random Parts and Export each Part.
+ Set 100. Part# 562 Handle= 563.
+ Set 200. Part# 482 Handle= 483.
+
+ LookUp for 251 parts; Asserts = 67
+ <Part2 > Asserts = 17; NULL Asserts = 33.
+ <DrawObj > Asserts = 0; NULL Asserts = 75.
+ <NamedObj > Asserts = 0; NULL Asserts = 0.
+ <Person > Asserts = 0; NULL Asserts = 50.
+ <TestObj > Asserts = 4800; NULL Asserts = 0.
+
+ DELETE 100 Random Parts.
+
+ Delete for 101 parts;
+
+ Traverse Count= 1
+
+ TRAVERSE PartId[ 65] and all Connections to 5 Levels
+
+ Traverse Count= 138
+ Traverse Asserts = 2. True Tests = 0
+ < 2> DrawObj objects DELETED.
+ < 10> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 100 Additional Parts
+
+ Create 100 New Parts
+ Create Part 1101. Token[ 4: 1102].
+
+ < 100> Parts Created. CurrentId= 1200
+
+ Connect each instantiated Part TO 3 unique Parts
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=1200
+ < 462> Part images' Committed.
+ < 0> are Named.
+ < 270> Point images' Committed.
+ < 147> Person images' Committed.
+
+ COMMIT Parts(* 1000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. TestObj Committed.
+ < 126> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. CartesianPoint Committed.
+ < 126> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. TestObj Deleted.
+ < 126> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. CartesianPoint Deleted.
+ < 126> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 1: 2].
+
+ INNER LOOP [ 1: 3] :
+
+ LOOK UP 250 Random Parts and Export each Part.
+ Set 100. Part# 290 Handle= 291.
+ Set 200. Part# 890 Handle= 891.
+
+ LookUp for 251 parts; Asserts = 58
+ <Part2 > Asserts = 8; NULL Asserts = 42.
+ <DrawObj > Asserts = 0; NULL Asserts = 73.
+ <NamedObj > Asserts = 0; NULL Asserts = 2.
+ <Person > Asserts = 0; NULL Asserts = 50.
+ <TestObj > Asserts = 4850; NULL Asserts = 0.
+
+ DELETE 100 Random Parts.
+
+ Delete for 101 parts;
+
+ Traverse Count= 138
+
+ TRAVERSE PartId[ 132] and all Connections to 5 Levels
+
+ Traverse Count= 159
+ Traverse Asserts = 3. True Tests = 2
+ < 3> DrawObj objects DELETED.
+ < 14> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 100 Additional Parts
+
+ Create 100 New Parts
+ Create Part 1201. Token[ 4: 1202].
+
+ < 100> Parts Created. CurrentId= 1300
+
+ Connect each instantiated Part TO 3 unique Parts
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=1300
+ < 507> Part images' Committed.
+ < 0> are Named.
+ < 198> Point images' Committed.
+ < 142> Person images' Committed.
+
+ COMMIT Parts(* 1000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 4]. TestObj Committed.
+ < 127> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Committed.
+ < 127> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 4]. TestObj Deleted.
+ < 127> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Deleted.
+ < 127> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 1: 3].
+
+ INNER LOOP [ 1: 4] :
+
+ LOOK UP 250 Random Parts and Export each Part.
+ Set 100. Part# 644 Handle= 645.
+ Set 200. Part# 140 Handle= 141.
+
+ LookUp for 251 parts; Asserts = 65
+ <Part2 > Asserts = 15; NULL Asserts = 35.
+ <DrawObj > Asserts = 0; NULL Asserts = 50.
+ <NamedObj > Asserts = 0; NULL Asserts = 0.
+ <Person > Asserts = 0; NULL Asserts = 75.
+ <TestObj > Asserts = 4750; NULL Asserts = 0.
+
+ DELETE 100 Random Parts.
+
+ Delete for 101 parts;
+
+ Traverse Count= 159
+
+ TRAVERSE PartId[ 1008] and all Connections to 5 Levels
+
+ Traverse Count= 93
+ Traverse Asserts = 2. True Tests = 0
+ < 1> DrawObj objects DELETED.
+ < 4> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 100 Additional Parts
+
+ Create 100 New Parts
+ Create Part 1301. Token[ 4: 1302].
+
+ < 100> Parts Created. CurrentId= 1400
+
+ Connect each instantiated Part TO 3 unique Parts
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=1400
+ < 488> Part images' Committed.
+ < 0> are Named.
+ < 198> Point images' Committed.
+ < 140> Person images' Committed.
+
+ COMMIT Parts(* 1000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. TestObj Committed.
+ < 126> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. CartesianPoint Committed.
+ < 126> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. TestObj Deleted.
+ < 126> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. CartesianPoint Deleted.
+ < 126> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 1: 4].
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ < 0> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ < 0> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ OUTER LOOP [ 2] : NewParts = 1000 LookUps = 250 StuffParts = 100.
+
+ Create 1000 New Parts
+ Create Part 1401. Token[ 4: 1402].
+
+ < 1000> Parts Created. CurrentId= 2400
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 2001. Token[ 4: 2002]
+
+ SET <DrawObjs> entries::
+ 1. [ 5: 7] := <2 >; @[: 8]
+ 1001. [ 5: 1618] := <1407 >; @[: 1620]
+ Iteration count = 1994
+
+ SET <NamedDrawObjs> entries::
+ 1. [ 5: 2633] := <1002 >;
+ Iteration count = 264
+
+ SET <LibRectangles> entries::
+ 1. [ 5: 23] := <8 >; @[: 24]
+ Iteration count = 258
+
+ LIST <DbRectangles> entries::
+ 1. [ 5: 23]
+ Iteration count = 300
+
+ SET <PersonNames > entries::
+ Iteration count = 250
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=2400
+ < 1000> Part images' Committed.
+ < 0> are Named.
+ < 500> Point images' Committed.
+ < 250> Person images' Committed.
+
+ COMMIT Parts(* 2000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 0: 0]. TestObj Committed.
+ < 0> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 0: 0]. CartesianPoint Committed.
+ < 0> CartesianPoint images' Committed.
+
+ BEGIN Inner Loop Sequence::.
+
+ INNER LOOP [ 2: 1] :
+
+ LOOK UP 250 Random Parts and Export each Part.
+ Set 100. Part# 1031 Handle= 1032.
+ Set 200. Part# 2059 Handle= 2060.
+
+ LookUp for 251 parts; Asserts = 61
+ <Part2 > Asserts = 11; NULL Asserts = 39.
+ <DrawObj > Asserts = 0; NULL Asserts = 47.
+ <NamedObj > Asserts = 0; NULL Asserts = 3.
+ <Person > Asserts = 0; NULL Asserts = 75.
+ <TestObj > Asserts = 4800; NULL Asserts = 0.
+
+ DELETE 100 Random Parts.
+
+ Delete for 101 parts;
+
+ Traverse Count= 93
+
+ TRAVERSE PartId[ 76] and all Connections to 5 Levels
+
+ Traverse Count= 87
+ Traverse Asserts = 1. True Tests = 0
+ < 2> DrawObj objects DELETED.
+ < 9> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 100 Additional Parts
+
+ Create 100 New Parts
+ Create Part 2401. Token[ 4: 2402].
+
+ < 100> Parts Created. CurrentId= 2500
+
+ Connect each instantiated Part TO 3 unique Parts
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=2500
+ < 551> Part images' Committed.
+ < 0> are Named.
+ < 286> Point images' Committed.
+ < 153> Person images' Committed.
+
+ COMMIT Parts(* 2000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 8]. TestObj Committed.
+ < 125> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. CartesianPoint Committed.
+ < 125> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 8]. TestObj Deleted.
+ < 125> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. CartesianPoint Deleted.
+ < 125> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 2: 1].
+
+ INNER LOOP [ 2: 2] :
+
+ LOOK UP 250 Random Parts and Export each Part.
+ Set 100. Part# 483 Handle= 484.
+ Set 200. Part# 2471 Handle= 2472.
+
+ LookUp for 251 parts; Asserts = 59
+ <Part2 > Asserts = 9; NULL Asserts = 41.
+ <DrawObj > Asserts = 0; NULL Asserts = 75.
+ <NamedObj > Asserts = 0; NULL Asserts = 0.
+ <Person > Asserts = 0; NULL Asserts = 50.
+ <TestObj > Asserts = 4750; NULL Asserts = 0.
+
+ DELETE 100 Random Parts.
+
+ Delete for 101 parts;
+
+ Traverse Count= 87
+
+ TRAVERSE PartId[ 1785] and all Connections to 5 Levels
+
+ Traverse Count= 27
+ Traverse Asserts = 0. True Tests = 0
+ < 0> DrawObj objects DELETED.
+ < 14> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 100 Additional Parts
+
+ Create 100 New Parts
+ Create Part 2501. Token[ 4: 2502].
+
+ < 100> Parts Created. CurrentId= 2600
+
+ Connect each instantiated Part TO 3 unique Parts
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=2600
+ < 521> Part images' Committed.
+ < 0> are Named.
+ < 266> Point images' Committed.
+ < 153> Person images' Committed.
+
+ COMMIT Parts(* 2000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. TestObj Committed.
+ < 125> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 8]. CartesianPoint Committed.
+ < 125> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. TestObj Deleted.
+ < 125> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 8]. CartesianPoint Deleted.
+ < 125> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 2: 2].
+
+ INNER LOOP [ 2: 3] :
+
+ LOOK UP 250 Random Parts and Export each Part.
+ Set 100. Part# 694 Handle= 695.
+ Set 200. Part# 1718 Handle= 1719.
+
+ LookUp for 251 parts; Asserts = 68
+ <Part2 > Asserts = 18; NULL Asserts = 57.
+ <DrawObj > Asserts = 0; NULL Asserts = 47.
+ <NamedObj > Asserts = 0; NULL Asserts = 3.
+ <Person > Asserts = 0; NULL Asserts = 50.
+ <TestObj > Asserts = 4800; NULL Asserts = 0.
+
+ DELETE 100 Random Parts.
+
+ Delete for 101 parts;
+
+ Traverse Count= 27
+
+ TRAVERSE PartId[ 1384] and all Connections to 5 Levels
+
+ Traverse Count= 90
+ Traverse Asserts = 1. True Tests = 0
+ < 1> DrawObj objects DELETED.
+ < 8> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 100 Additional Parts
+
+ Create 100 New Parts
+ Create Part 2601. Token[ 4: 2602].
+
+ < 100> Parts Created. CurrentId= 2700
+
+ Connect each instantiated Part TO 3 unique Parts
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=2700
+ < 527> Part images' Committed.
+ < 0> are Named.
+ < 250> Point images' Committed.
+ < 158> Person images' Committed.
+
+ COMMIT Parts(* 2000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 8]. TestObj Committed.
+ < 126> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. CartesianPoint Committed.
+ < 126> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 8]. TestObj Deleted.
+ < 126> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. CartesianPoint Deleted.
+ < 126> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 2: 3].
+
+ INNER LOOP [ 2: 4] :
+
+ LOOK UP 250 Random Parts and Export each Part.
+ Set 100. Part# 2600 Handle= 2601.
+ Set 200. Part# 352 Handle= 353.
+
+ LookUp for 251 parts; Asserts = 87
+ <Part2 > Asserts = 12; NULL Asserts = 38.
+ <DrawObj > Asserts = 0; NULL Asserts = 45.
+ <NamedObj > Asserts = 0; NULL Asserts = 5.
+ <Person > Asserts = 0; NULL Asserts = 50.
+ <TestObj > Asserts = 6450; NULL Asserts = 0.
+
+ DELETE 100 Random Parts.
+
+ Delete for 101 parts;
+
+ Traverse Count= 90
+
+ TRAVERSE PartId[ 379] and all Connections to 5 Levels
+
+ Traverse Count= 3
+ Traverse Asserts = 0. True Tests = 0
+ < 1> DrawObj objects DELETED.
+ < 23> are Named.
+ < 2> Point objects DELETED.
+
+ CREATE 100 Additional Parts
+
+ Create 100 New Parts
+ Create Part 2701. Token[ 4: 2702].
+
+ < 100> Parts Created. CurrentId= 2800
+
+ Connect each instantiated Part TO 3 unique Parts
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=2800
+ < 529> Part images' Committed.
+ < 0> are Named.
+ < 308> Point images' Committed.
+ < 146> Person images' Committed.
+
+ COMMIT Parts(* 2000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 9]. TestObj Committed.
+ < 125> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. CartesianPoint Committed.
+ < 125> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 9]. TestObj Deleted.
+ < 125> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. CartesianPoint Deleted.
+ < 125> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 2: 4].
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ < 0> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ < 0> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+ STATUS= -201
+V O R T E x 0 1!V O R T E x 0 1!V O R T E x 0 1!V O R T E x 0 1!V O R T E x 0 1!
+exit 0
Added: test-suite/trunk/External/SPEC/CINT95/147.vortex/147.vortex.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/External/SPEC/CINT95/147.vortex/147.vortex.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/External/SPEC/CINT95/147.vortex/147.vortex.reference_output.small (added)
+++ test-suite/trunk/External/SPEC/CINT95/147.vortex/147.vortex.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,847 @@
+ CREATE Db Header and Db Primal ...
+ NEW DB [ 3] Created.
+
+VORTEX INPUT PARAMETERS::
+ MESSAGE FileName: vortex.msg
+ OUTPUT FileName: vortex.out
+ DISK CACHE FileName: NULL
+ PART DB FileName: parts.db
+ DRAW DB FileName: draw.db
+ PERSON DB FileName: emp.db
+ PERSONS Data FileName: persons.1k
+ PARTS Count : 10000
+ OUTER Loops : 2
+ INNER Loops : 4
+ LOOKUP Parts : 250
+ DELETE Parts : 500
+ STUFF Parts : 500
+ DEPTH Traverse: 5
+ % DECREASE Parts : 50
+ % INCREASE LookUps : 25
+ % INCREASE Deletes : 50
+ % INCREASE Stuffs : 100
+ FREEZE_PACKETS : 1
+ ALLOC_CHUNKS : 10000
+ EXTEND_CHUNKS : 5000
+ DELETE Draw objects : True
+ DELETE Part objects : False
+ QUE_BUG : 1000
+ VOID_BOUNDARY : 67108864
+ VOID_RESERVE : 1048576
+
+ COMMIT_DBS : False
+
+
+
+ BMT TEST :: files...
+ EdbName := PartLib
+ EdbFileName := parts.db
+ DrwName := DrawLib
+ DrwFileName := draw.db
+ EmpName := PersonLib
+ EmpFileName := emp.db
+
+ Swap to DiskCache := False
+ Freeze the cache := True
+
+
+ BMT TEST :: parms...
+ DeBug modulo := 1000
+ Create Parts count:= 10000
+ Outer Loops := 2
+ Inner Loops := 4
+ Look Ups := 250
+ Delete Parts := 500
+ Stuff Parts := 500
+ Traverse Limit := 5
+ Delete Draws := True
+ Delete Parts := False
+ Delete ALL Parts := after every <mod 0>Outer Loop
+
+ INITIALIZE LIBRARY ::
+
+ INITIALIZE SCHEMA ::
+ Primal_CreateDb Accessed !!!
+ CREATE Db Header and Db Primal ...
+ NEW DB [ 4] Created.
+ PartLibCreate:: Db[ 4]; VpartsDir= 1
+
+ Part Count= 1
+
+ Initialize the Class maps
+ LIST HEADS loaded ... DbListHead_Class = 207
+ DbListNode_Class = 206
+
+...NOTE... ShellLoadCode:: Class[ 228] will NOT be Activated.
+
+
+...NOTE... ShellLoadCode:: Class[ 229] will NOT be Activated.
+
+ Primal_CreateDb Accessed !!!
+ CREATE Db Header and Db Primal ...
+ NEW DB [ 5] Created.
+ DrawLibCreate:: Db[ 5]; VpartsDir= 1
+
+ Initialize the Class maps of this schema.
+ Primal_CreateDb Accessed !!!
+ CREATE Db Header and Db Primal ...
+ NEW DB [ 6] Created.
+
+ ***NOTE*** Persons Library Extended!
+
+ Create <131072> Persons.
+ ItNum 0. Person[ 6: 5]. Name= Riddell , Robert V. ;
+
+ LAST Person Read::
+ ItNum 1000. Person[ 6: 2003]. Name= Stanton , Miklos Q. ;
+
+ BUILD <Query0> for <Part2> class::
+
+ if (link[1].length >= 5) ::
+
+ Build Query2 for <Address> class::
+
+ if (State == CA || State == T*)
+
+ Build Query1 for <Person> class::
+
+ if (LastName >= H* && LastName <= P* && Query0(Residence)) ::
+
+ BUILD <Query3> for <DrawObj> class::
+
+ if (Id >= 3000
+ && (Id >= 3000 && Id <= 3001)
+ && Id >= 3002)
+
+ BUILD <Query4> for <NamedDrawObj> class::
+
+ if (Nam == Pre*
+ || (Nam == ??Mid??? || == Pre??Mid?? || == ??Post
+ || == Pre??Post || == ??Mid???Post || == Pre??Mid???Post)
+ && Id <= 7)
+ SEED := 1008; Swap = False; RgnEntries = 26000
+
+ OUTER LOOP [ 1] : NewParts = 10000 LookUps = 250 StuffParts = 500.
+
+ Create 10000 New Parts
+ Create Part 1. Token[ 4: 2].
+ Create Part 1001. Token[ 4: 1002].
+ Create Part 2001. Token[ 4: 2002].
+ Create Part 3001. Token[ 4: 3002].
+ Create Part 4001. Token[ 4: 4002].
+ Create Part 5001. Token[ 4: 5002].
+ Create Part 6001. Token[ 4: 6002].
+ Create Part 7001. Token[ 4: 7002].
+ Create Part 8001. Token[ 4: 8002].
+ Create Part 9001. Token[ 4: 9002].
+
+ < 10000> Parts Created. CurrentId= 10000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 1. Token[ 4: 2]
+ Connect Part 2021. Token[ 4: 2022] FromList= 2022.
+ Connect Part 9992. Token[ 4: 9993] FromList= 9993.
+ Connect Part 7743. Token[ 4: 7744] FromList= 7744.
+ Connect Part 1001. Token[ 4: 1002]
+ Connect Part 2001. Token[ 4: 2002]
+ Connect Part 3001. Token[ 4: 3002]
+ Connect Part 4001. Token[ 4: 4002]
+ Connect Part 5001. Token[ 4: 5002]
+ Connect Part 6001. Token[ 4: 6002]
+ Connect Part 7001. Token[ 4: 7002]
+ Connect Part 8001. Token[ 4: 8002]
+ Connect Part 9001. Token[ 4: 9002]
+
+ SET <DrawObjs> entries::
+ 1. [ 5: 5] := <1 >; @[: 6]
+ 1001. [ 5: 2631] := <1001 >; @[: 2632]
+ 2001. [ 5: 5256] := <2001 >; @[: 5257]
+ 3001. [ 5: 7881] := <3001 >; @[: 7882]
+ 4001. [ 5: 10506] := <4001 >; @[: 10507]
+ 5001. [ 5: 13131] := <5001 >; @[: 13132]
+ 6001. [ 5: 15756] := <6001 >; @[: 15757]
+ 7001. [ 5: 18381] := <7001 >; @[: 18382]
+ 8001. [ 5: 21006] := <8001 >; @[: 21007]
+ 9001. [ 5: 23631] := <9001 >; @[: 23632]
+ Iteration count = 10000
+
+ SET <NamedDrawObjs> entries::
+ 1. [ 5: 2643] := <1006 >;
+ 1001. [ 5: 21543] := <8206 >;
+ Iteration count = 1250
+
+ SET <LibRectangles> entries::
+ 1. [ 5: 23] := <8 >; @[: 24]
+ 1001. [ 5: 21024] := <8008 >; @[: 21025]
+ Iteration count = 1250
+
+ LIST <DbRectangles> entries::
+ 1. [ 5: 23]
+ 1001. [ 5: 21024]
+ Iteration count = 1250
+
+ SET <PersonNames > entries::
+ Iteration count = 1000
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=10000
+ < 10000> Part images' Committed.
+ < 0> are Named.
+ < 5000> Point images' Committed.
+ < 1000> Person images' Committed.
+
+ COMMIT Parts(* 10000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 0: 0]. TestObj Committed.
+ < 0> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 0: 0]. CartesianPoint Committed.
+ < 0> CartesianPoint images' Committed.
+
+ BEGIN Inner Loop Sequence::.
+
+ INNER LOOP [ 1: 1] :
+
+ LOOK UP 250 Random Parts and Export each Part.
+ Set 100. Part# 9460 Handle= 9461.
+ Set 200. Part# 3492 Handle= 3493.
+
+ LookUp for 251 parts; Asserts = 106
+ <Part2 > Asserts = 11; NULL Asserts = 39.
+ <DrawObj > Asserts = 21; NULL Asserts = 28.
+ <NamedObj > Asserts = 0; NULL Asserts = 0.
+ <Person > Asserts = 0; NULL Asserts = 50.
+ <TestObj > Asserts = 6351; NULL Asserts = 0.
+
+ DELETE 500 Random Parts.
+
+ PartDelete :: Token[ 4: 7220].
+ PartDisconnect:: Token[ 4: 7220] id:= 7219 for each link.
+ DisConnect link [ 0]:= 7363; PartToken[ 7364: 7364].
+ DisConnect link [ 1]:= 4286; PartToken[ 4287: 4287].
+ DisConnect link [ 2]:= 5533; PartToken[ 5534: 5534].
+ DeleteFromList:: Vchunk[ 4: 7220]. (* 3)
+ DisConnect FromList[ 0]:= 2360; Token[ 2361: 2361].
+ DisConnect FromList[ 1]:= 2557; Token[ 2558: 2558].
+ DisConnect FromList[ 2]:= 7432; Token[ 7433: 7433].
+ Vlists[7218] := 10000;
+
+ Delete for 501 parts;
+
+ Traverse Count= 0
+
+ TRAVERSE PartId[ 6487] and all Connections to 5 Levels
+
+ Traverse Count= 315
+ Traverse Asserts = 5. True Tests = 2
+ < 5> DrawObj objects DELETED.
+ < 39> are Named.
+ < 2> Point objects DELETED.
+
+ CREATE 500 Additional Parts
+
+ Create 500 New Parts
+ Create Part 10001. Token[ 4: 10002].
+
+ < 500> Parts Created. CurrentId= 10500
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 10001. Token[ 4: 10002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=10500
+ < 2145> Part images' Committed.
+ < 0> are Named.
+ < 1238> Point images' Committed.
+ < 204> Person images' Committed.
+
+ COMMIT Parts(* 10000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 4]. TestObj Committed.
+ < 127> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Committed.
+ < 128> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 4]. TestObj Deleted.
+ < 127> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Deleted.
+ < 128> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 1: 1].
+
+ INNER LOOP [ 1: 2] :
+
+ LOOK UP 250 Random Parts and Export each Part.
+ Set 100. Part# 3186 Handle= 3187.
+ Set 200. Part# 1778 Handle= 1779.
+
+ LookUp for 251 parts; Asserts = 73
+ <Part2 > Asserts = 9; NULL Asserts = 66.
+ <DrawObj > Asserts = 14; NULL Asserts = 35.
+ <NamedObj > Asserts = 0; NULL Asserts = 1.
+ <Person > Asserts = 0; NULL Asserts = 50.
+ <TestObj > Asserts = 4750; NULL Asserts = 0.
+
+ DELETE 500 Random Parts.
+
+ Delete for 501 parts;
+
+ Traverse Count= 315
+
+ TRAVERSE PartId[ 1227] and all Connections to 5 Levels
+
+ Traverse Count= 219
+ Traverse Asserts = 4. True Tests = 1
+ < 3> DrawObj objects DELETED.
+ < 47> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 500 Additional Parts
+
+ Create 500 New Parts
+ Create Part 10501. Token[ 4: 10502].
+
+ < 500> Parts Created. CurrentId= 11000
+
+ Connect each instantiated Part TO 3 unique Parts
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=11000
+ < 2003> Part images' Committed.
+ < 0> are Named.
+ < 1142> Point images' Committed.
+ < 214> Person images' Committed.
+
+ COMMIT Parts(* 10000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. TestObj Committed.
+ < 127> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Committed.
+ < 127> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 5]. TestObj Deleted.
+ < 127> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Deleted.
+ < 127> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 1: 2].
+
+ INNER LOOP [ 1: 3] :
+
+ LOOK UP 250 Random Parts and Export each Part.
+ Set 100. Part# 2782 Handle= 2783.
+ Set 200. Part# 9761 Handle= 9762.
+
+ LookUp for 251 parts; Asserts = 87
+ <Part2 > Asserts = 16; NULL Asserts = 34.
+ <DrawObj > Asserts = 20; NULL Asserts = 30.
+ <NamedObj > Asserts = 0; NULL Asserts = 0.
+ <Person > Asserts = 1; NULL Asserts = 74.
+ <TestObj > Asserts = 4725; NULL Asserts = 0.
+
+ DELETE 500 Random Parts.
+
+ Delete for 501 parts;
+
+ Traverse Count= 219
+
+ TRAVERSE PartId[ 10654] and all Connections to 5 Levels
+
+ Traverse Count= 210
+ Traverse Asserts = 2. True Tests = 1
+ < 4> DrawObj objects DELETED.
+ < 47> are Named.
+ < 2> Point objects DELETED.
+
+ CREATE 500 Additional Parts
+
+ Create 500 New Parts
+ Create Part 11001. Token[ 4: 11002].
+
+ < 500> Parts Created. CurrentId= 11500
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 11001. Token[ 4: 11002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=11500
+ < 1944> Part images' Committed.
+ < 0> are Named.
+ < 894> Point images' Committed.
+ < 221> Person images' Committed.
+
+ COMMIT Parts(* 10000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. TestObj Committed.
+ < 126> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. CartesianPoint Committed.
+ < 126> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. TestObj Deleted.
+ < 126> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. CartesianPoint Deleted.
+ < 126> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 1: 3].
+
+ INNER LOOP [ 1: 4] :
+
+ LOOK UP 250 Random Parts and Export each Part.
+ Set 100. Part# 8810 Handle= 8811.
+ Set 200. Part# 5370 Handle= 5371.
+
+ LookUp for 251 parts; Asserts = 92
+ <Part2 > Asserts = 8; NULL Asserts = 42.
+ <DrawObj > Asserts = 33; NULL Asserts = 42.
+ <NamedObj > Asserts = 0; NULL Asserts = 0.
+ <Person > Asserts = 1; NULL Asserts = 49.
+ <TestObj > Asserts = 4850; NULL Asserts = 0.
+
+ DELETE 500 Random Parts.
+
+ Delete for 501 parts;
+
+ Traverse Count= 210
+
+ TRAVERSE PartId[ 11242] and all Connections to 5 Levels
+
+ Traverse Count= 192
+ Traverse Asserts = 4. True Tests = 2
+ < 3> DrawObj objects DELETED.
+ < 53> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 500 Additional Parts
+
+ Create 500 New Parts
+ Create Part 11501. Token[ 4: 11502].
+
+ < 500> Parts Created. CurrentId= 12000
+
+ Connect each instantiated Part TO 3 unique Parts
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=12000
+ < 1990> Part images' Committed.
+ < 0> are Named.
+ < 846> Point images' Committed.
+ < 223> Person images' Committed.
+
+ COMMIT Parts(* 10000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 7]. TestObj Committed.
+ < 127> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Committed.
+ < 127> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 7]. TestObj Deleted.
+ < 127> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. CartesianPoint Deleted.
+ < 127> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 1: 4].
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ < 0> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ < 0> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ OUTER LOOP [ 2] : NewParts = 5000 LookUps = 312 StuffParts = 1000.
+
+ Create 5000 New Parts
+ Create Part 12001. Token[ 4: 12002].
+ Create Part 13001. Token[ 4: 13002].
+ Create Part 14001. Token[ 4: 14002].
+ Create Part 15001. Token[ 4: 15002].
+ Create Part 16001. Token[ 4: 16002].
+
+ < 5000> Parts Created. CurrentId= 17000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 12001. Token[ 4: 12002]
+ Connect Part 13001. Token[ 4: 13002]
+ Connect Part 14001. Token[ 4: 14002]
+ Connect Part 15001. Token[ 4: 15002]
+ Connect Part 16001. Token[ 4: 16002]
+
+ SET <DrawObjs> entries::
+ 1. [ 5: 5] := <1 >; @[: 6]
+ 1001. [ 5: 3189] := <1214 >; @[: 3190]
+ 2001. [ 5: 6366] := <2424 >; @[: 6367]
+ 3001. [ 5: 9552] := <3638 >; @[: 9553]
+ 4001. [ 5: 12732] := <4849 >; @[: 12733]
+ 5001. [ 5: 15987] := <6089 >; @[: 15988]
+ 6001. [ 5: 19231] := <7325 >; @[: 19232]
+ 7001. [ 5: 22452] := <8552 >; @[: 22453]
+ 8001. [ 5: 25697] := <9788 >; @[: 25698]
+ 9001. [ 5: 13936] := <10985 >; @[: 18533]
+ 10001. [ 5: 17243] := <12014 >; @[: 17242]
+ 11001. [ 5: 29062] := <13014 >; @[: 29063]
+ 12001. [ 5: 31687] := <14014 >; @[: 31688]
+ 13001. [ 5: 34312] := <15014 >; @[: 34313]
+ 14001. [ 5: 36937] := <16014 >; @[: 36938]
+ Iteration count = 14987
+
+ SET <NamedDrawObjs> entries::
+ 1. [ 5: 26264] := <10004 >;
+ 1001. [ 5: 5667] := <2158 >;
+ Iteration count = 1939
+
+ SET <LibRectangles> entries::
+ 1. [ 5: 23] := <8 >; @[: 24]
+ 1001. [ 5: 24489] := <9328 >; @[: 24490]
+ Iteration count = 1926
+
+ LIST <DbRectangles> entries::
+ 1. [ 5: 23]
+ 1001. [ 5: 21024]
+ 2001. [ 5: 36905]
+ Iteration count = 2125
+
+ SET <PersonNames > entries::
+ Iteration count = 1000
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=17000
+ < 4999> Part images' Committed.
+ < 0> are Named.
+ < 2498> Point images' Committed.
+ < 1000> Person images' Committed.
+
+ COMMIT Parts(* 15000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 0: 0]. TestObj Committed.
+ < 0> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 0: 0]. CartesianPoint Committed.
+ < 0> CartesianPoint images' Committed.
+
+ BEGIN Inner Loop Sequence::.
+
+ INNER LOOP [ 2: 1] :
+
+ LOOK UP 312 Random Parts and Export each Part.
+ Set 100. Part# 14816 Handle= 14817.
+ Set 200. Part# 9496 Handle= 9497.
+ Set 300. Part# 15704 Handle= 15705.
+
+ LookUp for 313 parts; Asserts = 100
+ <Part2 > Asserts = 16; NULL Asserts = 47.
+ <DrawObj > Asserts = 22; NULL Asserts = 64.
+ <NamedObj > Asserts = 0; NULL Asserts = 7.
+ <Person > Asserts = 0; NULL Asserts = 63.
+ <TestObj > Asserts = 7378; NULL Asserts = 0.
+
+ DELETE 750 Random Parts.
+
+ Delete for 751 parts;
+
+ Traverse Count= 192
+
+ TRAVERSE PartId[ 11023] and all Connections to 5 Levels
+
+ Traverse Count= 186
+ Traverse Asserts = 2. True Tests = 1
+ < 3> DrawObj objects DELETED.
+ < 65> are Named.
+ < 2> Point objects DELETED.
+
+ CREATE 1000 Additional Parts
+
+ Create 1000 New Parts
+ Create Part 17001. Token[ 4: 17002].
+
+ < 1000> Parts Created. CurrentId= 18000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 17001. Token[ 4: 17002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=18000
+ < 3057> Part images' Committed.
+ < 0> are Named.
+ < 1586> Point images' Committed.
+ < 247> Person images' Committed.
+
+ COMMIT Parts(* 15250)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. TestObj Committed.
+ < 158> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. CartesianPoint Committed.
+ < 158> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 3]. TestObj Deleted.
+ < 158> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. CartesianPoint Deleted.
+ < 158> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 2: 1].
+
+ INNER LOOP [ 2: 2] :
+
+ LOOK UP 312 Random Parts and Export each Part.
+ Set 100. Part# 9458 Handle= 9459.
+ Set 200. Part# 10907 Handle= 10908.
+ Set 300. Part# 4112 Handle= 4113.
+
+ LookUp for 313 parts; Asserts = 96
+ <Part2 > Asserts = 22; NULL Asserts = 71.
+ <DrawObj > Asserts = 11; NULL Asserts = 42.
+ <NamedObj > Asserts = 0; NULL Asserts = 9.
+ <Person > Asserts = 0; NULL Asserts = 63.
+ <TestObj > Asserts = 7473; NULL Asserts = 0.
+
+ DELETE 750 Random Parts.
+
+ Delete for 751 parts;
+
+ Traverse Count= 186
+
+ TRAVERSE PartId[ 7354] and all Connections to 5 Levels
+
+ Traverse Count= 168
+ Traverse Asserts = 3. True Tests = 1
+ < 3> DrawObj objects DELETED.
+ < 111> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 1000 Additional Parts
+
+ Create 1000 New Parts
+ Create Part 18001. Token[ 4: 18002].
+
+ < 1000> Parts Created. CurrentId= 19000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 18001. Token[ 4: 18002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=19000
+ < 3032> Part images' Committed.
+ < 0> are Named.
+ < 1422> Point images' Committed.
+ < 281> Person images' Committed.
+
+ COMMIT Parts(* 15500)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 7]. TestObj Committed.
+ < 157> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. CartesianPoint Committed.
+ < 157> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 7]. TestObj Deleted.
+ < 157> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. CartesianPoint Deleted.
+ < 157> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 2: 2].
+
+ INNER LOOP [ 2: 3] :
+
+ LOOK UP 312 Random Parts and Export each Part.
+ Set 100. Part# 14370 Handle= 14371.
+ Set 200. Part# 9943 Handle= 9944.
+ Set 300. Part# 1290 Handle= 1291.
+
+ LookUp for 313 parts; Asserts = 120
+ <Part2 > Asserts = 16; NULL Asserts = 47.
+ <DrawObj > Asserts = 11; NULL Asserts = 46.
+ <NamedObj > Asserts = 0; NULL Asserts = 5.
+ <Person > Asserts = 0; NULL Asserts = 63.
+ <TestObj > Asserts = 9796; NULL Asserts = 0.
+
+ DELETE 750 Random Parts.
+
+ Delete for 751 parts;
+
+ Traverse Count= 168
+
+ TRAVERSE PartId[ 3503] and all Connections to 5 Levels
+
+ Traverse Count= 132
+ Traverse Asserts = 1. True Tests = 0
+ < 2> DrawObj objects DELETED.
+ < 53> are Named.
+ < 0> Point objects DELETED.
+
+ CREATE 1000 Additional Parts
+
+ Create 1000 New Parts
+ Create Part 19001. Token[ 4: 19002].
+
+ < 1000> Parts Created. CurrentId= 20000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 19001. Token[ 4: 19002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=20000
+ < 3024> Part images' Committed.
+ < 0> are Named.
+ < 1616> Point images' Committed.
+ < 263> Person images' Committed.
+
+ COMMIT Parts(* 15750)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. TestObj Committed.
+ < 157> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 7]. CartesianPoint Committed.
+ < 157> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. TestObj Deleted.
+ < 157> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 7]. CartesianPoint Deleted.
+ < 157> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 2: 3].
+
+ INNER LOOP [ 2: 4] :
+
+ LOOK UP 312 Random Parts and Export each Part.
+ Set 100. Part# 13437 Handle= 13438.
+ Set 200. Part# 14737 Handle= 14738.
+ Set 300. Part# 18884 Handle= 18885.
+
+ LookUp for 313 parts; Asserts = 89
+ <Part2 > Asserts = 19; NULL Asserts = 75.
+ <DrawObj > Asserts = 8; NULL Asserts = 45.
+ <NamedObj > Asserts = 0; NULL Asserts = 9.
+ <Person > Asserts = 0; NULL Asserts = 63.
+ <TestObj > Asserts = 7409; NULL Asserts = 0.
+
+ DELETE 750 Random Parts.
+
+ Delete for 751 parts;
+
+ Traverse Count= 132
+
+ TRAVERSE PartId[ 16769] and all Connections to 5 Levels
+
+ Traverse Count= 123
+ Traverse Asserts = 2. True Tests = 0
+ < 2> DrawObj objects DELETED.
+ < 65> are Named.
+ < 2> Point objects DELETED.
+
+ CREATE 1000 Additional Parts
+
+ Create 1000 New Parts
+ Create Part 20001. Token[ 4: 20002].
+
+ < 1000> Parts Created. CurrentId= 21000
+
+ Connect each instantiated Part TO 3 unique Parts
+ Connect Part 20001. Token[ 4: 20002]
+
+ COMMIT All Image copies:: Release=<True>; Max Parts=21000
+ < 2861> Part images' Committed.
+ < 0> are Named.
+ < 1366> Point images' Committed.
+ < 275> Person images' Committed.
+
+ COMMIT Parts(* 16000)
+
+ Commit TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 7]. TestObj Committed.
+ < 157> TestObj images' Committed.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. CartesianPoint Committed.
+ < 157> CartesianPoint images' Committed.
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 7]. TestObj Deleted.
+ < 157> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ ItNum 0. Token[ 3: 6]. CartesianPoint Deleted.
+ < 157> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+
+ END INNER LOOP [ 2: 4].
+
+ DELETE All TestObj objects;
+
+ Delete TestObj_Class in <Primal> DB.
+ < 0> TestObj objects Deleted.
+
+ Commit CartesianPoint_Class in <Primal> DB.
+ < 0> CartesianPoint objects Deleted.
+
+ DELETE TestObj and Point objects...
+ STATUS= -201
+V O R T E x 0 1!V O R T E x 0 1!V O R T E x 0 1!V O R T E x 0 1!V O R T E x 0 1!
+exit 0
Added: test-suite/trunk/MultiSource/Applications/Burg/burg.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/Burg/burg.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/Burg/burg.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/Burg/burg.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,347 @@
+
+#include <stdio.h>
+
+typedef struct node *NODEPTR_TYPE;
+
+struct node {
+ int op, state_label;
+ NODEPTR_TYPE left, right;
+};
+
+#define OP_LABEL(p) ((p)->op)
+#define STATE_LABEL(p) ((p)->state_label)
+#define LEFT_CHILD(p) ((p)->left)
+#define RIGHT_CHILD(p) ((p)->right)
+#define PANIC printf
+#ifndef burm_PANIC
+#define burm_PANIC PANIC
+#endif /* burm_PANIC */
+#ifdef __STDC__
+extern void abort(void);
+#else
+extern void abort();
+#endif
+#ifdef NDEBUG
+#define burm_assert(x,y) ;
+#else
+#define burm_assert(x,y) if(!(x)) {y; abort();}
+#endif
+static short burm_r1_nts[] ={ 0 };
+static short burm_r3_nts[] ={ 2, 0 };
+static short burm_r4_nts[] ={ 2, 1, 0 };
+static short burm_r6_nts[] ={ 3, 0 };
+static short burm_r7_nts[] ={ 3, 1, 0 };
+short *burm_nts[] = {
+ 0,
+ burm_r1_nts,
+ burm_r1_nts,
+ burm_r3_nts,
+ burm_r4_nts,
+ burm_r4_nts,
+ burm_r6_nts,
+ burm_r7_nts,
+};
+static unsigned char burm_Assign_transition[2][2] = {
+{ 0, 0} /* row 0 */,
+{ 0, 1} /* row 1 */
+};
+static unsigned char burm_Mul_transition[2][2] = {
+{ 0, 0} /* row 0 */,
+{ 0, 1} /* row 1 */
+};
+static unsigned char burm_Plus_transition[2][3] = {
+{ 0, 0, 0} /* row 0 */,
+{ 0, 1, 2} /* row 1 */
+};
+static struct {
+ unsigned int f0:2;
+ unsigned int f1:2;
+ unsigned int f2:2;
+ unsigned int f3:2;
+ unsigned int f4:2;
+ unsigned int f5:3;
+ unsigned int f6:2;
+ unsigned int f7:2;
+} burm_plank_0[] = {
+ { 0, 0, 0, 0, 0, 0, 0, 0,}, /* row 0 */
+ { 0, 1, 0, 0, 1, 0, 0, 1,}, /* row 1 */
+ { 1, 0, 0, 1, 0, 3, 1, 0,}, /* row 2 */
+ { 0, 1, 0, 0, 1, 0, 0, 2,}, /* row 3 */
+ { 1, 0, 1, 1, 0, 3, 2, 0,}, /* row 4 */
+ { 0, 0, 0, 0, 2, 0, 0, 0,}, /* row 5 */
+ { 1, 0, 0, 0, 0, 1, 0, 0,}, /* row 6 */
+ { 1, 0, 0, 0, 0, 2, 0, 0,}, /* row 7 */
+};
+static short burm_eruleMap[] = {
+ 0, 4, 5, 3, 0, 1, 2, 0, 7, 6
+};
+#define burm_reg_rule(state) burm_eruleMap[burm_plank_0[state].f7 +7]
+#define burm_con_rule(state) burm_eruleMap[burm_plank_0[state].f6 +4]
+#define burm_addr_rule(state) burm_eruleMap[burm_plank_0[state].f5 +0]
+
+#ifdef __STDC__
+int burm_rule(int state, int goalnt) {
+#else
+int burm_rule(state, goalnt) int state; int goalnt; {
+#endif
+ burm_assert(state >= 0 && state < 8, burm_PANIC("Bad state %d passed to burm_rule\n", state));
+ switch(goalnt) {
+ case 1:
+ return burm_reg_rule(state);
+ case 2:
+ return burm_con_rule(state);
+ case 3:
+ return burm_addr_rule(state);
+ default:
+ burm_PANIC("Unknown nonterminal %d in burm_rule;\n", goalnt);
+ abort();
+ return 0;
+ }
+}
+
+int burm_TEMP;
+#define burm_Assign_state(l,r) ( (burm_TEMP = burm_Assign_transition[burm_plank_0[l].f0][burm_plank_0[r].f1]) ? burm_TEMP + 0 : 0 )
+#define burm_Constant_state 2
+#define burm_Fetch_state(l) ( (burm_TEMP = burm_plank_0[l].f0) ? burm_TEMP + 2 : 0 )
+#define burm_Four_state 4
+#define burm_Mul_state(l,r) ( (burm_TEMP = burm_Mul_transition[burm_plank_0[l].f2][burm_plank_0[r].f1]) ? burm_TEMP + 4 : 0 )
+#define burm_Plus_state(l,r) ( (burm_TEMP = burm_Plus_transition[burm_plank_0[l].f3][burm_plank_0[r].f4]) ? burm_TEMP + 5 : 0 )
+
+#ifdef __STDC__
+int burm_state(int op, int l, int r) {
+#else
+int burm_state(op, l, r) int op; int l; int r; {
+#endif
+ register int burm_TEMP;
+#ifndef NDEBUG
+ switch (op) {
+ case 1:
+ case 5:
+ case 6:
+ burm_assert(r >= 0 && r < 8, burm_PANIC("Bad state %d passed to burm_state\n", r));
+ /*FALLTHROUGH*/
+ case 3:
+ burm_assert(l >= 0 && l < 8, burm_PANIC("Bad state %d passed to burm_state\n", l));
+ /*FALLTHROUGH*/
+ case 2:
+ case 4:
+ break;
+ }
+#endif
+ switch (op) {
+ default: burm_PANIC("Unknown op %d in burm_state\n", op); abort(); return 0;
+ case 1:
+ return burm_Assign_state(l,r);
+ case 2:
+ return burm_Constant_state;
+ case 3:
+ return burm_Fetch_state(l);
+ case 4:
+ return burm_Four_state;
+ case 5:
+ return burm_Mul_state(l,r);
+ case 6:
+ return burm_Plus_state(l,r);
+ }
+}
+#ifdef burm_STATE_LABEL
+#define burm_INCLUDE_EXTRA
+#else
+#ifdef STATE_LABEL
+#define burm_INCLUDE_EXTRA
+#define burm_STATE_LABEL STATE_LABEL
+#define burm_NODEPTR_TYPE NODEPTR_TYPE
+#define burm_LEFT_CHILD LEFT_CHILD
+#define burm_OP_LABEL OP_LABEL
+#define burm_RIGHT_CHILD RIGHT_CHILD
+#endif /* STATE_LABEL */
+#endif /* burm_STATE_LABEL */
+
+#ifdef burm_INCLUDE_EXTRA
+
+#ifdef __STDC__
+int burm_label(burm_NODEPTR_TYPE n) {
+#else
+int burm_label(n) burm_NODEPTR_TYPE n; {
+#endif
+ burm_assert(n, burm_PANIC("NULL pointer passed to burm_label\n"));
+ switch (burm_OP_LABEL(n)) {
+ default: burm_PANIC("Bad op %d in burm_label\n", burm_OP_LABEL(n)); abort(); return 0;
+ case 2:
+ case 4:
+ return burm_STATE_LABEL(n) = burm_state(burm_OP_LABEL(n), 0, 0);
+ case 3:
+ return burm_STATE_LABEL(n) = burm_state(burm_OP_LABEL(n), burm_label(burm_LEFT_CHILD(n)), 0);
+ case 1:
+ case 5:
+ case 6:
+ return burm_STATE_LABEL(n) = burm_state(burm_OP_LABEL(n), burm_label(burm_LEFT_CHILD(n)), burm_label(burm_RIGHT_CHILD(n)));
+ }
+}
+#ifdef __STDC__
+burm_NODEPTR_TYPE * burm_kids(burm_NODEPTR_TYPE p, int rulenumber, burm_NODEPTR_TYPE *kids) {
+#else
+burm_NODEPTR_TYPE * burm_kids(p, rulenumber, kids) burm_NODEPTR_TYPE p; int rulenumber; burm_NODEPTR_TYPE *kids; {
+#endif
+ burm_assert(p, burm_PANIC("NULL node pointer passed to burm_kids\n"));
+ burm_assert(kids, burm_PANIC("NULL kids pointer passed to burm_kids\n"));
+ switch (rulenumber) {
+ default:
+ burm_PANIC("Unknown Rule %d in burm_kids;\n", rulenumber);
+ abort();
+ /* NOTREACHED */
+ case 1:
+ case 2:
+ break;
+ case 3:
+ kids[0] = p;
+ break;
+ case 5:
+ kids[0] = burm_LEFT_CHILD(p);
+ kids[1] = burm_RIGHT_CHILD(burm_RIGHT_CHILD(p));
+ break;
+ case 6:
+ kids[0] = burm_LEFT_CHILD(p);
+ break;
+ case 4:
+ case 7:
+ kids[0] = burm_LEFT_CHILD(p);
+ kids[1] = burm_RIGHT_CHILD(p);
+ break;
+ }
+ return kids;
+}
+#endif /* burm_INCLUDE_EXTRA */
+#define burm_addr_NT 3
+#define burm_con_NT 2
+#define burm_reg_NT 1
+#define burm_NT 3
+short burm_closure[4][4] = {
+ { 0, 0, 0, 0,},
+ { 0, 0, 0, 0,},
+ { 0, 0, 0, 0,},
+ { 0, 0, 3, 0,},
+};
+
+
+#define Assign 1
+#define Constant 2
+#define Fetch 3
+#define Four 4
+#define Mul 5
+#define Plus 6
+
+#ifdef __STDC__
+#define ARGS(x) x
+#else
+#define ARGS(x) ()
+#endif
+
+NODEPTR_TYPE buildtree ARGS((int, NODEPTR_TYPE, NODEPTR_TYPE));
+void printcover ARGS((NODEPTR_TYPE, int, int));
+void printtree ARGS((NODEPTR_TYPE));
+int treecost ARGS((NODEPTR_TYPE, int, int));
+void printMatches ARGS((NODEPTR_TYPE));
+int main ARGS((void));
+
+NODEPTR_TYPE buildtree(op, left, right) int op; NODEPTR_TYPE left; NODEPTR_TYPE right; {
+ NODEPTR_TYPE p;
+ extern void *malloc ARGS((unsigned));
+
+ p = (NODEPTR_TYPE) malloc(sizeof *p);
+ p->op = op;
+ p->left = left;
+ p->right = right;
+ return p;
+}
+
+void printcover(p, goalnt, indent) NODEPTR_TYPE p; int goalnt; int indent; {
+ int eruleno = burm_rule(STATE_LABEL(p), goalnt);
+ short *nts = burm_nts[eruleno];
+ NODEPTR_TYPE kids[10];
+ int i;
+
+ if (eruleno == 0) {
+ printf("no cover\n");
+ return;
+ }
+ for (i = 0; i < indent; i++)
+ printf(".");
+ printf("%s\n", burm_string[eruleno]);
+ burm_kids(p, eruleno, kids);
+ for (i = 0; nts[i]; i++)
+ printcover(kids[i], nts[i], indent+1);
+}
+
+void printtree(p) NODEPTR_TYPE p; {
+ int op = burm_op_label(p);
+
+ printf("%s", burm_opname[op]);
+ switch (burm_arity[op]) {
+ case 0:
+ break;
+ case 1:
+ printf("(");
+ printtree(burm_child(p, 0));
+ printf(")");
+ break;
+ case 2:
+ printf("(");
+ printtree(burm_child(p, 0));
+ printf(", ");
+ printtree(burm_child(p, 1));
+ printf(")");
+ break;
+ }
+}
+
+int treecost(p, goalnt, costindex) NODEPTR_TYPE p; int goalnt; int costindex; {
+ int eruleno = burm_rule(STATE_LABEL(p), goalnt);
+ int cost = burm_cost[eruleno][costindex], i;
+ short *nts = burm_nts[eruleno];
+ NODEPTR_TYPE kids[10];
+
+ burm_kids(p, eruleno, kids);
+ for (i = 0; nts[i]; i++)
+ cost += treecost(kids[i], nts[i], costindex);
+ return cost;
+}
+
+void printMatches(p) NODEPTR_TYPE p; {
+ int nt;
+ int eruleno;
+
+ printf("Node 0x%lx= ", (unsigned long)p);
+ printtree(p);
+ printf(" matched rules:\n");
+ for (nt = 1; burm_ntname[nt] != (char*)NULL; nt++)
+ if ((eruleno = burm_rule(STATE_LABEL(p), nt)) != 0)
+ printf("\t%s\n", burm_string[eruleno]);
+}
+
+main() {
+ NODEPTR_TYPE p;
+
+ p = buildtree(Assign,
+ buildtree(Constant, 0, 0),
+ buildtree(Fetch,
+ buildtree(Plus,
+ buildtree(Constant, 0, 0),
+ buildtree(Mul,
+ buildtree(Four, 0, 0),
+ buildtree(Fetch, buildtree(Constant, 0, 0), 0)
+ )
+ ),
+ 0
+ )
+ );
+ printtree(p);
+ printf("\n\n");
+ burm_label(p);
+ printcover(p, 1, 0);
+ printf("\nCover cost == %d\n\n", treecost(p, 1, 0));
+ printMatches(p);
+ return 0;
+}
+
+exit 0
Added: test-suite/trunk/MultiSource/Applications/ClamAV/clamscan.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/ClamAV/clamscan.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/ClamAV/clamscan.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/ClamAV/clamscan.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,2961 @@
+LibClamAV Warning: **************************************************
+LibClamAV Warning: *** The virus database is older than 7 days! ***
+LibClamAV Warning: *** Please update it as soon as possible. ***
+LibClamAV Warning: **************************************************
+Initializing the engine (devel-20071218)
+
+Initializing phishcheck module
+
+Phishcheck: Compiling regex: %s
+
+Phishcheck: Compiling regex: %s
+
+Phishcheck: Compiling regex: %s
+
+Phishcheck: Compiling regex: %s
+
+Phishcheck: Compiling regex: %s
+
+Phishcheck: Compiling regex: %s
+
+Phishcheck module initialized
+
+cli_loaddbdir: Acquiring dbdir lock
+
+Loading databases from %s
+
+in cli_cvdload()
+
+MD5(.tar.gz) = %s
+
+in cli_untgz()
+
+cli_untgz: Unpacking %s
+
+cli_untgz: Unpacking %s
+
+cli_untgz: Unpacking %s
+
+cli_untgz: Unpacking %s
+
+cli_untgz: Unpacking %s
+
+cli_untgz: Unpacking %s
+
+cli_untgz: Unpacking %s
+
+cli_untgz: Unpacking %s
+
+cli_untgz: Unpacking %s
+
+cli_untgz: Unpacking %s
+
+cli_untgz: Unpacking %s
+
+cli_untgz: Unpacking %s
+
+cli_untgz: Unpacking %s
+
+cli_untgz: Unpacking %s
+
+cli_loaddbdir: Acquiring dbdir lock
+
+Loading databases from %s
+
+%s loaded
+
+Initializing engine->root[%d]
+
+Initialising AC pattern matcher of root[%d]
+
+cli_initroots: Initializing BM tables of root[%d]
+
+Initializing engine->root[%d]
+
+Initialising AC pattern matcher of root[%d]
+
+cli_initroots: Initializing BM tables of root[%d]
+
+Initializing engine->root[%d]
+
+Initialising AC pattern matcher of root[%d]
+
+cli_initroots: Initializing BM tables of root[%d]
+
+Initializing engine->root[%d]
+
+Initialising AC pattern matcher of root[%d]
+
+cli_initroots: Initializing BM tables of root[%d]
+
+Initializing engine->root[%d]
+
+Initialising AC pattern matcher of root[%d]
+
+cli_initroots: Initializing BM tables of root[%d]
+
+Initializing engine->root[%d]
+
+Initialising AC pattern matcher of root[%d]
+
+cli_initroots: Initializing BM tables of root[%d]
+
+Initializing engine->root[%d]
+
+Initialising AC pattern matcher of root[%d]
+
+cli_initroots: Initializing BM tables of root[%d]
+
+%s loaded
+
+cli_loadmd5: Initializing MD5 list structure
+
+%s loaded
+
+%s loaded
+
+%s skipped
+
+%s loaded
+
+%s skipped
+
+%s loaded
+
+%s skipped
+
+Loading regex_list
+
+regex_list: Initialising AC pattern matcher
+
+Building regex list
+
+%s loaded
+
+Loading regex_list
+
+regex_list: Initialising AC pattern matcher
+
+Building regex list
+
+%s loaded
+
+%s loaded
+
+%s loaded
+
+Dynamic engine configuration settings:
+
+--------------------------------------
+
+Module PE: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+Module ELF: %s
+
+Module ARCHIVE: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+Module DOCUMENT: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+Module MAIL: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+Module OTHER: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+Module PHISHING %s
+
+ * Submodule %10s: %s
+
+ * Submodule %10s: %s
+
+Scanning README
+README: OK
+Scanning clam-v2.rar
+LibClamAV Warning: RAR code not compiled-in
+Recognized %s file
+
+clam-v2.rar: OK
+Scanning clam-v3.rar
+LibClamAV Warning: RAR code not compiled-in
+Recognized %s file
+
+clam-v3.rar: OK
+Scanning clam.cab
+Recognized %s file
+
+in cli_scanmscab()
+
+CAB: -------------- Cabinet file ----------------
+
+CAB: Cabinet length: %u
+
+CAB: Folders: %u
+
+CAB: Files: %u
+
+CAB: File format version: %u.%u
+
+CAB: Folder record %u
+
+CAB: Folder offset: %u
+
+CAB: Folder compression method: %d
+
+CAB: File record %u
+
+CAB: File name: %s
+
+CAB: File offset: %u
+
+CAB: File folder index: %u
+
+CAB: File attribs: 0x%x
+
+CAB: * file modified since last backup
+
+CAB: Extracting file %s to %s, size %u
+
+Recognized %s file
+
+Matched signature for file type %s
+
+e_lfanew == %d
+
+Machine type: 80386
+
+NumberOfSections: %d
+
+TimeDateStamp: %s
+SizeOfOptionalHeader: %x
+
+File format: PE
+
+MajorLinkerVersion: %d
+
+MinorLinkerVersion: %d
+
+SizeOfCode: 0x%x
+
+SizeOfInitializedData: 0x%x
+
+SizeOfUninitializedData: 0x%x
+
+AddressOfEntryPoint: 0x%x
+
+BaseOfCode: 0x%x
+
+SectionAlignment: 0x%x
+
+FileAlignment: 0x%x
+
+MajorSubsystemVersion: %d
+
+MinorSubsystemVersion: %d
+
+SizeOfImage: 0x%x
+
+SizeOfHeaders: 0x%x
+
+NumberOfRvaAndSizes: %d
+
+Subsystem: Win32 GUI
+
+------------------------------------
+
+Section %d
+
+Section name: %s
+
+Section data (from headers - in memory)
+
+VirtualSize: 0x%x 0x%x
+
+VirtualAddress: 0x%x 0x%x
+
+SizeOfRawData: 0x%x 0x%x
+
+PointerToRawData: 0x%x 0x%x
+
+Section's memory is writeable
+
+------------------------------------
+
+EntryPoint offset: 0x%x (%d)
+
+clam.cab: OK
+Scanning clam.exe
+Recognized %s file
+
+Matched signature for file type %s
+
+e_lfanew == %d
+
+Machine type: 80386
+
+NumberOfSections: %d
+
+TimeDateStamp: %s
+SizeOfOptionalHeader: %x
+
+File format: PE
+
+MajorLinkerVersion: %d
+
+MinorLinkerVersion: %d
+
+SizeOfCode: 0x%x
+
+SizeOfInitializedData: 0x%x
+
+SizeOfUninitializedData: 0x%x
+
+AddressOfEntryPoint: 0x%x
+
+BaseOfCode: 0x%x
+
+SectionAlignment: 0x%x
+
+FileAlignment: 0x%x
+
+MajorSubsystemVersion: %d
+
+MinorSubsystemVersion: %d
+
+SizeOfImage: 0x%x
+
+SizeOfHeaders: 0x%x
+
+NumberOfRvaAndSizes: %d
+
+Subsystem: Win32 GUI
+
+------------------------------------
+
+Section %d
+
+Section name: %s
+
+Section data (from headers - in memory)
+
+VirtualSize: 0x%x 0x%x
+
+VirtualAddress: 0x%x 0x%x
+
+SizeOfRawData: 0x%x 0x%x
+
+PointerToRawData: 0x%x 0x%x
+
+Section's memory is writeable
+
+------------------------------------
+
+EntryPoint offset: 0x%x (%d)
+
+clam.exe: OK
+Scanning clam.exe.bz2
+Recognized %s file
+
+clam.exe.bz2: OK
+Scanning clam.zip
+Recognized %s file
+
+in scanzip()
+
+Unzip: __zip_find_disk_trailer: found file header at %u, shift %u
+
+Zip: %s, crc32: 0x%x, offset: %u, encrypted: %u, compressed: %u, normal: %u, method: %u, ratio: %u (max: %u)
+
+Zip: File decompressed to %s
+
+Recognized %s file
+
+Matched signature for file type %s
+
+e_lfanew == %d
+
+Machine type: 80386
+
+NumberOfSections: %d
+
+TimeDateStamp: %s
+SizeOfOptionalHeader: %x
+
+File format: PE
+
+MajorLinkerVersion: %d
+
+MinorLinkerVersion: %d
+
+SizeOfCode: 0x%x
+
+SizeOfInitializedData: 0x%x
+
+SizeOfUninitializedData: 0x%x
+
+AddressOfEntryPoint: 0x%x
+
+BaseOfCode: 0x%x
+
+SectionAlignment: 0x%x
+
+FileAlignment: 0x%x
+
+MajorSubsystemVersion: %d
+
+MinorSubsystemVersion: %d
+
+SizeOfImage: 0x%x
+
+SizeOfHeaders: 0x%x
+
+NumberOfRvaAndSizes: %d
+
+Subsystem: Win32 GUI
+
+------------------------------------
+
+Section %d
+
+Section name: %s
+
+Section data (from headers - in memory)
+
+VirtualSize: 0x%x 0x%x
+
+VirtualAddress: 0x%x 0x%x
+
+SizeOfRawData: 0x%x 0x%x
+
+PointerToRawData: 0x%x 0x%x
+
+Section's memory is writeable
+
+------------------------------------
+
+EntryPoint offset: 0x%x (%d)
+
+Matched signature for file type %s at %u
+
+clam.zip: OK
+Scanning clamdoc.tar.gz
+Recognized %s file
+
+in cli_scangzip()
+
+Recognized POSIX tar file
+
+in cli_scantar()
+
+In untar(%s, %d)
+
+cli_untar: size = %d
+
+cli_untar: extracting %s
+
+Recognized %s file
+
+in cli_pdf(%s)
+
+cli_pdf: scanning %lu bytes
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+Length is in indirect obj %ld
+
+length in '%s' %ld
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: writing %lu bytes from the stream
+
+cli_pdf: extracted file %d to %s
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+length %ld, calculated_streamlen %ld isFlate %d isASCII85 %d
+
+cli_pdf: flatedecode %lu bytes
+
+cli_pdf: flatedecode in=%lu out=%lu ratio %lu (max %u)
+
+cli_pdf: extracted file %d to %s
+
+cli_pdf: returning %d
+
+Recognized %s file
+
+in cli_check_jpeg_exploit()
+
+clamdoc.tar.gz: OK
+Scanning Doc1.rtf
+Recognized %s file
+
+in cli_scanrtf()
+
+RTF: waiting for magic
+
+RTF: description length:%lu
+
+RTF: in WAIT_DESC
+
+Preparing to dump rtf embedded object, description:%s
+
+RTF: next state: wait_data_size
+
+RTF: in WAIT_DATA_SIZE
+
+Dumping rtf embedded object of size:%lu
+
+RTF: next state: DUMP_DATA
+
+RTF:Scanning embedded object:%s
+
+Decoding ole object
+
+Recognized %s file
+
+Matched signature for file type %s
+
+e_lfanew == %d
+
+Machine type: 80386
+
+NumberOfSections: %d
+
+TimeDateStamp: %s
+SizeOfOptionalHeader: %x
+
+File format: PE
+
+MajorLinkerVersion: %d
+
+MinorLinkerVersion: %d
+
+SizeOfCode: 0x%x
+
+SizeOfInitializedData: 0x%x
+
+SizeOfUninitializedData: 0x%x
+
+AddressOfEntryPoint: 0x%x
+
+BaseOfCode: 0x%x
+
+SectionAlignment: 0x%x
+
+FileAlignment: 0x%x
+
+MajorSubsystemVersion: %d
+
+MinorSubsystemVersion: %d
+
+SizeOfImage: 0x%x
+
+SizeOfHeaders: 0x%x
+
+NumberOfRvaAndSizes: %d
+
+Subsystem: Win32 GUI
+
+------------------------------------
+
+Section %d
+
+Section name: %s
+
+Section data (from headers - in memory)
+
+VirtualSize: 0x%x 0x%x
+
+VirtualAddress: 0x%x 0x%x
+
+SizeOfRawData: 0x%x 0x%x
+
+PointerToRawData: 0x%x 0x%x
+
+Section's memory is writeable
+
+------------------------------------
+
+EntryPoint offset: 0x%x (%d)
+
+RTF: waiting for magic
+
+Warning: rtf objdata magic number not matched, expected:%d, got: %d, at pos:%lu
+
+RTF: description length:%lu
+
+RTF: in WAIT_DESC
+
+Preparing to dump rtf embedded object, description:%s
+
+RTF: next state: wait_data_size
+
+RTF: in WAIT_DATA_SIZE
+
+Dumping rtf embedded object of size:%lu
+
+RTF: next state: DUMP_DATA
+
+RTF:Scanning embedded object:%s
+
+Decoding ole object
+
+Small data (%u bytes)
+
+Doc1.rtf: OK
+Scanning Doc11.rtf
+Recognized %s file
+
+in cli_scanrtf()
+
+RTF: waiting for magic
+
+RTF: description length:%lu
+
+RTF: in WAIT_DESC
+
+Preparing to dump rtf embedded object, description:%s
+
+RTF: next state: wait_data_size
+
+RTF: in WAIT_DATA_SIZE
+
+Dumping rtf embedded object of size:%lu
+
+RTF: next state: DUMP_DATA
+
+RTF:Scanning embedded object:%s
+
+Recognized %s file
+
+in cli_scanole2()
+
+in cli_ole2_extract()
+
+mmap'ed file
+
+
+Magic: 0x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+
+
+CLSID: {
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+}
+
+Minor version: 0x%x
+
+DLL version: 0x%x
+
+Byte Order: %d
+
+Big Block Size: %i
+
+Small Block Size: %i
+
+BAT count: %d
+
+Prop start: %d
+
+SBAT cutoff: %d
+
+SBat start: %d
+
+SBat block count: %d
+
+XBat start: %d
+
+XBat block count: %d
+
+
+Max block number: %lu
+
+%34s
+ [root]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [dir ]
+ b
+ 0x%.8x 0x%.8x
+
+OLE2 dir entry: %s
+
+%34s
+ [dir ]
+ b
+ 0x%.8x 0x%.8x
+
+OLE2 dir entry: %s
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+VBADir: %s
+
+in vba56_dir_read()
+
+Can't open %s
+
+Open PowerPoint Document failed
+
+macro offset: 0x%.4x
+
+macro len: 0x%.4x
+
+
+read macro_info failed
+
+VBADir: %s
+
+in vba56_dir_read()
+
+Can't open %s
+
+Open PowerPoint Document failed
+
+Open WordDocument failed
+
+VBADir: %s
+
+in vba56_dir_read()
+
+Can't open %s
+
+Open PowerPoint Document failed
+
+Open WordDocument failed
+
+Matched signature for file type %s
+
+Recognized %s file
+
+Matched signature for file type %s
+
+e_lfanew == %d
+
+Machine type: 80386
+
+NumberOfSections: %d
+
+TimeDateStamp: %s
+SizeOfOptionalHeader: %x
+
+File format: PE
+
+MajorLinkerVersion: %d
+
+MinorLinkerVersion: %d
+
+SizeOfCode: 0x%x
+
+SizeOfInitializedData: 0x%x
+
+SizeOfUninitializedData: 0x%x
+
+AddressOfEntryPoint: 0x%x
+
+BaseOfCode: 0x%x
+
+SectionAlignment: 0x%x
+
+FileAlignment: 0x%x
+
+MajorSubsystemVersion: %d
+
+MinorSubsystemVersion: %d
+
+SizeOfImage: 0x%x
+
+SizeOfHeaders: 0x%x
+
+NumberOfRvaAndSizes: %d
+
+Subsystem: Win32 GUI
+
+------------------------------------
+
+Section %d
+
+Section name: %s
+
+Section data (from headers - in memory)
+
+VirtualSize: 0x%x 0x%x
+
+VirtualAddress: 0x%x 0x%x
+
+SizeOfRawData: 0x%x 0x%x
+
+PointerToRawData: 0x%x 0x%x
+
+Section's memory is writeable
+
+------------------------------------
+
+EntryPoint offset: 0x%x (%d)
+
+RTF: waiting for magic
+
+Warning: rtf objdata magic number not matched, expected:%d, got: %d, at pos:%lu
+
+Doc11.rtf: OK
+Scanning Doc2.rtf
+Recognized %s file
+
+in cli_scanrtf()
+
+RTF: waiting for magic
+
+RTF: description length:%lu
+
+RTF: in WAIT_DESC
+
+Preparing to dump rtf embedded object, description:%s
+
+RTF: next state: wait_data_size
+
+RTF: in WAIT_DATA_SIZE
+
+Dumping rtf embedded object of size:%lu
+
+RTF: next state: DUMP_DATA
+
+RTF:Scanning embedded object:%s
+
+Recognized %s file
+
+in cli_scanole2()
+
+in cli_ole2_extract()
+
+mmap'ed file
+
+
+Magic: 0x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+
+
+CLSID: {
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+}
+
+Minor version: 0x%x
+
+DLL version: 0x%x
+
+Byte Order: %d
+
+Big Block Size: %i
+
+Small Block Size: %i
+
+BAT count: %d
+
+Prop start: %d
+
+SBAT cutoff: %d
+
+SBat start: %d
+
+SBat block count: %d
+
+XBat start: %d
+
+XBat block count: %d
+
+
+Max block number: %lu
+
+%34s
+ [root]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [dir ]
+ b
+ 0x%.8x 0x%.8x
+
+OLE2 dir entry: %s
+
+%34s
+ [dir ]
+ b
+ 0x%.8x 0x%.8x
+
+OLE2 dir entry: %s
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+VBADir: %s
+
+in vba56_dir_read()
+
+Can't open %s
+
+Open PowerPoint Document failed
+
+macro offset: 0x%.4x
+
+macro len: 0x%.4x
+
+
+read macro_info failed
+
+VBADir: %s
+
+in vba56_dir_read()
+
+Can't open %s
+
+Open PowerPoint Document failed
+
+Open WordDocument failed
+
+VBADir: %s
+
+in vba56_dir_read()
+
+Can't open %s
+
+Open PowerPoint Document failed
+
+Open WordDocument failed
+
+Matched signature for file type %s
+
+Recognized %s file
+
+Matched signature for file type %s
+
+e_lfanew == %d
+
+Machine type: 80386
+
+NumberOfSections: %d
+
+TimeDateStamp: %s
+SizeOfOptionalHeader: %x
+
+File format: PE
+
+MajorLinkerVersion: %d
+
+MinorLinkerVersion: %d
+
+SizeOfCode: 0x%x
+
+SizeOfInitializedData: 0x%x
+
+SizeOfUninitializedData: 0x%x
+
+AddressOfEntryPoint: 0x%x
+
+BaseOfCode: 0x%x
+
+SectionAlignment: 0x%x
+
+FileAlignment: 0x%x
+
+MajorSubsystemVersion: %d
+
+MinorSubsystemVersion: %d
+
+SizeOfImage: 0x%x
+
+SizeOfHeaders: 0x%x
+
+NumberOfRvaAndSizes: %d
+
+Subsystem: Win32 GUI
+
+------------------------------------
+
+Section %d
+
+Section name: %s
+
+Section data (from headers - in memory)
+
+VirtualSize: 0x%x 0x%x
+
+VirtualAddress: 0x%x 0x%x
+
+SizeOfRawData: 0x%x 0x%x
+
+PointerToRawData: 0x%x 0x%x
+
+Section's memory is writeable
+
+------------------------------------
+
+EntryPoint offset: 0x%x (%d)
+
+RTF: waiting for magic
+
+Warning: rtf objdata magic number not matched, expected:%d, got: %d, at pos:%lu
+
+Doc2.rtf: OK
+Scanning Doc22.rtf
+Recognized %s file
+
+in cli_scanrtf()
+
+RTF: waiting for magic
+
+RTF: description length:%lu
+
+RTF: in WAIT_DESC
+
+Preparing to dump rtf embedded object, description:%s
+
+RTF: next state: wait_data_size
+
+RTF: in WAIT_DATA_SIZE
+
+Dumping rtf embedded object of size:%lu
+
+RTF: next state: DUMP_DATA
+
+RTF:Scanning embedded object:%s
+
+Recognized %s file
+
+in cli_scanole2()
+
+in cli_ole2_extract()
+
+mmap'ed file
+
+
+Magic: 0x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+
+
+CLSID: {
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+}
+
+Minor version: 0x%x
+
+DLL version: 0x%x
+
+Byte Order: %d
+
+Big Block Size: %i
+
+Small Block Size: %i
+
+BAT count: %d
+
+Prop start: %d
+
+SBAT cutoff: %d
+
+SBat start: %d
+
+SBat block count: %d
+
+XBat start: %d
+
+XBat block count: %d
+
+
+Max block number: %lu
+
+%34s
+ [root]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [dir ]
+ b
+ 0x%.8x 0x%.8x
+
+OLE2 dir entry: %s
+
+%34s
+ [dir ]
+ b
+ 0x%.8x 0x%.8x
+
+OLE2 dir entry: %s
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+VBADir: %s
+
+in vba56_dir_read()
+
+Can't open %s
+
+Open PowerPoint Document failed
+
+macro offset: 0x%.4x
+
+macro len: 0x%.4x
+
+
+read macro_info failed
+
+VBADir: %s
+
+in vba56_dir_read()
+
+Can't open %s
+
+Open PowerPoint Document failed
+
+Open WordDocument failed
+
+VBADir: %s
+
+in vba56_dir_read()
+
+Can't open %s
+
+Open PowerPoint Document failed
+
+Open WordDocument failed
+
+Matched signature for file type %s
+
+Recognized %s file
+
+Matched signature for file type %s
+
+e_lfanew == %d
+
+Machine type: 80386
+
+NumberOfSections: %d
+
+TimeDateStamp: %s
+SizeOfOptionalHeader: %x
+
+File format: PE
+
+MajorLinkerVersion: %d
+
+MinorLinkerVersion: %d
+
+SizeOfCode: 0x%x
+
+SizeOfInitializedData: 0x%x
+
+SizeOfUninitializedData: 0x%x
+
+AddressOfEntryPoint: 0x%x
+
+BaseOfCode: 0x%x
+
+SectionAlignment: 0x%x
+
+FileAlignment: 0x%x
+
+MajorSubsystemVersion: %d
+
+MinorSubsystemVersion: %d
+
+SizeOfImage: 0x%x
+
+SizeOfHeaders: 0x%x
+
+NumberOfRvaAndSizes: %d
+
+Subsystem: Win32 GUI
+
+------------------------------------
+
+Section %d
+
+Section name: %s
+
+Section data (from headers - in memory)
+
+VirtualSize: 0x%x 0x%x
+
+VirtualAddress: 0x%x 0x%x
+
+SizeOfRawData: 0x%x 0x%x
+
+PointerToRawData: 0x%x 0x%x
+
+Section's memory is writeable
+
+------------------------------------
+
+EntryPoint offset: 0x%x (%d)
+
+RTF: waiting for magic
+
+Warning: rtf objdata magic number not matched, expected:%d, got: %d, at pos:%lu
+
+Doc22.rtf: OK
+Scanning doc3.rtf
+Recognized %s file
+
+in cli_scanrtf()
+
+RTF: waiting for magic
+
+RTF: description length:%lu
+
+RTF: in WAIT_DESC
+
+Preparing to dump rtf embedded object, description:%s
+
+RTF: next state: wait_data_size
+
+RTF: in WAIT_DATA_SIZE
+
+Dumping rtf embedded object of size:%lu
+
+RTF: next state: DUMP_DATA
+
+RTF:Scanning embedded object:%s
+
+Recognized %s file
+
+in cli_scanole2()
+
+in cli_ole2_extract()
+
+mmap'ed file
+
+
+Magic: 0x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+
+
+CLSID: {
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+}
+
+Minor version: 0x%x
+
+DLL version: 0x%x
+
+Byte Order: %d
+
+Big Block Size: %i
+
+Small Block Size: %i
+
+BAT count: %d
+
+Prop start: %d
+
+SBAT cutoff: %d
+
+SBat start: %d
+
+SBat block count: %d
+
+XBat start: %d
+
+XBat block count: %d
+
+
+Max block number: %lu
+
+%34s
+ [root]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [dir ]
+ b
+ 0x%.8x 0x%.8x
+
+OLE2 dir entry: %s
+
+%34s
+ [dir ]
+ b
+ 0x%.8x 0x%.8x
+
+OLE2 dir entry: %s
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [dir ]
+ b
+ 0x%.8x 0x%.8x
+
+OLE2 dir entry: %s
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [dir ]
+ b
+ 0x%.8x 0x%.8x
+
+OLE2 dir entry: %s
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+VBADir: %s
+
+in vba56_dir_read()
+
+Can't open %s
+
+Open PowerPoint Document failed
+
+macro offset: 0x%.4x
+
+macro len: 0x%.4x
+
+
+read macro_info failed
+
+VBADir: %s
+
+in vba56_dir_read()
+
+Can't open %s
+
+Open PowerPoint Document failed
+
+Open WordDocument failed
+
+VBADir: %s
+
+in vba56_dir_read()
+
+Can't open %s
+
+Open PowerPoint Document failed
+
+macro offset: 0x%.4x
+
+macro len: 0x%.4x
+
+
+read macro_info failed
+
+VBADir: %s
+
+in vba56_dir_read()
+
+Can't open %s
+
+Open PowerPoint Document failed
+
+Open WordDocument failed
+
+VBADir: %s
+
+in vba56_dir_read()
+
+Can't open %s
+
+Open PowerPoint Document failed
+
+Open WordDocument failed
+
+Matched signature for file type %s
+
+Recognized %s file
+
+Matched signature for file type %s
+
+e_lfanew == %d
+
+Machine type: 80386
+
+NumberOfSections: %d
+
+TimeDateStamp: %s
+SizeOfOptionalHeader: %x
+
+File format: PE
+
+MajorLinkerVersion: %d
+
+MinorLinkerVersion: %d
+
+SizeOfCode: 0x%x
+
+SizeOfInitializedData: 0x%x
+
+SizeOfUninitializedData: 0x%x
+
+AddressOfEntryPoint: 0x%x
+
+BaseOfCode: 0x%x
+
+SectionAlignment: 0x%x
+
+FileAlignment: 0x%x
+
+MajorSubsystemVersion: %d
+
+MinorSubsystemVersion: %d
+
+SizeOfImage: 0x%x
+
+SizeOfHeaders: 0x%x
+
+NumberOfRvaAndSizes: %d
+
+Subsystem: Win32 GUI
+
+------------------------------------
+
+Section %d
+
+Section name: %s
+
+Section data (from headers - in memory)
+
+VirtualSize: 0x%x 0x%x
+
+VirtualAddress: 0x%x 0x%x
+
+SizeOfRawData: 0x%x 0x%x
+
+PointerToRawData: 0x%x 0x%x
+
+Section's memory is writeable
+
+------------------------------------
+
+EntryPoint offset: 0x%x (%d)
+
+RTF: waiting for magic
+
+Warning: rtf objdata magic number not matched, expected:%d, got: %d, at pos:%lu
+
+doc3.rtf: OK
+Scanning docCLAMexe.rtf
+Recognized %s file
+
+in cli_scanrtf()
+
+RTF: waiting for magic
+
+RTF: description length:%lu
+
+RTF: in WAIT_DESC
+
+Preparing to dump rtf embedded object, description:%s
+
+RTF: next state: wait_data_size
+
+RTF: in WAIT_DATA_SIZE
+
+Dumping rtf embedded object of size:%lu
+
+RTF: next state: DUMP_DATA
+
+RTF:Scanning embedded object:%s
+
+Decoding ole object
+
+Recognized %s file
+
+Matched signature for file type %s
+
+e_lfanew == %d
+
+Machine type: 80386
+
+NumberOfSections: %d
+
+TimeDateStamp: %s
+SizeOfOptionalHeader: %x
+
+File format: PE
+
+MajorLinkerVersion: %d
+
+MinorLinkerVersion: %d
+
+SizeOfCode: 0x%x
+
+SizeOfInitializedData: 0x%x
+
+SizeOfUninitializedData: 0x%x
+
+AddressOfEntryPoint: 0x%x
+
+BaseOfCode: 0x%x
+
+SectionAlignment: 0x%x
+
+FileAlignment: 0x%x
+
+MajorSubsystemVersion: %d
+
+MinorSubsystemVersion: %d
+
+SizeOfImage: 0x%x
+
+SizeOfHeaders: 0x%x
+
+NumberOfRvaAndSizes: %d
+
+Subsystem: Win32 GUI
+
+------------------------------------
+
+Section %d
+
+Section name: %s
+
+Section data (from headers - in memory)
+
+VirtualSize: 0x%x 0x%x
+
+VirtualAddress: 0x%x 0x%x
+
+SizeOfRawData: 0x%x 0x%x
+
+PointerToRawData: 0x%x 0x%x
+
+Section's memory is writeable
+
+------------------------------------
+
+EntryPoint offset: 0x%x (%d)
+
+RTF: waiting for magic
+
+Warning: rtf objdata magic number not matched, expected:%d, got: %d, at pos:%lu
+
+RTF: description length:%lu
+
+RTF: in WAIT_DESC
+
+Preparing to dump rtf embedded object, description:%s
+
+RTF: next state: wait_data_size
+
+RTF: in WAIT_DATA_SIZE
+
+Dumping rtf embedded object of size:%lu
+
+RTF: next state: DUMP_DATA
+
+RTF:Scanning embedded object:%s
+
+Decoding ole object
+
+Small data (%u bytes)
+
+docCLAMexe.rtf: OK
+Scanning rtf-novirus.rtf
+Recognized %s file
+
+in cli_scanrtf()
+
+RTF: waiting for magic
+
+RTF: description length:%lu
+
+RTF: in WAIT_DESC
+
+Preparing to dump rtf embedded object, description:%s
+
+RTF: next state: wait_data_size
+
+RTF: in WAIT_DATA_SIZE
+
+Dumping rtf embedded object of size:%lu
+
+RTF: next state: DUMP_DATA
+
+RTF:Scanning embedded object:%s
+
+Recognized %s file
+
+in cli_scanole2()
+
+in cli_ole2_extract()
+
+mmap'ed file
+
+
+Magic: 0x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+
+
+CLSID: {
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+}
+
+Minor version: 0x%x
+
+DLL version: 0x%x
+
+Byte Order: %d
+
+Big Block Size: %i
+
+Small Block Size: %i
+
+BAT count: %d
+
+Prop start: %d
+
+SBAT cutoff: %d
+
+SBat start: %d
+
+SBat block count: %d
+
+XBat start: %d
+
+XBat block count: %d
+
+
+Max block number: %lu
+
+%34s
+ [root]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+VBADir: %s
+
+in vba56_dir_read()
+
+Can't open %s
+
+Open PowerPoint Document failed
+
+No macros detected
+
+RTF: waiting for magic
+
+Warning: rtf objdata magic number not matched, expected:%d, got: %d, at pos:%lu
+
+RTF: waiting for magic
+
+RTF: description length:%lu
+
+RTF: in WAIT_DESC
+
+Preparing to dump rtf embedded object, description:%s
+
+RTF: next state: wait_data_size
+
+RTF: in WAIT_DATA_SIZE
+
+Dumping rtf embedded object of size:%lu
+
+RTF: next state: DUMP_DATA
+
+RTF:Scanning embedded object:%s
+
+Recognized %s file
+
+in cli_scanole2()
+
+in cli_ole2_extract()
+
+mmap'ed file
+
+
+Magic: 0x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+
+
+CLSID: {
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+%x
+}
+
+Minor version: 0x%x
+
+DLL version: 0x%x
+
+Byte Order: %d
+
+Big Block Size: %i
+
+Small Block Size: %i
+
+BAT count: %d
+
+Prop start: %d
+
+SBAT cutoff: %d
+
+SBat start: %d
+
+SBat block count: %d
+
+XBat start: %d
+
+XBat block count: %d
+
+
+Max block number: %lu
+
+%34s
+ [root]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ b
+ 0x%.8x 0x%.8x
+
+%34s
+ [file]
+ r
+ 0x%.8x 0x%.8x
+
+VBADir: %s
+
+in vba56_dir_read()
+
+Can't open %s
+
+Open PowerPoint Document failed
+
+No macros detected
+
+RTF: waiting for magic
+
+Warning: rtf objdata magic number not matched, expected:%d, got: %d, at pos:%lu
+
+rtf-novirus.rtf: OK
+Scanning rtf1.rtf
+Recognized %s file
+
+in cli_scanrtf()
+
+RTF: waiting for magic
+
+RTF: description length:%lu
+
+RTF: in WAIT_DESC
+
+Preparing to dump rtf embedded object, description:%s
+
+RTF: next state: wait_data_size
+
+RTF: in WAIT_DATA_SIZE
+
+Dumping rtf embedded object of size:%lu
+
+RTF: next state: DUMP_DATA
+
+RTF:Scanning embedded object:%s
+
+Decoding ole object
+
+RTF: waiting for magic
+
+Warning: rtf objdata magic number not matched, expected:%d, got: %d, at pos:%lu
+
+RTF: description length:%lu
+
+RTF: in WAIT_DESC
+
+Preparing to dump rtf embedded object, description:%s
+
+RTF: next state: wait_data_size
+
+RTF: in WAIT_DATA_SIZE
+
+Dumping rtf embedded object of size:%lu
+
+RTF: next state: DUMP_DATA
+
+RTF:Scanning embedded object:%s
+
+Decoding ole object
+
+Small data (%u bytes)
+
+RTF: waiting for magic
+
+RTF: description length:%lu
+
+RTF: in WAIT_DESC
+
+Preparing to dump rtf embedded object, description:%s
+
+RTF: next state: wait_data_size
+
+RTF: in WAIT_DATA_SIZE
+
+Dumping rtf embedded object of size:%lu
+
+RTF: next state: DUMP_DATA
+
+RTF:Scanning embedded object:%s
+
+Decoding ole object
+
+Recognized %s file
+
+Matched signature for file type %s
+
+e_lfanew == %d
+
+Machine type: 80386
+
+NumberOfSections: %d
+
+TimeDateStamp: %s
+SizeOfOptionalHeader: %x
+
+File format: PE
+
+MajorLinkerVersion: %d
+
+MinorLinkerVersion: %d
+
+SizeOfCode: 0x%x
+
+SizeOfInitializedData: 0x%x
+
+SizeOfUninitializedData: 0x%x
+
+AddressOfEntryPoint: 0x%x
+
+BaseOfCode: 0x%x
+
+SectionAlignment: 0x%x
+
+FileAlignment: 0x%x
+
+MajorSubsystemVersion: %d
+
+MinorSubsystemVersion: %d
+
+SizeOfImage: 0x%x
+
+SizeOfHeaders: 0x%x
+
+NumberOfRvaAndSizes: %d
+
+Subsystem: Win32 GUI
+
+------------------------------------
+
+Section %d
+
+Section name: %s
+
+Section data (from headers - in memory)
+
+VirtualSize: 0x%x 0x%x
+
+VirtualAddress: 0x%x 0x%x
+
+SizeOfRawData: 0x%x 0x%x
+
+PointerToRawData: 0x%x 0x%x
+
+Section's memory is writeable
+
+------------------------------------
+
+EntryPoint offset: 0x%x (%d)
+
+RTF: waiting for magic
+
+Warning: rtf objdata magic number not matched, expected:%d, got: %d, at pos:%lu
+
+RTF: description length:%lu
+
+RTF: in WAIT_DESC
+
+Preparing to dump rtf embedded object, description:%s
+
+RTF: next state: wait_data_size
+
+RTF: in WAIT_DATA_SIZE
+
+Dumping rtf embedded object of size:%lu
+
+RTF: next state: DUMP_DATA
+
+RTF:Scanning embedded object:%s
+
+Decoding ole object
+
+Small data (%u bytes)
+
+rtf1.rtf: OK
+Cleaning up phishcheck
+
+Freeing phishcheck struct
+
+Phishcheck cleaned up
+
+
+----------- SCAN SUMMARY -----------
+Known viruses: 19590
+Engine version: devel-20071218
+Scanned directories: 1
+Scanned files: 16
+Infected files: 0
+Data scanned: 1.89 MB
+exit 0
Added: test-suite/trunk/MultiSource/Applications/JM/ldecod/ldecod.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/JM/ldecod/ldecod.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/JM/ldecod/ldecod.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/JM/ldecod/ldecod.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,34 @@
+----------------------------- JM 12.1 (FRExt) -----------------------------
+ Decoder config file : (null)
+--------------------------------------------------------------------------
+ Input H.264 bitstream : test.264
+ Output decoded YUV : Output/test_dec.yuv
+ Output status file : log.dec
+ Input reference file : test_rec.yuv
+--------------------------------------------------------------------------
+POC must = frame# or field# for SNRs to be correct
+--------------------------------------------------------------------------
+ Frame POC Pic# QP SnrY SnrU SnrV Y:U:V Time(ms)
+--------------------------------------------------------------------------
+0000(I) 0 0 28 0.0000 0.0000 0.0000 4:2:2 0
+0002(P) 4 1 28 0.0000 0.0000 0.0000 4:2:2 0
+0001(B) 2 2 30 0.0000 0.0000 0.0000 4:2:2 0
+0004(P) 8 2 28 0.0000 0.0000 0.0000 4:2:2 0
+0003(B) 6 3 30 0.0000 0.0000 0.0000 4:2:2 0
+0006(P) 12 3 28 0.0000 0.0000 0.0000 4:2:2 0
+0005(B) 10 4 30 0.0000 0.0000 0.0000 4:2:2 0
+0008(P) 16 4 28 0.0000 0.0000 0.0000 4:2:2 0
+0007(B) 14 5 30 0.0000 0.0000 0.0000 4:2:2 0
+0010(P) 20 5 28 0.0000 0.0000 0.0000 4:2:2 0
+0009(B) 18 6 30 0.0000 0.0000 0.0000 4:2:2 0
+0012(P) 24 6 28 0.0000 0.0000 0.0000 4:2:2 0
+0011(B) 22 7 30 0.0000 0.0000 0.0000 4:2:2 0
+0014(P) 28 7 28 0.0000 0.0000 0.0000 4:2:2 0
+0013(B) 26 8 30 0.0000 0.0000 0.0000 4:2:2 0
+-------------------- Average SNR all frames ------------------------------
+ SNR Y(dB) : 0.00
+ SNR U(dB) : 0.00
+ SNR V(dB) : 0.00
+--------------------------------------------------------------------------
+ Exit JM 12 (FRExt) decoder, ver 12.1
+exit 0
Added: test-suite/trunk/MultiSource/Applications/JM/lencod/lencod.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/JM/lencod/lencod.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/JM/lencod/lencod.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/JM/lencod/lencod.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,73 @@
+Setting Default Parameters...
+Parsing Configfile encoder.cfg............................................................................................................................................................................................................................
+Parsing command line string 'IGNORED'.
+Parsing command line string 'IGNORED'.
+Parsing command line string 'IGNORED'.
+
+------------------------------- JM 12.1 (FRExt) --------------------------------
+ Input YUV file : foreman_part_qcif_444.yuv
+ Output H.264 bitstream : Output/test.264
+ Output YUV file : Output/test_rec.yuv
+ YUV Format : YUV 4:2:2
+ Frames to be encoded I-P/B : 8/7
+ PicInterlace / MbInterlace : 0/0
+ Transform8x8Mode : 1
+-------------------------------------------------------------------------------
+ Frame Bit/pic QP SnrY SnrU SnrV Time(ms) MET(ms) Frm/Fld Ref
+-------------------------------------------------------------------------------
+0000(NVB) 0
+0000(IDR) 0 28 37.492 37.535 39.793 0 0 FRM 1
+0002(P) 0 28 43.547 38.497 36.904 0 0 FRM 1
+0001(B) 0 30 43.308 32.833 33.469 0 0 FRM 0
+0004(P) 0 28 44.991 33.902 34.510 0 0 FRM 1
+0003(B) 0 30 35.568 36.845 38.115 0 0 FRM 0
+0006(P) 0 28 36.908 37.322 39.341 0 0 FRM 1
+0005(B) 0 30 42.171 38.433 36.416 0 0 FRM 0
+0008(P) 0 28 43.508 39.754 38.446 0 0 FRM 1
+0007(B) 0 30 42.371 32.743 33.310 0 0 FRM 0
+0010(P) 0 28 44.658 33.887 34.472 0 0 FRM 1
+0009(B) 0 30 36.034 37.083 38.584 0 0 FRM 0
+0012(P) 0 28 36.888 37.454 38.867 0 0 FRM 1
+0011(B) 0 30 42.237 39.691 38.114 0 0 FRM 0
+0014(P) 0 28 43.365 39.852 38.752 0 0 FRM 1
+0013(B) 0 30 41.805 32.659 33.524 0 0 FRM 0
+-------------------------------------------------------------------------------
+ Total Frames: 15 (8)
+ Leaky BucketRateFile does not have valid entries.
+ Using rate calculated from avg. rate
+-------------------------------------------------------------------------------
+ Freq. for encoded bitstream : 15
+ ME Metric for Refinement Level 0 : SAD
+ ME Metric for Refinement Level 1 : Hadamard SAD
+ ME Metric for Refinement Level 2 : Hadamard SAD
+ Mode Decision Metric : Hadamard SAD
+ Motion Estimation for components : Y
+ Image format : 176x144
+ Error robustness : Off
+ Search range : 16
+ Total number of references : 5
+ References for P slices : 5
+ List0 references for B slices : 5
+ List1 references for B slices : 1
+ Sequence type : I-B-P-B-P (QP: I 28, P 28, B 30)
+ Entropy coding method : CABAC
+ Profile/Level IDC : (144,40)
+ Motion Estimation Scheme : Fast Full Search
+ Search range restrictions : none
+ RD-optimized mode decision : used
+ Data Partitioning Mode : 1 partition
+ Output File Format : H.264 Bit Stream File Format
+------------------ Average data all frames -----------------------------------
+ PSNR Y(dB) : 40.99
+ PSNR U(dB) : 36.57
+ PSNR V(dB) : 36.84
+ cSNR Y(dB) : 39.71 ( 6.96)
+ cSNR U(dB) : 35.79 (17.15)
+ cSNR V(dB) : 36.22 (15.51)
+ Total bits : 199896 (I 21480, P 94872, B 83368 NVB 176)
+ Bit rate (kbit/s) @ 30.00 Hz : 399.79
+ Bits to avoid Startcode Emulation : 0
+ Bits for parameter sets : 176
+-------------------------------------------------------------------------------
+Exit JM 12 (FRExt) encoder ver 12.1
+exit 0
Added: test-suite/trunk/MultiSource/Applications/JM/lencod/lencod.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/JM/lencod/lencod.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/JM/lencod/lencod.reference_output.small (added)
+++ test-suite/trunk/MultiSource/Applications/JM/lencod/lencod.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,61 @@
+Setting Default Parameters...
+Parsing Configfile encoder_small.cfg............................................................................................................................................................................................................................
+Parsing command line string 'IGNORED'.
+Parsing command line string 'IGNORED'.
+Parsing command line string 'IGNORED'.
+
+------------------------------- JM 12.1 (FRExt) --------------------------------
+ Input YUV file : foreman_part_qcif_444.yuv
+ Output H.264 bitstream : Output/test.264
+ Output YUV file : Output/test_rec.yuv
+ YUV Format : YUV 4:2:2
+ Frames to be encoded I-P/B : 2/1
+ PicInterlace / MbInterlace : 0/0
+ Transform8x8Mode : 1
+-------------------------------------------------------------------------------
+ Frame Bit/pic QP SnrY SnrU SnrV Time(ms) MET(ms) Frm/Fld Ref
+-------------------------------------------------------------------------------
+0000(NVB) 0
+0000(IDR) 0 28 37.492 37.535 39.793 0 0 FRM 1
+0002(P) 0 28 43.547 38.497 36.904 0 0 FRM 1
+0001(B) 0 30 43.308 32.833 33.469 0 0 FRM 0
+-------------------------------------------------------------------------------
+ Total Frames: 3 (2)
+ Leaky BucketRateFile does not have valid entries.
+ Using rate calculated from avg. rate
+-------------------------------------------------------------------------------
+ Freq. for encoded bitstream : 15
+ ME Metric for Refinement Level 0 : SAD
+ ME Metric for Refinement Level 1 : Hadamard SAD
+ ME Metric for Refinement Level 2 : Hadamard SAD
+ Mode Decision Metric : Hadamard SAD
+ Motion Estimation for components : Y
+ Image format : 176x144
+ Error robustness : Off
+ Search range : 16
+ Total number of references : 5
+ References for P slices : 5
+ List0 references for B slices : 5
+ List1 references for B slices : 1
+ Sequence type : I-B-P-B-P (QP: I 28, P 28, B 30)
+ Entropy coding method : CABAC
+ Profile/Level IDC : (144,40)
+ Motion Estimation Scheme : Fast Full Search
+ Search range restrictions : none
+ RD-optimized mode decision : used
+ Data Partitioning Mode : 1 partition
+ Output File Format : H.264 Bit Stream File Format
+------------------ Average data all frames -----------------------------------
+ PSNR Y(dB) : 41.45
+ PSNR U(dB) : 36.29
+ PSNR V(dB) : 36.72
+ cSNR Y(dB) : 40.47 ( 5.83)
+ cSNR U(dB) : 35.54 (18.18)
+ cSNR V(dB) : 35.97 (16.45)
+ Total bits : 62080 (I 21480, P 4920, B 35504 NVB 176)
+ Bit rate (kbit/s) @ 30.00 Hz : 620.80
+ Bits to avoid Startcode Emulation : 0
+ Bits for parameter sets : 176
+-------------------------------------------------------------------------------
+Exit JM 12 (FRExt) encoder ver 12.1
+exit 0
Added: test-suite/trunk/MultiSource/Applications/SIBsim4/SIBsim4.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/SIBsim4/SIBsim4.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/SIBsim4/SIBsim4.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/SIBsim4/SIBsim4.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,295 @@
+
+>4.143962167-143965267 Slice, no description; LEN=303101
+>MUSSPSYN Mouse spermidine synthase mRNA, complete cds.; LEN=1282
+
+29-268 (4-242) 99% -> (GT/AG) 24
+526-646 (243-363) 100% -> (GT/AG) 24
+964-1056 (364-456) 100% -> (GT/AG) 24
+1770-1923 (457-610) 100% -> (GT/AG) 24
+2250-2479 (611-840) 100% -> (GT/AG) 24
+2565-2687 (841-963) 99% -> (GT/AG) 24
+2769-3074 (964-1279) 96%
+
+ 0 . : . : . : . : . :
+ 29 GTTGTGCTGGGGGGGGTCCGCGCGCCCTGCAGTCCCGAACCCGCTACGCG
+ |||||||||||||||-||||||||||||||||||||||||||||||||||
+ 4 GTTGTGCTGGGGGGG TCCGCGCGCCCTGCAGTCCCGAACCCGCTACGCG
+
+ 50 . : . : . : . : . :
+ 79 CTCCGTCGGCCCGCCCGCCCGCCATGGAGCCTGGCCCCGACGGCCCAGCC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 53 CTCCGTCGGCCCGCCCGCCCGCCATGGAGCCTGGCCCCGACGGCCCAGCC
+
+ 100 . : . : . : . : . :
+ 129 GCGCCCGGCCCCGCCGCCATCCGTGAGGGCTGGTTCCGAGAGACCTGCAG
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 103 GCGCCCGGCCCCGCCGCCATCCGTGAGGGCTGGTTCCGAGAGACCTGCAG
+
+ 150 . : . : . : . : . :
+ 179 CCTGTGGCCCGGCCAGGCCCTGTCGCTGCAAGTGGAGCAGCTGCTTCACC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 153 CCTGTGGCCCGGCCAGGCCCTGTCGCTGCAAGTGGAGCAGCTGCTTCACC
+
+ 200 . : . : . : . : . :
+ 229 ACCGGCGATCGCGGTACCAAGACATCCTCGTCTTCCGCAGGTA...CAGT
+ ||||||||||||||||||||||||||||||||||||||||>>>...>>>|
+ 203 ACCGGCGATCGCGGTACCAAGACATCCTCGTCTTCCGCAG T
+
+ 250 . : . : . : . : . :
+ 527 AAAACCTACGGCAACGTGCTGGTTCTGGATGGCGTCATCCAGTGTACTGA
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 244 AAAACCTACGGCAACGTGCTGGTTCTGGATGGCGTCATCCAGTGTACTGA
+
+ 300 . : . : . : . : . :
+ 577 GAGGGATGAGTTCTCCTACCAGGAGATGATCGCCAACCTGCCGCTCTGCA
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 294 GAGGGATGAGTTCTCCTACCAGGAGATGATCGCCAACCTGCCGCTCTGCA
+
+ 350 . : . : . : . : . :
+ 627 GCCACCCCAACCCGCGGAAGGTA...CAGGTGCTGATCATCGGGGGTGGA
+ ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
+ 344 GCCACCCCAACCCGCGGAAG GTGCTGATCATCGGGGGTGGA
+
+ 400 . : . : . : . : . :
+ 985 GATGGGGGCGTCCTACGGGAAGTGGTGAAGCACCCCTCTGTGGAGTCGGT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 385 GATGGGGGCGTCCTACGGGAAGTGGTGAAGCACCCCTCTGTGGAGTCGGT
+
+ 450 . : . : . : . : . :
+ 1035 GGTCCAGTGCGAGATTGATGAGGTG...CAGGATGTCATTGAAGTCTCTA
+ ||||||||||||||||||||||>>>...>>>|||||||||||||||||||
+ 435 GGTCCAGTGCGAGATTGATGAG GATGTCATTGAAGTCTCTA
+
+ 500 . : . : . : . : . :
+ 1789 AGAAGTTCCTGCCTGGCATGGCCGTTGGCTTCTCCAGCTCAAAGCTGACT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 476 AGAAGTTCCTGCCTGGCATGGCCGTTGGCTTCTCCAGCTCAAAGCTGACT
+
+ 550 . : . : . : . : . :
+ 1839 CTCCACGTGGGCGATGGCTTTGAGTTCATGAAACAGAACCAAGATGCCTT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 526 CTCCACGTGGGCGATGGCTTTGAGTTCATGAAACAGAACCAAGATGCCTT
+
+ 600 . : . : . : . : . :
+ 1889 TGACGTCATCATCACCGACTCCTCAGACCCCATGGGTG...TAGGCCCTG
+ |||||||||||||||||||||||||||||||||||>>>...>>>||||||
+ 576 TGACGTCATCATCACCGACTCCTCAGACCCCATGG GCCCTG
+
+ 650 . : . : . : . : . :
+ 2256 CTGAGAGCCTCTTCAAGGAGTCCTATTACCAGCTCATGAAGACAGCACTC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 617 CTGAGAGCCTCTTCAAGGAGTCCTATTACCAGCTCATGAAGACAGCACTC
+
+ 700 . : . : . : . : . :
+ 2306 AAAGAAGATGGCATCCTGTGCTGCCAGGGTGAGTGCCAGTGGCTGCACCT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 667 AAAGAAGATGGCATCCTGTGCTGCCAGGGTGAGTGCCAGTGGCTGCACCT
+
+ 750 . : . : . : . : . :
+ 2356 GGACCTCATCAAGGAGATGAGGCACTTCTGCAAATCTCTCTTCCCCGTGG
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 717 GGACCTCATCAAGGAGATGAGGCACTTCTGCAAATCTCTCTTCCCCGTGG
+
+ 800 . : . : . : . : . :
+ 2406 TGGACTACGCCTACTGTAGCATTCCTACCTATCCCAGCGGCCAGATCGGC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 767 TGGACTACGCCTACTGTAGCATTCCTACCTATCCCAGCGGCCAGATCGGC
+
+ 850 . : . : . : . : . :
+ 2456 TTCATGCTGTGTAGCAAAAACCCGGTG...CAGAGCACCAACTTCCGGGA
+ ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
+ 817 TTCATGCTGTGTAGCAAAAACCCG AGCACCAACTTCCGGGA
+
+ 900 . : . : . : . : . :
+ 2582 GCCAGTGCAGCAGTTGACACAGGCCCAGGTGGAGCAGATGCAGCTGAAAT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 858 GCCAGTGCAGCAGTTGACACAGGCCCAGGTGGAGCAGATGCAGCTGAAAT
+
+ 950 . : . : . : . : . :
+ 2632 ACTATAACTCGGACATGCACCGTGCCGCCTTCGTACTGCCCGAGTTCACC
+ |||||||||||||||||||||||||||||||||||||||| |||||||||
+ 908 ACTATAACTCGGACATGCACCGTGCCGCCTTCGTACTGCCTGAGTTCACC
+
+ 1000 . : . : . : . : . :
+ 2682 CGGAAGGTG...CAGGCCCTCAATGACATAAGCTGAATCCAGGTGCCACT
+ ||||||>>>...>>>|||||||||||||||||||||||||||||||||||
+ 958 CGGAAG GCCCTCAATGACATAAGCTGAATCCAGGTGCCACT
+
+ 1050 . : . : . : . : . :
+ 2804 GTGACACCACCCGAGACCTCAATCGGATTGGACCAAGGATCTTCCAAGTT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 999 GTGACACCACCCGAGACCTCAATCGGATTGGACCAAGGATCTTCCAAGTT
+
+ 1100 . : . : . : . : . :
+ 2854 GTCTGGGGACCACCAGTCCTGGACCAGACTCCCAGATGACTCTTGCCCAC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 1049 GTCTGGGGACCACCAGTCCTGGACCAGACTCCCAGATGACTCTTGCCCAC
+
+ 1150 . : . : . : . : . :
+ 2904 CAACCAAGTGTTACAGGCCCCACGATGCTGCCTGGCCTGGCCTGGCCTGG
+ |||||||||||||||||||||| |||||||||||||||||||||||||||
+ 1099 CAACCAAGTGTTACAGGCCCCATGATGCTGCCTGGCCTGGCCTGGCCTGG
+
+ 1200 . : . : . : . : . :
+ 2954 CCTG CC C TGCTGGGTGGACTCAGTCTCTGTCTGTCTATCT
+ ||||-||---|------|||||||||||||||||||||||||||||||||
+ 1149 CCTGGCCTGGCCTGCCCTGCTGGGTGGACTCAGTCTCTGTCTGTCTATCT
+
+ 1250 . : . : . : . : . :
+ 2994 CTGTGGCGTTCAGCCCCACGCCTATACCAGCTCTGTACAGCACCGCCTAT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 1199 CTGTGGCGTTCAGCCCCACGCCTATACCAGCTCTGTACAGCACCGCCTAT
+
+ 1300 . : . : . :
+ 3044 GCCCTGTGACCCAACAAAATACATGTGTATT
+ |||||||||||||||||||||||||||||||
+ 1249 GCCCTGTGACCCAACAAAATACATGTGTATT
+
+
+>4.143962167-143965267 Slice, no description; LEN=303101
+>MUSSPSYN Mouse spermidine synthase mRNA, complete cds.; LEN=1282
+
+29-268 (4-242) 99% -> (GT/AG) 24
+526-646 (243-363) 100% -> (GT/AG) 24
+964-1056 (364-456) 100% -> (GT/AG) 24
+1770-1923 (457-610) 100% -> (GT/AG) 24
+2250-2479 (611-840) 100% -> (GT/AG) 24
+2565-2687 (841-963) 99% -> (GT/AG) 24
+2769-3074 (964-1279) 96%
+
+ 0 . : . : . : . : . :
+ 29 GTTGTGCTGGGGGGGGTCCGCGCGCCCTGCAGTCCCGAACCCGCTACGCG
+ |||||||||||||||-||||||||||||||||||||||||||||||||||
+ 4 GTTGTGCTGGGGGGG TCCGCGCGCCCTGCAGTCCCGAACCCGCTACGCG
+
+ 50 . : . : . : . : . :
+ 79 CTCCGTCGGCCCGCCCGCCCGCCATGGAGCCTGGCCCCGACGGCCCAGCC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 53 CTCCGTCGGCCCGCCCGCCCGCCATGGAGCCTGGCCCCGACGGCCCAGCC
+
+ 100 . : . : . : . : . :
+ 129 GCGCCCGGCCCCGCCGCCATCCGTGAGGGCTGGTTCCGAGAGACCTGCAG
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 103 GCGCCCGGCCCCGCCGCCATCCGTGAGGGCTGGTTCCGAGAGACCTGCAG
+
+ 150 . : . : . : . : . :
+ 179 CCTGTGGCCCGGCCAGGCCCTGTCGCTGCAAGTGGAGCAGCTGCTTCACC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 153 CCTGTGGCCCGGCCAGGCCCTGTCGCTGCAAGTGGAGCAGCTGCTTCACC
+
+ 200 . : . : . : . : . :
+ 229 ACCGGCGATCGCGGTACCAAGACATCCTCGTCTTCCGCAGGTA...CAGT
+ ||||||||||||||||||||||||||||||||||||||||>>>...>>>|
+ 203 ACCGGCGATCGCGGTACCAAGACATCCTCGTCTTCCGCAG T
+
+ 250 . : . : . : . : . :
+ 527 AAAACCTACGGCAACGTGCTGGTTCTGGATGGCGTCATCCAGTGTACTGA
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 244 AAAACCTACGGCAACGTGCTGGTTCTGGATGGCGTCATCCAGTGTACTGA
+
+ 300 . : . : . : . : . :
+ 577 GAGGGATGAGTTCTCCTACCAGGAGATGATCGCCAACCTGCCGCTCTGCA
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 294 GAGGGATGAGTTCTCCTACCAGGAGATGATCGCCAACCTGCCGCTCTGCA
+
+ 350 . : . : . : . : . :
+ 627 GCCACCCCAACCCGCGGAAGGTA...CAGGTGCTGATCATCGGGGGTGGA
+ ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
+ 344 GCCACCCCAACCCGCGGAAG GTGCTGATCATCGGGGGTGGA
+
+ 400 . : . : . : . : . :
+ 985 GATGGGGGCGTCCTACGGGAAGTGGTGAAGCACCCCTCTGTGGAGTCGGT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 385 GATGGGGGCGTCCTACGGGAAGTGGTGAAGCACCCCTCTGTGGAGTCGGT
+
+ 450 . : . : . : . : . :
+ 1035 GGTCCAGTGCGAGATTGATGAGGTG...CAGGATGTCATTGAAGTCTCTA
+ ||||||||||||||||||||||>>>...>>>|||||||||||||||||||
+ 435 GGTCCAGTGCGAGATTGATGAG GATGTCATTGAAGTCTCTA
+
+ 500 . : . : . : . : . :
+ 1789 AGAAGTTCCTGCCTGGCATGGCCGTTGGCTTCTCCAGCTCAAAGCTGACT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 476 AGAAGTTCCTGCCTGGCATGGCCGTTGGCTTCTCCAGCTCAAAGCTGACT
+
+ 550 . : . : . : . : . :
+ 1839 CTCCACGTGGGCGATGGCTTTGAGTTCATGAAACAGAACCAAGATGCCTT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 526 CTCCACGTGGGCGATGGCTTTGAGTTCATGAAACAGAACCAAGATGCCTT
+
+ 600 . : . : . : . : . :
+ 1889 TGACGTCATCATCACCGACTCCTCAGACCCCATGGGTG...TAGGCCCTG
+ |||||||||||||||||||||||||||||||||||>>>...>>>||||||
+ 576 TGACGTCATCATCACCGACTCCTCAGACCCCATGG GCCCTG
+
+ 650 . : . : . : . : . :
+ 2256 CTGAGAGCCTCTTCAAGGAGTCCTATTACCAGCTCATGAAGACAGCACTC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 617 CTGAGAGCCTCTTCAAGGAGTCCTATTACCAGCTCATGAAGACAGCACTC
+
+ 700 . : . : . : . : . :
+ 2306 AAAGAAGATGGCATCCTGTGCTGCCAGGGTGAGTGCCAGTGGCTGCACCT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 667 AAAGAAGATGGCATCCTGTGCTGCCAGGGTGAGTGCCAGTGGCTGCACCT
+
+ 750 . : . : . : . : . :
+ 2356 GGACCTCATCAAGGAGATGAGGCACTTCTGCAAATCTCTCTTCCCCGTGG
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 717 GGACCTCATCAAGGAGATGAGGCACTTCTGCAAATCTCTCTTCCCCGTGG
+
+ 800 . : . : . : . : . :
+ 2406 TGGACTACGCCTACTGTAGCATTCCTACCTATCCCAGCGGCCAGATCGGC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 767 TGGACTACGCCTACTGTAGCATTCCTACCTATCCCAGCGGCCAGATCGGC
+
+ 850 . : . : . : . : . :
+ 2456 TTCATGCTGTGTAGCAAAAACCCGGTG...CAGAGCACCAACTTCCGGGA
+ ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
+ 817 TTCATGCTGTGTAGCAAAAACCCG AGCACCAACTTCCGGGA
+
+ 900 . : . : . : . : . :
+ 2582 GCCAGTGCAGCAGTTGACACAGGCCCAGGTGGAGCAGATGCAGCTGAAAT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 858 GCCAGTGCAGCAGTTGACACAGGCCCAGGTGGAGCAGATGCAGCTGAAAT
+
+ 950 . : . : . : . : . :
+ 2632 ACTATAACTCGGACATGCACCGTGCCGCCTTCGTACTGCCCGAGTTCACC
+ |||||||||||||||||||||||||||||||||||||||| |||||||||
+ 908 ACTATAACTCGGACATGCACCGTGCCGCCTTCGTACTGCCTGAGTTCACC
+
+ 1000 . : . : . : . : . :
+ 2682 CGGAAGGTG...CAGGCCCTCAATGACATAAGCTGAATCCAGGTGCCACT
+ ||||||>>>...>>>|||||||||||||||||||||||||||||||||||
+ 958 CGGAAG GCCCTCAATGACATAAGCTGAATCCAGGTGCCACT
+
+ 1050 . : . : . : . : . :
+ 2804 GTGACACCACCCGAGACCTCAATCGGATTGGACCAAGGATCTTCCAAGTT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 999 GTGACACCACCCGAGACCTCAATCGGATTGGACCAAGGATCTTCCAAGTT
+
+ 1100 . : . : . : . : . :
+ 2854 GTCTGGGGACCACCAGTCCTGGACCAGACTCCCAGATGACTCTTGCCCAC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 1049 GTCTGGGGACCACCAGTCCTGGACCAGACTCCCAGATGACTCTTGCCCAC
+
+ 1150 . : . : . : . : . :
+ 2904 CAACCAAGTGTTACAGGCCCCACGATGCTGCCTGGCCTGGCCTGGCCTGG
+ |||||||||||||||||||||| |||||||||||||||||||||||||||
+ 1099 CAACCAAGTGTTACAGGCCCCATGATGCTGCCTGGCCTGGCCTGGCCTGG
+
+ 1200 . : . : . : . : . :
+ 2954 CCTG CC C TGCTGGGTGGACTCAGTCTCTGTCTGTCTATCT
+ ||||-||---|------|||||||||||||||||||||||||||||||||
+ 1149 CCTGGCCTGGCCTGCCCTGCTGGGTGGACTCAGTCTCTGTCTGTCTATCT
+
+ 1250 . : . : . : . : . :
+ 2994 CTGTGGCGTTCAGCCCCACGCCTATACCAGCTCTGTACAGCACCGCCTAT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 1199 CTGTGGCGTTCAGCCCCACGCCTATACCAGCTCTGTACAGCACCGCCTAT
+
+ 1300 . : . : . :
+ 3044 GCCCTGTGACCCAACAAAATACATGTGTATT
+ |||||||||||||||||||||||||||||||
+ 1249 GCCCTGTGACCCAACAAAATACATGTGTATT
+
+exit 0
Added: test-suite/trunk/MultiSource/Applications/SIBsim4/SIBsim4.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/SIBsim4/SIBsim4.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/SIBsim4/SIBsim4.reference_output.small (added)
+++ test-suite/trunk/MultiSource/Applications/SIBsim4/SIBsim4.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,332 @@
+
+>4.143962167-143965267 Slice, no description; LEN=61271
+>MUSSPSYN Mouse spermidine synthase mRNA, complete cds.; LEN=1282
+
+29-268 (4-242) 99% -> (GT/AG) 24
+526-646 (243-363) 100% -> (GT/AG) 24
+964-1056 (364-456) 100% -> (GT/AG) 24
+1770-1923 (457-610) 100% -> (GT/AG) 24
+2250-2479 (611-840) 100% -> (GT/AG) 24
+2565-2687 (841-963) 99% -> (GT/AG) 24
+2769-3074 (964-1279) 96%
+
+ 0 . : . : . : . : . :
+ 29 GTTGTGCTGGGGGGGGTCCGCGCGCCCTGCAGTCCCGAACCCGCTACGCG
+ |||||||||||||||-||||||||||||||||||||||||||||||||||
+ 4 GTTGTGCTGGGGGGG TCCGCGCGCCCTGCAGTCCCGAACCCGCTACGCG
+
+ 50 . : . : . : . : . :
+ 79 CTCCGTCGGCCCGCCCGCCCGCCATGGAGCCTGGCCCCGACGGCCCAGCC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 53 CTCCGTCGGCCCGCCCGCCCGCCATGGAGCCTGGCCCCGACGGCCCAGCC
+
+ 100 . : . : . : . : . :
+ 129 GCGCCCGGCCCCGCCGCCATCCGTGAGGGCTGGTTCCGAGAGACCTGCAG
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 103 GCGCCCGGCCCCGCCGCCATCCGTGAGGGCTGGTTCCGAGAGACCTGCAG
+
+ 150 . : . : . : . : . :
+ 179 CCTGTGGCCCGGCCAGGCCCTGTCGCTGCAAGTGGAGCAGCTGCTTCACC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 153 CCTGTGGCCCGGCCAGGCCCTGTCGCTGCAAGTGGAGCAGCTGCTTCACC
+
+ 200 . : . : . : . : . :
+ 229 ACCGGCGATCGCGGTACCAAGACATCCTCGTCTTCCGCAGGTA...CAGT
+ ||||||||||||||||||||||||||||||||||||||||>>>...>>>|
+ 203 ACCGGCGATCGCGGTACCAAGACATCCTCGTCTTCCGCAG T
+
+ 250 . : . : . : . : . :
+ 527 AAAACCTACGGCAACGTGCTGGTTCTGGATGGCGTCATCCAGTGTACTGA
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 244 AAAACCTACGGCAACGTGCTGGTTCTGGATGGCGTCATCCAGTGTACTGA
+
+ 300 . : . : . : . : . :
+ 577 GAGGGATGAGTTCTCCTACCAGGAGATGATCGCCAACCTGCCGCTCTGCA
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 294 GAGGGATGAGTTCTCCTACCAGGAGATGATCGCCAACCTGCCGCTCTGCA
+
+ 350 . : . : . : . : . :
+ 627 GCCACCCCAACCCGCGGAAGGTA...CAGGTGCTGATCATCGGGGGTGGA
+ ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
+ 344 GCCACCCCAACCCGCGGAAG GTGCTGATCATCGGGGGTGGA
+
+ 400 . : . : . : . : . :
+ 985 GATGGGGGCGTCCTACGGGAAGTGGTGAAGCACCCCTCTGTGGAGTCGGT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 385 GATGGGGGCGTCCTACGGGAAGTGGTGAAGCACCCCTCTGTGGAGTCGGT
+
+ 450 . : . : . : . : . :
+ 1035 GGTCCAGTGCGAGATTGATGAGGTG...CAGGATGTCATTGAAGTCTCTA
+ ||||||||||||||||||||||>>>...>>>|||||||||||||||||||
+ 435 GGTCCAGTGCGAGATTGATGAG GATGTCATTGAAGTCTCTA
+
+ 500 . : . : . : . : . :
+ 1789 AGAAGTTCCTGCCTGGCATGGCCGTTGGCTTCTCCAGCTCAAAGCTGACT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 476 AGAAGTTCCTGCCTGGCATGGCCGTTGGCTTCTCCAGCTCAAAGCTGACT
+
+ 550 . : . : . : . : . :
+ 1839 CTCCACGTGGGCGATGGCTTTGAGTTCATGAAACAGAACCAAGATGCCTT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 526 CTCCACGTGGGCGATGGCTTTGAGTTCATGAAACAGAACCAAGATGCCTT
+
+ 600 . : . : . : . : . :
+ 1889 TGACGTCATCATCACCGACTCCTCAGACCCCATGGGTG...TAGGCCCTG
+ |||||||||||||||||||||||||||||||||||>>>...>>>||||||
+ 576 TGACGTCATCATCACCGACTCCTCAGACCCCATGG GCCCTG
+
+ 650 . : . : . : . : . :
+ 2256 CTGAGAGCCTCTTCAAGGAGTCCTATTACCAGCTCATGAAGACAGCACTC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 617 CTGAGAGCCTCTTCAAGGAGTCCTATTACCAGCTCATGAAGACAGCACTC
+
+ 700 . : . : . : . : . :
+ 2306 AAAGAAGATGGCATCCTGTGCTGCCAGGGTGAGTGCCAGTGGCTGCACCT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 667 AAAGAAGATGGCATCCTGTGCTGCCAGGGTGAGTGCCAGTGGCTGCACCT
+
+ 750 . : . : . : . : . :
+ 2356 GGACCTCATCAAGGAGATGAGGCACTTCTGCAAATCTCTCTTCCCCGTGG
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 717 GGACCTCATCAAGGAGATGAGGCACTTCTGCAAATCTCTCTTCCCCGTGG
+
+ 800 . : . : . : . : . :
+ 2406 TGGACTACGCCTACTGTAGCATTCCTACCTATCCCAGCGGCCAGATCGGC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 767 TGGACTACGCCTACTGTAGCATTCCTACCTATCCCAGCGGCCAGATCGGC
+
+ 850 . : . : . : . : . :
+ 2456 TTCATGCTGTGTAGCAAAAACCCGGTG...CAGAGCACCAACTTCCGGGA
+ ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
+ 817 TTCATGCTGTGTAGCAAAAACCCG AGCACCAACTTCCGGGA
+
+ 900 . : . : . : . : . :
+ 2582 GCCAGTGCAGCAGTTGACACAGGCCCAGGTGGAGCAGATGCAGCTGAAAT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 858 GCCAGTGCAGCAGTTGACACAGGCCCAGGTGGAGCAGATGCAGCTGAAAT
+
+ 950 . : . : . : . : . :
+ 2632 ACTATAACTCGGACATGCACCGTGCCGCCTTCGTACTGCCCGAGTTCACC
+ |||||||||||||||||||||||||||||||||||||||| |||||||||
+ 908 ACTATAACTCGGACATGCACCGTGCCGCCTTCGTACTGCCTGAGTTCACC
+
+ 1000 . : . : . : . : . :
+ 2682 CGGAAGGTG...CAGGCCCTCAATGACATAAGCTGAATCCAGGTGCCACT
+ ||||||>>>...>>>|||||||||||||||||||||||||||||||||||
+ 958 CGGAAG GCCCTCAATGACATAAGCTGAATCCAGGTGCCACT
+
+ 1050 . : . : . : . : . :
+ 2804 GTGACACCACCCGAGACCTCAATCGGATTGGACCAAGGATCTTCCAAGTT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 999 GTGACACCACCCGAGACCTCAATCGGATTGGACCAAGGATCTTCCAAGTT
+
+ 1100 . : . : . : . : . :
+ 2854 GTCTGGGGACCACCAGTCCTGGACCAGACTCCCAGATGACTCTTGCCCAC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 1049 GTCTGGGGACCACCAGTCCTGGACCAGACTCCCAGATGACTCTTGCCCAC
+
+ 1150 . : . : . : . : . :
+ 2904 CAACCAAGTGTTACAGGCCCCACGATGCTGCCTGGCCTGGCCTGGCCTGG
+ |||||||||||||||||||||| |||||||||||||||||||||||||||
+ 1099 CAACCAAGTGTTACAGGCCCCATGATGCTGCCTGGCCTGGCCTGGCCTGG
+
+ 1200 . : . : . : . : . :
+ 2954 CCTG CC C TGCTGGGTGGACTCAGTCTCTGTCTGTCTATCT
+ ||||-||---|------|||||||||||||||||||||||||||||||||
+ 1149 CCTGGCCTGGCCTGCCCTGCTGGGTGGACTCAGTCTCTGTCTGTCTATCT
+
+ 1250 . : . : . : . : . :
+ 2994 CTGTGGCGTTCAGCCCCACGCCTATACCAGCTCTGTACAGCACCGCCTAT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 1199 CTGTGGCGTTCAGCCCCACGCCTATACCAGCTCTGTACAGCACCGCCTAT
+
+ 1300 . : . : . :
+ 3044 GCCCTGTGACCCAACAAAATACATGTGTATT
+ |||||||||||||||||||||||||||||||
+ 1249 GCCCTGTGACCCAACAAAATACATGTGTATT
+
+
+>4.143962167-143965267 Slice, no description; LEN=61271
+>MUSSPSYN Mouse spermidine synthase mRNA, complete cds.; LEN=1282
+
+29-268 (4-242) 99% -> (GT/AG) 24
+526-646 (243-363) 100% -> (GT/AG) 24
+964-1056 (364-456) 100% -> (GT/AG) 24
+1770-1923 (457-610) 100% -> (GT/AG) 24
+2250-2479 (611-840) 100% -> (GT/AG) 24
+2565-2687 (841-963) 99% -> (GT/AG) 24
+2769-3074 (964-1279) 96%
+
+ 0 . : . : . : . : . :
+ 29 GTTGTGCTGGGGGGGGTCCGCGCGCCCTGCAGTCCCGAACCCGCTACGCG
+ |||||||||||||||-||||||||||||||||||||||||||||||||||
+ 4 GTTGTGCTGGGGGGG TCCGCGCGCCCTGCAGTCCCGAACCCGCTACGCG
+
+ 50 . : . : . : . : . :
+ 79 CTCCGTCGGCCCGCCCGCCCGCCATGGAGCCTGGCCCCGACGGCCCAGCC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 53 CTCCGTCGGCCCGCCCGCCCGCCATGGAGCCTGGCCCCGACGGCCCAGCC
+
+ 100 . : . : . : . : . :
+ 129 GCGCCCGGCCCCGCCGCCATCCGTGAGGGCTGGTTCCGAGAGACCTGCAG
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 103 GCGCCCGGCCCCGCCGCCATCCGTGAGGGCTGGTTCCGAGAGACCTGCAG
+
+ 150 . : . : . : . : . :
+ 179 CCTGTGGCCCGGCCAGGCCCTGTCGCTGCAAGTGGAGCAGCTGCTTCACC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 153 CCTGTGGCCCGGCCAGGCCCTGTCGCTGCAAGTGGAGCAGCTGCTTCACC
+
+ 200 . : . : . : . : . :
+ 229 ACCGGCGATCGCGGTACCAAGACATCCTCGTCTTCCGCAGGTA...CAGT
+ ||||||||||||||||||||||||||||||||||||||||>>>...>>>|
+ 203 ACCGGCGATCGCGGTACCAAGACATCCTCGTCTTCCGCAG T
+
+ 250 . : . : . : . : . :
+ 527 AAAACCTACGGCAACGTGCTGGTTCTGGATGGCGTCATCCAGTGTACTGA
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 244 AAAACCTACGGCAACGTGCTGGTTCTGGATGGCGTCATCCAGTGTACTGA
+
+ 300 . : . : . : . : . :
+ 577 GAGGGATGAGTTCTCCTACCAGGAGATGATCGCCAACCTGCCGCTCTGCA
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 294 GAGGGATGAGTTCTCCTACCAGGAGATGATCGCCAACCTGCCGCTCTGCA
+
+ 350 . : . : . : . : . :
+ 627 GCCACCCCAACCCGCGGAAGGTA...CAGGTGCTGATCATCGGGGGTGGA
+ ||||||||||||||||||||>>>...>>>|||||||||||||||||||||
+ 344 GCCACCCCAACCCGCGGAAG GTGCTGATCATCGGGGGTGGA
+
+ 400 . : . : . : . : . :
+ 985 GATGGGGGCGTCCTACGGGAAGTGGTGAAGCACCCCTCTGTGGAGTCGGT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 385 GATGGGGGCGTCCTACGGGAAGTGGTGAAGCACCCCTCTGTGGAGTCGGT
+
+ 450 . : . : . : . : . :
+ 1035 GGTCCAGTGCGAGATTGATGAGGTG...CAGGATGTCATTGAAGTCTCTA
+ ||||||||||||||||||||||>>>...>>>|||||||||||||||||||
+ 435 GGTCCAGTGCGAGATTGATGAG GATGTCATTGAAGTCTCTA
+
+ 500 . : . : . : . : . :
+ 1789 AGAAGTTCCTGCCTGGCATGGCCGTTGGCTTCTCCAGCTCAAAGCTGACT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 476 AGAAGTTCCTGCCTGGCATGGCCGTTGGCTTCTCCAGCTCAAAGCTGACT
+
+ 550 . : . : . : . : . :
+ 1839 CTCCACGTGGGCGATGGCTTTGAGTTCATGAAACAGAACCAAGATGCCTT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 526 CTCCACGTGGGCGATGGCTTTGAGTTCATGAAACAGAACCAAGATGCCTT
+
+ 600 . : . : . : . : . :
+ 1889 TGACGTCATCATCACCGACTCCTCAGACCCCATGGGTG...TAGGCCCTG
+ |||||||||||||||||||||||||||||||||||>>>...>>>||||||
+ 576 TGACGTCATCATCACCGACTCCTCAGACCCCATGG GCCCTG
+
+ 650 . : . : . : . : . :
+ 2256 CTGAGAGCCTCTTCAAGGAGTCCTATTACCAGCTCATGAAGACAGCACTC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 617 CTGAGAGCCTCTTCAAGGAGTCCTATTACCAGCTCATGAAGACAGCACTC
+
+ 700 . : . : . : . : . :
+ 2306 AAAGAAGATGGCATCCTGTGCTGCCAGGGTGAGTGCCAGTGGCTGCACCT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 667 AAAGAAGATGGCATCCTGTGCTGCCAGGGTGAGTGCCAGTGGCTGCACCT
+
+ 750 . : . : . : . : . :
+ 2356 GGACCTCATCAAGGAGATGAGGCACTTCTGCAAATCTCTCTTCCCCGTGG
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 717 GGACCTCATCAAGGAGATGAGGCACTTCTGCAAATCTCTCTTCCCCGTGG
+
+ 800 . : . : . : . : . :
+ 2406 TGGACTACGCCTACTGTAGCATTCCTACCTATCCCAGCGGCCAGATCGGC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 767 TGGACTACGCCTACTGTAGCATTCCTACCTATCCCAGCGGCCAGATCGGC
+
+ 850 . : . : . : . : . :
+ 2456 TTCATGCTGTGTAGCAAAAACCCGGTG...CAGAGCACCAACTTCCGGGA
+ ||||||||||||||||||||||||>>>...>>>|||||||||||||||||
+ 817 TTCATGCTGTGTAGCAAAAACCCG AGCACCAACTTCCGGGA
+
+ 900 . : . : . : . : . :
+ 2582 GCCAGTGCAGCAGTTGACACAGGCCCAGGTGGAGCAGATGCAGCTGAAAT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 858 GCCAGTGCAGCAGTTGACACAGGCCCAGGTGGAGCAGATGCAGCTGAAAT
+
+ 950 . : . : . : . : . :
+ 2632 ACTATAACTCGGACATGCACCGTGCCGCCTTCGTACTGCCCGAGTTCACC
+ |||||||||||||||||||||||||||||||||||||||| |||||||||
+ 908 ACTATAACTCGGACATGCACCGTGCCGCCTTCGTACTGCCTGAGTTCACC
+
+ 1000 . : . : . : . : . :
+ 2682 CGGAAGGTG...CAGGCCCTCAATGACATAAGCTGAATCCAGGTGCCACT
+ ||||||>>>...>>>|||||||||||||||||||||||||||||||||||
+ 958 CGGAAG GCCCTCAATGACATAAGCTGAATCCAGGTGCCACT
+
+ 1050 . : . : . : . : . :
+ 2804 GTGACACCACCCGAGACCTCAATCGGATTGGACCAAGGATCTTCCAAGTT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 999 GTGACACCACCCGAGACCTCAATCGGATTGGACCAAGGATCTTCCAAGTT
+
+ 1100 . : . : . : . : . :
+ 2854 GTCTGGGGACCACCAGTCCTGGACCAGACTCCCAGATGACTCTTGCCCAC
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 1049 GTCTGGGGACCACCAGTCCTGGACCAGACTCCCAGATGACTCTTGCCCAC
+
+ 1150 . : . : . : . : . :
+ 2904 CAACCAAGTGTTACAGGCCCCACGATGCTGCCTGGCCTGGCCTGGCCTGG
+ |||||||||||||||||||||| |||||||||||||||||||||||||||
+ 1099 CAACCAAGTGTTACAGGCCCCATGATGCTGCCTGGCCTGGCCTGGCCTGG
+
+ 1200 . : . : . : . : . :
+ 2954 CCTG CC C TGCTGGGTGGACTCAGTCTCTGTCTGTCTATCT
+ ||||-||---|------|||||||||||||||||||||||||||||||||
+ 1149 CCTGGCCTGGCCTGCCCTGCTGGGTGGACTCAGTCTCTGTCTGTCTATCT
+
+ 1250 . : . : . : . : . :
+ 2994 CTGTGGCGTTCAGCCCCACGCCTATACCAGCTCTGTACAGCACCGCCTAT
+ ||||||||||||||||||||||||||||||||||||||||||||||||||
+ 1199 CTGTGGCGTTCAGCCCCACGCCTATACCAGCTCTGTACAGCACCGCCTAT
+
+ 1300 . : . : . :
+ 3044 GCCCTGTGACCCAACAAAATACATGTGTATT
+ |||||||||||||||||||||||||||||||
+ 1249 GCCCTGTGACCCAACAAAATACATGTGTATT
+
+
+>4.143962167-143965267 Slice, no description; LEN=61271
+>ref|NT_037436.3|:1-300000 Drosophila melanogaster chromosome 3L; LEN=59010
+
+(complement)
+
+12990-13028 (13533-13571) 92% ==
+13818-13833 (15241-15256) 100% ==
+31168-31182 (17060-17074) 100% ==
+41886-41900 (19658-19672) 100% ==
+46554-46569 (22366-22381) 100%
+
+ 0 . : . : . : .
+ 12990 ATATACTTTATATGGTCGGAAAAGCTTCCTTCTGCCTGT
+ ||||||||||||| |||||||| |||||||| |||||||
+ 13533 ATATACTTTATATAGTCGGAAACGCTTCCTTTTGCCTGT
+
+ 0 . : .
+ 13818 ACAATTTATTAAATGG
+ ||||||||||||||||
+ 15241 ACAATTTATTAAATGG
+
+ 0 . : .
+ 31168 GACTGTAGTCAGTCC
+ |||||||||||||||
+ 17060 GACTGTAGTCAGTCC
+
+ 0 . : .
+ 41886 TGAAAATTTTAAAAT
+ |||||||||||||||
+ 19658 TGAAAATTTTAAAAT
+
+ 0 . : .
+ 46554 ATTTATGTGCTATGCA
+ ||||||||||||||||
+ 22366 ATTTATGTGCTATGCA
+
+exit 0
Added: test-suite/trunk/MultiSource/Applications/SPASS/SPASS.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/SPASS/SPASS.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/SPASS/SPASS.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/SPASS/SPASS.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1 @@
+17485914422bce49640cfa07b9862e11
Added: test-suite/trunk/MultiSource/Applications/SPASS/SPASS.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/SPASS/SPASS.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/SPASS/SPASS.reference_output.small (added)
+++ test-suite/trunk/MultiSource/Applications/SPASS/SPASS.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1 @@
+7b26d82848883071c0052d4c95d40023
Added: test-suite/trunk/MultiSource/Applications/aha/aha.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/aha/aha.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/aha/aha.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/aha/aha.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,48 @@
+Searching for programs with 1 operations.
+Found 0 solutions.
+Counters = 104, total = 104
+Searching for programs with 2 operations.
+Found 0 solutions.
+Counters = 448, 11305, total = 11753
+Searching for programs with 3 operations.
+Found 0 solutions.
+Counters = 21914, 53141, 1752237, total = 1827292
+Searching for programs with 4 operations.
+
+Found a 4-operation program:
+ add r1,rx,3
+ and r2,r1,2
+ shr r3,3,r2
+ xor r4,r3,rx
+ Expr: ((3 >>u ((x + 3) & 2)) ^ x)
+
+Found a 4-operation program:
+ add r1,rx,3
+ and r2,r1,2
+ shrs r3,3,r2
+ xor r4,r3,rx
+ Expr: ((3 >>s ((x + 3) & 2)) ^ x)
+
+Found a 4-operation program:
+ sub r1,rx,1
+ and r2,r1,2
+ shr r3,3,r2
+ xor r4,r3,rx
+ Expr: ((3 >>u ((x - 1) & 2)) ^ x)
+
+Found a 4-operation program:
+ sub r1,rx,1
+ and r2,r1,2
+ shrs r3,3,r2
+ xor r4,r3,rx
+ Expr: ((3 >>s ((x - 1) & 2)) ^ x)
+
+Found a 4-operation program:
+ sub r1,-2,rx
+ and r2,r1,2
+ shr r3,3,r2
+ xor r4,r3,rx
+ Expr: ((3 >>u ((-2 - x) & 2)) ^ x)
+Found 5 solutions.
+Counters = 971685, 1006173, 3822690, 85224621, total = 91025169
+exit 0
Added: test-suite/trunk/MultiSource/Applications/d/make_dparser.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/d/make_dparser.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/d/make_dparser.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/d/make_dparser.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1 @@
+2da1fdf178a10a55a8f2c937ba76e015
Added: test-suite/trunk/MultiSource/Applications/hbd/hbd.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/hbd/hbd.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/hbd/hbd.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/hbd/hbd.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,503 @@
+HomeBrew Decompiler. Copyright (c) 1994-2003 Pete Ryland.
+Classfile version 45.3
+Compiled from file.java
+/*
+** Compiled from file.java - COPYRIGHT UNKNOWN.
+**
+** Decompiled using the HomeBrew Decompiler
+** Copyright (c) 1994-2003 Widget (aka Pete Ryland).
+** Available under GPL from http://pdr.cx/hbd/
+*/
+
+import java.rmi.RemoteException;
+import java.rmi.server.UnicastRemoteObject;
+
+synchronized class Sort extends UnicastRemoteObject {
+ public Sort() throws RemoteException {
+ super(); /*0*/
+ }
+ public String BubbleSort[](String var1[]) throws RemoteException {
+ if (var1 == null) { /*0*/
+ return null; /*4*/
+ }
+ var4 = var1.length - 1; /*6*/
+ if (var4 > 0) { /*12*/
+ var3 = 0; /*17*/
+ do {
+ break; /*19*/
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*25*/
+ var2 = var1[var3 + 1]; /*39*/
+ var1[var3 + 1] = var1[var3]; /*45*/
+ var1[var3] = var2; /*53*/
+ }
+ ++var3; /*57*/
+ } while(true); /*60*/
+ --var4; /*63*/
+ } else { /*66*/
+ return var1; /*69*/
+ }
+ public String SelectSort[](String var1[]) throws RemoteException {
+ if (var1 == null) { /*0*/
+ return null; /*4*/
+ }
+ var5 = 0; /*6*/
+ if (var5 < var1.length) { /*9*/
+ var4 = var5; /*16*/
+ var3 = var5; /*20*/
+ do {
+ break; /*23*/
+ if (var1[var3].compareTo(var1[var4]) < 0) { /*29*/
+ var4 = var3; /*42*/
+ }
+ ++var3; /*45*/
+ } while(true); /*48*/
+ if (var4 != var5) { /*51*/
+ var2 = var1[var4]; /*58*/
+ var1[var4] = var1[var5]; /*63*/
+ var1[var5] = var2; /*71*/
+ }
+ ++var5; /*76*/
+ } else { /*79*/
+ return var1; /*82*/
+ }
+ public String Function1[](String var1[]) throws RemoteException {
+ if (var1 == null) { /*0*/
+ return null; /*4*/
+ }
+ var4 = var1.length - 1; /*6*/
+ if (var4 > 0) { /*12*/
+ var3 = 0; /*17*/
+ do {
+ break; /*19*/
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*25*/
+ var2 = var1[var3 + 1]; /*39*/
+ var1[var3 + 1] = var1[var3]; /*45*/
+ var1[var3] = var2; /*53*/
+ }
+ ++var3; /*57*/
+ } while(true); /*60*/
+ --var4; /*63*/
+ } else { /*66*/
+ return var1; /*69*/
+ }
+ public String Function2[](String var1[]) throws RemoteException {
+ if (var1 == null) { /*0*/
+ return null; /*4*/
+ }
+ var6 = var1.length - 1; /*6*/
+ if (var6 > 0) { /*12*/
+ var5 = 0; /*17*/
+ do {
+ break; /*20*/
+ if (var1[var5].compareTo(var1[var5 + 1]) > 0) { /*27*/
+ var2 = var1[var5 + 1]; /*43*/
+ var1[var5 + 1] = var1[var5]; /*50*/
+ var1[var5] = var2; /*60*/
+ }
+ ++var5; /*65*/
+ } while(true); /*68*/
+ --var6; /*71*/
+ } else { /*74*/
+ return var1; /*77*/
+ }
+ public String Function7[](String var1[]) throws RemoteException {
+ if (var1 == null) { /*0*/
+ return null; /*4*/
+ }
+ var4 = var1.length - 1; /*6*/
+ if (var4 > 0) { /*12*/
+ var3 = 0; /*17*/
+ do {
+ break; /*19*/
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*25*/
+ var2 = var1[var3 + 1]; /*39*/
+ var1[var3 + 1] = var1[var3]; /*45*/
+ var1[var3] = var2; /*53*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*57*/
+ var2 = var1[var3 + 1]; /*71*/
+ var1[var3 + 1] = var1[var3]; /*77*/
+ var1[var3] = var2; /*85*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*89*/
+ var2 = var1[var3 + 1]; /*103*/
+ var1[var3 + 1] = var1[var3]; /*109*/
+ var1[var3] = var2; /*117*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*121*/
+ var2 = var1[var3 + 1]; /*135*/
+ var1[var3 + 1] = var1[var3]; /*141*/
+ var1[var3] = var2; /*149*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*153*/
+ var2 = var1[var3 + 1]; /*167*/
+ var1[var3 + 1] = var1[var3]; /*173*/
+ var1[var3] = var2; /*181*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*185*/
+ var2 = var1[var3 + 1]; /*199*/
+ var1[var3 + 1] = var1[var3]; /*205*/
+ var1[var3] = var2; /*213*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*217*/
+ var2 = var1[var3 + 1]; /*231*/
+ var1[var3 + 1] = var1[var3]; /*237*/
+ var1[var3] = var2; /*245*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*249*/
+ var2 = var1[var3 + 1]; /*263*/
+ var1[var3 + 1] = var1[var3]; /*269*/
+ var1[var3] = var2; /*277*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*281*/
+ var2 = var1[var3 + 1]; /*295*/
+ var1[var3 + 1] = var1[var3]; /*301*/
+ var1[var3] = var2; /*309*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*313*/
+ var2 = var1[var3 + 1]; /*327*/
+ var1[var3 + 1] = var1[var3]; /*333*/
+ var1[var3] = var2; /*341*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*345*/
+ var2 = var1[var3 + 1]; /*359*/
+ var1[var3 + 1] = var1[var3]; /*365*/
+ var1[var3] = var2; /*373*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*377*/
+ var2 = var1[var3 + 1]; /*391*/
+ var1[var3 + 1] = var1[var3]; /*397*/
+ var1[var3] = var2; /*405*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*409*/
+ var2 = var1[var3 + 1]; /*423*/
+ var1[var3 + 1] = var1[var3]; /*429*/
+ var1[var3] = var2; /*437*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*441*/
+ var2 = var1[var3 + 1]; /*455*/
+ var1[var3 + 1] = var1[var3]; /*461*/
+ var1[var3] = var2; /*469*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*473*/
+ var2 = var1[var3 + 1]; /*487*/
+ var1[var3 + 1] = var1[var3]; /*493*/
+ var1[var3] = var2; /*501*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*505*/
+ var2 = var1[var3 + 1]; /*519*/
+ var1[var3 + 1] = var1[var3]; /*525*/
+ var1[var3] = var2; /*533*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*537*/
+ var2 = var1[var3 + 1]; /*551*/
+ var1[var3 + 1] = var1[var3]; /*557*/
+ var1[var3] = var2; /*565*/
+ }
+ ++var3; /*569*/
+ } while(true); /*572*/
+ --var4; /*575*/
+ } else { /*578*/
+ return var1; /*581*/
+ }
+ public String Function6[](String var1[]) throws RemoteException {
+ if (var1 == null) { /*0*/
+ return null; /*4*/
+ }
+ var4 = var1.length - 1; /*6*/
+ if (var4 > 0) { /*12*/
+ var3 = 0; /*17*/
+ do {
+ break; /*19*/
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*25*/
+ var2 = var1[var3 + 1]; /*39*/
+ var1[var3 + 1] = var1[var3]; /*45*/
+ var1[var3] = var2; /*53*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*57*/
+ var2 = var1[var3 + 1]; /*71*/
+ var1[var3 + 1] = var1[var3]; /*77*/
+ var1[var3] = var2; /*85*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*89*/
+ var2 = var1[var3 + 1]; /*103*/
+ var1[var3 + 1] = var1[var3]; /*109*/
+ var1[var3] = var2; /*117*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*121*/
+ var2 = var1[var3 + 1]; /*135*/
+ var1[var3 + 1] = var1[var3]; /*141*/
+ var1[var3] = var2; /*149*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*153*/
+ var2 = var1[var3 + 1]; /*167*/
+ var1[var3 + 1] = var1[var3]; /*173*/
+ var1[var3] = var2; /*181*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*185*/
+ var2 = var1[var3 + 1]; /*199*/
+ var1[var3 + 1] = var1[var3]; /*205*/
+ var1[var3] = var2; /*213*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*217*/
+ var2 = var1[var3 + 1]; /*231*/
+ var1[var3 + 1] = var1[var3]; /*237*/
+ var1[var3] = var2; /*245*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*249*/
+ var2 = var1[var3 + 1]; /*263*/
+ var1[var3 + 1] = var1[var3]; /*269*/
+ var1[var3] = var2; /*277*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*281*/
+ var2 = var1[var3 + 1]; /*295*/
+ var1[var3 + 1] = var1[var3]; /*301*/
+ var1[var3] = var2; /*309*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*313*/
+ var2 = var1[var3 + 1]; /*327*/
+ var1[var3 + 1] = var1[var3]; /*333*/
+ var1[var3] = var2; /*341*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*345*/
+ var2 = var1[var3 + 1]; /*359*/
+ var1[var3 + 1] = var1[var3]; /*365*/
+ var1[var3] = var2; /*373*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*377*/
+ var2 = var1[var3 + 1]; /*391*/
+ var1[var3 + 1] = var1[var3]; /*397*/
+ var1[var3] = var2; /*405*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*409*/
+ var2 = var1[var3 + 1]; /*423*/
+ var1[var3 + 1] = var1[var3]; /*429*/
+ var1[var3] = var2; /*437*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*441*/
+ var2 = var1[var3 + 1]; /*455*/
+ var1[var3 + 1] = var1[var3]; /*461*/
+ var1[var3] = var2; /*469*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*473*/
+ var2 = var1[var3 + 1]; /*487*/
+ var1[var3 + 1] = var1[var3]; /*493*/
+ var1[var3] = var2; /*501*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*505*/
+ var2 = var1[var3 + 1]; /*519*/
+ var1[var3 + 1] = var1[var3]; /*525*/
+ var1[var3] = var2; /*533*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*537*/
+ var2 = var1[var3 + 1]; /*551*/
+ var1[var3 + 1] = var1[var3]; /*557*/
+ var1[var3] = var2; /*565*/
+ }
+ ++var3; /*569*/
+ } while(true); /*572*/
+ --var4; /*575*/
+ } else { /*578*/
+ return var1; /*581*/
+ }
+ public String Function5[](String var1[]) throws RemoteException {
+ if (var1 == null) { /*0*/
+ return null; /*4*/
+ }
+ var4 = var1.length - 1; /*6*/
+ if (var4 > 0) { /*12*/
+ var3 = 0; /*17*/
+ do {
+ break; /*19*/
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*25*/
+ var2 = var1[var3 + 1]; /*39*/
+ var1[var3 + 1] = var1[var3]; /*45*/
+ var1[var3] = var2; /*53*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*57*/
+ var2 = var1[var3 + 1]; /*71*/
+ var1[var3 + 1] = var1[var3]; /*77*/
+ var1[var3] = var2; /*85*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*89*/
+ var2 = var1[var3 + 1]; /*103*/
+ var1[var3 + 1] = var1[var3]; /*109*/
+ var1[var3] = var2; /*117*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*121*/
+ var2 = var1[var3 + 1]; /*135*/
+ var1[var3 + 1] = var1[var3]; /*141*/
+ var1[var3] = var2; /*149*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*153*/
+ var2 = var1[var3 + 1]; /*167*/
+ var1[var3 + 1] = var1[var3]; /*173*/
+ var1[var3] = var2; /*181*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*185*/
+ var2 = var1[var3 + 1]; /*199*/
+ var1[var3 + 1] = var1[var3]; /*205*/
+ var1[var3] = var2; /*213*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*217*/
+ var2 = var1[var3 + 1]; /*231*/
+ var1[var3 + 1] = var1[var3]; /*237*/
+ var1[var3] = var2; /*245*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*249*/
+ var2 = var1[var3 + 1]; /*263*/
+ var1[var3 + 1] = var1[var3]; /*269*/
+ var1[var3] = var2; /*277*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*281*/
+ var2 = var1[var3 + 1]; /*295*/
+ var1[var3 + 1] = var1[var3]; /*301*/
+ var1[var3] = var2; /*309*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*313*/
+ var2 = var1[var3 + 1]; /*327*/
+ var1[var3 + 1] = var1[var3]; /*333*/
+ var1[var3] = var2; /*341*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*345*/
+ var2 = var1[var3 + 1]; /*359*/
+ var1[var3 + 1] = var1[var3]; /*365*/
+ var1[var3] = var2; /*373*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*377*/
+ var2 = var1[var3 + 1]; /*391*/
+ var1[var3 + 1] = var1[var3]; /*397*/
+ var1[var3] = var2; /*405*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*409*/
+ var2 = var1[var3 + 1]; /*423*/
+ var1[var3 + 1] = var1[var3]; /*429*/
+ var1[var3] = var2; /*437*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*441*/
+ var2 = var1[var3 + 1]; /*455*/
+ var1[var3 + 1] = var1[var3]; /*461*/
+ var1[var3] = var2; /*469*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*473*/
+ var2 = var1[var3 + 1]; /*487*/
+ var1[var3 + 1] = var1[var3]; /*493*/
+ var1[var3] = var2; /*501*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*505*/
+ var2 = var1[var3 + 1]; /*519*/
+ var1[var3 + 1] = var1[var3]; /*525*/
+ var1[var3] = var2; /*533*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*537*/
+ var2 = var1[var3 + 1]; /*551*/
+ var1[var3 + 1] = var1[var3]; /*557*/
+ var1[var3] = var2; /*565*/
+ }
+ ++var3; /*569*/
+ } while(true); /*572*/
+ --var4; /*575*/
+ } else { /*578*/
+ return var1; /*581*/
+ }
+ public String Function3[](String var1[]) throws RemoteException {
+ if (var1 == null) { /*0*/
+ return null; /*4*/
+ }
+ var4 = var1.length - 1; /*6*/
+ if (var4 > 0) { /*12*/
+ var3 = 0; /*17*/
+ do {
+ break; /*19*/
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*25*/
+ var2 = var1[var3 + 1]; /*39*/
+ var1[var3 + 1] = var1[var3]; /*45*/
+ var1[var3] = var2; /*53*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*57*/
+ var2 = var1[var3 + 1]; /*71*/
+ var1[var3 + 1] = var1[var3]; /*77*/
+ var1[var3] = var2; /*85*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*89*/
+ var2 = var1[var3 + 1]; /*103*/
+ var1[var3 + 1] = var1[var3]; /*109*/
+ var1[var3] = var2; /*117*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*121*/
+ var2 = var1[var3 + 1]; /*135*/
+ var1[var3 + 1] = var1[var3]; /*141*/
+ var1[var3] = var2; /*149*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*153*/
+ var2 = var1[var3 + 1]; /*167*/
+ var1[var3 + 1] = var1[var3]; /*173*/
+ var1[var3] = var2; /*181*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*185*/
+ var2 = var1[var3 + 1]; /*199*/
+ var1[var3 + 1] = var1[var3]; /*205*/
+ var1[var3] = var2; /*213*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*217*/
+ var2 = var1[var3 + 1]; /*231*/
+ var1[var3 + 1] = var1[var3]; /*237*/
+ var1[var3] = var2; /*245*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*249*/
+ var2 = var1[var3 + 1]; /*263*/
+ var1[var3 + 1] = var1[var3]; /*269*/
+ var1[var3] = var2; /*277*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*281*/
+ var2 = var1[var3 + 1]; /*295*/
+ var1[var3 + 1] = var1[var3]; /*301*/
+ var1[var3] = var2; /*309*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*313*/
+ var2 = var1[var3 + 1]; /*327*/
+ var1[var3 + 1] = var1[var3]; /*333*/
+ var1[var3] = var2; /*341*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*345*/
+ var2 = var1[var3 + 1]; /*359*/
+ var1[var3 + 1] = var1[var3]; /*365*/
+ var1[var3] = var2; /*373*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*377*/
+ var2 = var1[var3 + 1]; /*391*/
+ var1[var3 + 1] = var1[var3]; /*397*/
+ var1[var3] = var2; /*405*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*409*/
+ var2 = var1[var3 + 1]; /*423*/
+ var1[var3 + 1] = var1[var3]; /*429*/
+ var1[var3] = var2; /*437*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*441*/
+ var2 = var1[var3 + 1]; /*455*/
+ var1[var3 + 1] = var1[var3]; /*461*/
+ var1[var3] = var2; /*469*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*473*/
+ var2 = var1[var3 + 1]; /*487*/
+ var1[var3 + 1] = var1[var3]; /*493*/
+ var1[var3] = var2; /*501*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*505*/
+ var2 = var1[var3 + 1]; /*519*/
+ var1[var3 + 1] = var1[var3]; /*525*/
+ var1[var3] = var2; /*533*/
+ }
+ if (var1[var3].compareTo(var1[var3 + 1]) > 0) { /*537*/
+ var2 = var1[var3 + 1]; /*551*/
+ var1[var3 + 1] = var1[var3]; /*557*/
+ var1[var3] = var2; /*565*/
+ }
+ ++var3; /*569*/
+ } while(true); /*572*/
+ --var4; /*575*/
+ } else { /*578*/
+ return var1; /*581*/
+ }
+}exit 0
Added: test-suite/trunk/MultiSource/Applications/hexxagon/hexxagon.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/hexxagon/hexxagon.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/hexxagon/hexxagon.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/hexxagon/hexxagon.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,1574 @@
+Hexxagon board game.
+Copyright 2001.
+Erik Jonsson.
+Type "copyright" to see the copyright notice.
+
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . . o
+2- . . . . . .
+3- . . . . . . .
+4- . . . . . . . .
+5- o . . . . . . . x
+6- . . . . . . . .
+7- . . . . . . .
+8- . . . . . .
+9- x . . . o
+
+Bricks: x 3, o 3. Empty 55.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . . o
+2- . . . . . .
+3- . . . . . . .
+4- . . . . . . . .
+5- o . . . . . . . x
+6- . . . . . . . .
+7- . . . . . . .
+8- . . . . . .
+9- x . . . o
+
+Bricks: x 3, o 3. Empty 55.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . . o
+2- . . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- . . . . . . . .
+7- . . . . . . .
+8- . . . . . .
+9- x . . . o
+
+Bricks: x 4, o 3. Empty 54.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- . . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- . . . . . . . .
+7- . . . . . . .
+8- . . . . . .
+9- x . . . o
+
+Bricks: x 4, o 4. Empty 53.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- . . . . . . . .
+7- . . . . . . .
+8- . . . . . .
+9- x . . . o
+
+Bricks: x 5, o 4. Empty 52.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- o . . . . . . .
+7- . . . . . . .
+8- . . . . . .
+9- x . . . o
+
+Bricks: x 5, o 5. Empty 51.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- o . . . . . . x
+7- . . . . . . .
+8- . . . . . .
+9- x . . . o
+
+Bricks: x 6, o 5. Empty 50.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- . . . . . . . x
+7- . . . . . . .
+8- o . . . . .
+9- o . . . o
+
+Bricks: x 5, o 6. Empty 50.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- . . . . . . . .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 6, o 5. Empty 50.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- o . . . . . . .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 6, o 6. Empty 49.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . x x
+6- o . . . . . . .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 7, o 6. Empty 48.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . x x
+6- o o . . . . . .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 7, o 7. Empty 47.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . x x x
+6- o o . . . . . .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 8, o 7. Empty 46.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . o . . . x x x
+6- o o . . . . . .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 8, o 8. Empty 45.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . x . x
+5- o . o . . . x x x
+6- o o . . . . . .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 9, o 8. Empty 44.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o .
+2- x . . . . .
+3- . . . . . . o
+4- . . . . . x . o
+5- o . o . . . x x x
+6- o o . . . . . .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 8, o 9. Empty 44.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o .
+2- x . . . . .
+3- . . . . . . x
+4- . . . . . x x x
+5- o . o . . . x x x
+6- o o . . . . . .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 11, o 7. Empty 43.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . . .
+2- x . . . . .
+3- . . . . . o o
+4- . . . . . o o x
+5- o . o . . . x x x
+6- o o . . . . . .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 8, o 10. Empty 43.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . . .
+2- x . . . . .
+3- . . . . . o o
+4- . . . . . x o x
+5- o . o . . x x x x
+6- o o . . . . . .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 10, o 9. Empty 42.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . . .
+2- x . . . . .
+3- . . . . . . o
+4- . . . . o o o x
+5- o . o . . o x x x
+6- o o . . . . . .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 8, o 11. Empty 42.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . . .
+2- x . . . . .
+3- . . . . . x x
+4- . . . . o x x .
+5- o . o . . o x x x
+6- o o . . . . . .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 11, o 8. Empty 42.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . . .
+2- x . . . . .
+3- . . . . . x x
+4- . . . . o x x .
+5- o . o . . . o o x
+6- o o . . . . o .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 9, o 10. Empty 42.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . . .
+2- x . . . . .
+3- . . . . . x x
+4- . . . . o x x x
+5- o . o . . . o x x
+6- o o . . . . o .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 11, o 9. Empty 41.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . . .
+2- x . . . . .
+3- . . . . o o x
+4- . . . . o o x x
+5- o . o . . . o x x
+6- o o . . . . o .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 9, o 12. Empty 40.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . . .
+2- x . . . x .
+3- . . . . x x .
+4- . . . . o o x x
+5- o . o . . . o x x
+6- o o . . . . o .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 11, o 10. Empty 40.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . . .
+2- x . . o o .
+3- . . . . o x .
+4- . . . . . o x x
+5- o . o . . . o x x
+6- o o . . . . o .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 9, o 12. Empty 40.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . x .
+2- x . . x x .
+3- . . . . o . .
+4- . . . . . o x x
+5- o . o . . . o x x
+6- o o . . . . o .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 11, o 10. Empty 40.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . x .
+2- x . . x o .
+3- . . . . o o .
+4- . . . . . o o x
+5- o . o . . . o x x
+6- o o . . . . o .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 9, o 13. Empty 39.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . x .
+2- x . . x o .
+3- . . . . o x x
+4- . . . . . o x x
+5- o . o . . . o x x
+6- o o . . . . o .
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 12, o 11. Empty 38.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . x .
+2- x . . x o .
+3- . . . . o x x
+4- . . . . . o x x
+5- o . o . . . o o o
+6- o o . . . . o o
+7- . . . . . . .
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 10, o 14. Empty 37.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . x .
+2- x . . x o .
+3- . . . . o x x
+4- . . . . . o x x
+5- o . o . . . o o o
+6- o o . . . . x x
+7- . . . . . . x
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 13, o 12. Empty 36.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . x .
+2- x . . x o o
+3- . . . . o o o
+4- . . . . . o x x
+5- o . o . . . o o o
+6- o o . . . . x x
+7- . . . . . . x
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 11, o 15. Empty 35.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . x x
+2- x . . x x x
+3- . . . . o o o
+4- . . . . . o x x
+5- o . o . . . o o o
+6- o o . . . . x x
+7- . . . . . . x
+8- o . . . . x
+9- o . . . x
+
+Bricks: x 14, o 13. Empty 34.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . x x
+2- x . . x x x
+3- . . . . o o o
+4- . . . . . o x x
+5- o . o . . . . o o
+6- o o . . . . o x
+7- . . . . . o o
+8- o . . . . o
+9- o . . . x
+
+Bricks: x 11, o 16. Empty 34.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . x x
+2- x . . x x x
+3- . . . . o o o
+4- . . . . . x x x
+5- o . o . . . x x o
+6- o o . . . . x x
+7- . . . . . o o
+8- o . . . . o
+9- o . . . x
+
+Bricks: x 15, o 13. Empty 33.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . x x
+2- x . . x x x
+3- . . . . o o o
+4- . . . . . x x x
+5- o . o . . . x x o
+6- o o . . . . x x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 14, o 15. Empty 32.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . x x
+2- . . . x x x
+3- . . . . o o o
+4- . . x . . x x x
+5- o . x . . . x x o
+6- o o . . . . x x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 15, o 14. Empty 32.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . x x
+2- . . . x x x
+3- . . . . o o o
+4- . o o . . x x x
+5- . . o . . . x x o
+6- o o . . . . x x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 13, o 16. Empty 32.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . x x
+2- . . . x x x
+3- . x . . o o o
+4- . x x . . x x x
+5- . . o . . . x x o
+6- o o . . . . x x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 15, o 14. Empty 32.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . x x
+2- . . . x x x
+3- . o o . o o o
+4- . x o . . x x x
+5- . . . . . . x x o
+6- o o . . . . x x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 13, o 16. Empty 32.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . x x
+2- . . . x x x
+3- x x o . o o o
+4- . x o . . x x x
+5- . . . . . . x x o
+6- o o . . . . x x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 15, o 15. Empty 31.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . o o x
+2- . . . o x x
+3- x x . . o o o
+4- . x o . . x x x
+5- . . . . . . x x o
+6- o o . . . . x x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 13, o 17. Empty 31.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . x o x
+2- . . x x x x
+3- x . . . o o o
+4- . x o . . x x x
+5- . . . . . . x x o
+6- o o . . . . x x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 15, o 15. Empty 31.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . x o x
+2- . . x x x x
+3- o o . . o o o
+4- . o o . . x x x
+5- . . . . . . x x o
+6- o o . . . . x x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 13, o 18. Empty 30.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . x o x
+2- x . . x x x
+3- x x . . o o o
+4- . o o . . x x x
+5- . . . . . . x x o
+6- o o . . . . x x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 15, o 16. Empty 30.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . x o x
+2- x . . x x x
+3- x x . . o o o
+4- . o o . . x x x
+5- . . . . . . o x o
+6- o o . . . o o x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 13, o 19. Empty 29.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . x o x
+2- x . . x x x
+3- x x . . o o o
+4- . o o . . x x x
+5- . . . . . x x x o
+6- o o . . . x o x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 16, o 17. Empty 28.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . x o x
+2- x . . x x x
+3- x x . . o o o
+4- . o o . o o x x
+5- . . . . . o x x o
+6- o o . . . x o x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 14, o 20. Empty 27.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- x . . x x x
+3- x x . x x o o
+4- . o o . x o x x
+5- . . . . . o x x o
+6- o o . . . x o x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 16, o 18. Empty 27.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- x o . x x o o
+4- . o . . x o x x
+5- . . . . . o x x o
+6- o o . . . x o x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 14, o 20. Empty 27.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . o . x x o o
+4- . x . . x o x x
+5- . x . . . o x x o
+6- x x . . . x o x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 17, o 17. Empty 27.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . x x o o
+4- . o . . x o x x
+5- . o o . . o x x o
+6- x o . . . x o x
+7- . . . . . o o
+8- o . . . o o
+9- o . . . o
+
+Bricks: x 14, o 20. Empty 27.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . x x o o
+4- . o . . x o x x
+5- . o o . . o x x o
+6- x o . . . x o x
+7- . . . . x x o
+8- o . . . x o
+9- o . . . o
+
+Bricks: x 17, o 18. Empty 26.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . o x o o
+4- . o . o o o x x
+5- . o o . . . x x o
+6- x o . . . x o x
+7- . . . . x x o
+8- o . . . x o
+9- o . . . o
+
+Bricks: x 15, o 20. Empty 26.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . o x o o
+4- . o . o o o x x
+5- . o o . . . x x o
+6- x x . . . x o x
+7- x . . . x x o
+8- x . . . x o
+9- o . . . o
+
+Bricks: x 18, o 18. Empty 25.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . o x o o
+4- . o . o o o x x
+5- . o . . . . x x o
+6- x o . . . x o x
+7- o o . . x x o
+8- o . . . x o
+9- o . . . o
+
+Bricks: x 15, o 21. Empty 25.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . o x o o
+4- . x . o o o x x
+5- . x x . . . x x o
+6- . x . . . x o x
+7- o o . . x x o
+8- o . . . x o
+9- o . . . o
+
+Bricks: x 18, o 18. Empty 25.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . o x o o
+4- . x . o o o x x
+5- . x x . . o o x o
+6- . x . . . o o x
+7- o o . . x x o
+8- o . . . x o
+9- o . . . o
+
+Bricks: x 16, o 21. Empty 24.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . o x o o
+4- . x . o o o x x
+5- . x x . . o o x o
+6- . . . . . o o x
+7- o x . . x x o
+8- x x . . x o
+9- x . . . o
+
+Bricks: x 19, o 18. Empty 24.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . o x o o
+4- . x . o o o x x
+5- . o o . . o o x o
+6- . o . . . o o x
+7- o o . . x x o
+8- x x . . x o
+9- x . . . o
+
+Bricks: x 16, o 22. Empty 23.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . o x o o
+4- . x . o o o x x
+5- . o o . . x o x o
+6- . o . . x x o x
+7- o o . . x x o
+8- x x . . x o
+9- x . . . o
+
+Bricks: x 19, o 20. Empty 22.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . o x o o
+4- . x . o o o x x
+5- . o o . o o o x o
+6- . o . . o x o x
+7- o o . . x x o
+8- x x . . x o
+9- x . . . o
+
+Bricks: x 17, o 23. Empty 21.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . o x o o
+4- . . . o o o x x
+5- . x o . o o o x o
+6- x x . . o x o x
+7- x o . . x x o
+8- x x . . x o
+9- x . . . o
+
+Bricks: x 20, o 20. Empty 21.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . o x o o
+4- . . . o o o x x
+5- o o . . o o o x o
+6- o x . . o x o x
+7- x o . . x x o
+8- x x . . x o
+9- x . . . o
+
+Bricks: x 18, o 22. Empty 21.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . o x o o
+4- . . . x o o x x
+5- o o . x x o o x o
+6- o . . . o x o x
+7- x o . . x x o
+8- x x . . x o
+9- x . . . o
+
+Bricks: x 20, o 20. Empty 21.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . o x o o
+4- . . . x o o x x
+5- o o . o o o o x o
+6- o . . o o x o x
+7- x . . . x x o
+8- x x . . x o
+9- x . . . o
+
+Bricks: x 18, o 22. Empty 21.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . o x o o
+4- . . . x o o x x
+5- o x . o o o o x o
+6- x x . o o x o x
+7- x . . . x x o
+8- . x . . x o
+9- x . . . o
+
+Bricks: x 20, o 20. Empty 21.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- o o . x x x
+3- . . . o x o o
+4- o . . x o o x x
+5- o o . o o o o x o
+6- x x . o o x o x
+7- x . . . x x o
+8- . x . . x o
+9- x . . . o
+
+Bricks: x 19, o 22. Empty 20.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- x x . x x x
+3- . x . o x o o
+4- o . . . o o x x
+5- o o . o o o o x o
+6- x x . o o x o x
+7- x . . . x x o
+8- . x . . x o
+9- x . . . o
+
+Bricks: x 21, o 20. Empty 20.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- x x . x x x
+3- . x . o x o o
+4- o . . . o o x x
+5- o o . . o o o x o
+6- x o . o o x o x
+7- o o . . x x o
+8- . o . . x o
+9- x . . . o
+
+Bricks: x 18, o 23. Empty 20.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- x x . x x x
+3- . x . o x o o
+4- o . . . o o x x
+5- o o . . o o o x o
+6- x o . o o x o x
+7- x x . . x x o
+8- x x . . x o
+9- x . . . o
+
+Bricks: x 22, o 20. Empty 19.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- x o o o x x
+3- . x . o x o o
+4- o . . . o o x x
+5- o o . . o o o x o
+6- x o . o o x o x
+7- x x . . x x o
+8- x x . . x o
+9- x . . . o
+
+Bricks: x 20, o 23. Empty 18.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- x x x o x x
+3- . x x x . o o
+4- o . . . o o x x
+5- o o . . o o o x o
+6- x o . o o x o x
+7- x x . . x x o
+8- x x . . x o
+9- x . . . o
+
+Bricks: x 23, o 20. Empty 18.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- x x x o o x
+3- . x x o o o .
+4- o . . . o o x x
+5- o o . . o o o x o
+6- x o . o o x o x
+7- x x . . x x o
+8- x x . . x o
+9- x . . . o
+
+Bricks: x 21, o 22. Empty 18.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- x x x o o x
+3- . x x o o x x
+4- o . . . o o x x
+5- o o . . o o o x o
+6- x o . o o x o x
+7- x x . . x x o
+8- x x . . x o
+9- x . . . o
+
+Bricks: x 23, o 21. Empty 17.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- x x x o o x
+3- . x x o o x x
+4- o . . . o o x x
+5- o o . . o o o x o
+6- x o . o o x o x
+7- x o o . x x o
+8- x o . . x o
+9- x . . . o
+
+Bricks: x 21, o 24. Empty 16.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- x x x o o x
+3- . x x x o x x
+4- o . . x x o x x
+5- o o . . x o o x o
+6- x o . o o x o x
+7- x o o . x x o
+8- x o . . x o
+9- x . . . o
+
+Bricks: x 25, o 21. Empty 15.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- x x x o o x
+3- . o o x o x x
+4- o . o o x o x x
+5- o o . . x o o x o
+6- x o . . o x o x
+7- x o o . x x o
+8- x o . . x o
+9- x . . . o
+
+Bricks: x 22, o 24. Empty 15.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- x x x o o x
+3- . o o x o x x
+4- o . o o x o x x
+5- o o . . . o o x o
+6- x x x . o x o x
+7- x x x . x x o
+8- x o . . x o
+9- x . . . o
+
+Bricks: x 25, o 21. Empty 15.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- x x x o o x
+3- . o o x o x x
+4- o . o . x o x x
+5- o o . . . o o x o
+6- x x o o o x o x
+7- x x o . x x o
+8- x o . . x o
+9- x . . . o
+
+Bricks: x 23, o 23. Empty 15.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- x x x o o x
+3- . o o x o x x
+4- o . x . x o x x
+5- o x x . . o o x o
+6- x x x o o x o x
+7- x x o . x x o
+8- x o . . x o
+9- x . . . o
+
+Bricks: x 27, o 20. Empty 14.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . . o x
+2- x x x o o x
+3- . o . x o x x
+4- o o o . x o x x
+5- o o o . . o o x o
+6- x x x o o x o x
+7- x x o . x x o
+8- x o . . x o
+9- x . . . o
+
+Bricks: x 24, o 23. Empty 14.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . x x x
+2- x . x x o x
+3- . o . x o x x
+4- o o o . x o x x
+5- o o o . . o o x o
+6- x x x o o x o x
+7- x x o . x x o
+8- x o . . x o
+9- x . . . o
+
+Bricks: x 26, o 21. Empty 14.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . o o x x
+2- x . o x o x
+3- . . . x o x x
+4- o o o . x o x x
+5- o o o . . o o x o
+6- x x x o o x o x
+7- x x o . x x o
+8- x o . . x o
+9- x . . . o
+
+Bricks: x 24, o 23. Empty 14.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . o o x x
+2- x . o x o x
+3- . . . x o x x
+4- o o x . . o x x
+5- o o x x . o o x o
+6- x x x x o x o x
+7- x x o . x x o
+8- x o . . x o
+9- x . . . o
+
+Bricks: x 27, o 20. Empty 14.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . o o x x
+2- x . o x o x
+3- . . . x o x x
+4- o o x . . o x x
+5- o o x x . o o x o
+6- x x x o o x o x
+7- x x o o o x o
+8- x o . . x o
+9- x . . . o
+
+Bricks: x 25, o 23. Empty 13.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . o o x x
+2- x . o x o x
+3- . . . x o x x
+4- o o x . . o x x
+5- o o x x . o o x o
+6- x x x o o x o x
+7- x x x x o x o
+8- x x x . . o
+9- x . . . o
+
+Bricks: x 28, o 20. Empty 13.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . o o x x
+2- o . o x o x
+3- . o . x o x x
+4- o o o . . o x x
+5- o o x x . o o x o
+6- x x x o o x o x
+7- x x x x o x o
+8- x x x . . o
+9- x . . . o
+
+Bricks: x 26, o 23. Empty 12.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x o x x
+2- x x x . o x
+3- . x . x o x x
+4- o o o . . o x x
+5- o o x x . o o x o
+6- x x x o o x o x
+7- x x x x o x o
+8- x x x . . o
+9- x . . . o
+
+Bricks: x 30, o 19. Empty 12.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x o o x
+2- x x o o o x
+3- . x . o o x x
+4- o o o . . . x x
+5- o o x x . o o x o
+6- x x x o o x o x
+7- x x x x o x o
+8- x x x . . o
+9- x . . . o
+
+Bricks: x 27, o 22. Empty 12.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x o o x
+2- x x o o o x
+3- . x . o o x x
+4- o o o . . . x x
+5- o o x x x x o x o
+6- x x x x x x o x
+7- x x x x o x o
+8- x x x . . o
+9- x . . . o
+
+Bricks: x 31, o 19. Empty 11.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x o o x
+2- x x o o o x
+3- . x . o o o x
+4- o o o . . o o x
+5- o o x x x o o x o
+6- x x x x x x . x
+7- x x x x o x o
+8- x x x . . o
+9- x . . . o
+
+Bricks: x 28, o 22. Empty 11.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x o o x
+2- x x o o o x
+3- . x . o o o x
+4- o o o . . o o x
+5- o o x x x o x x o
+6- x x x x x x x x
+7- x x x x o x x
+8- x x x . . o
+9- x . . . o
+
+Bricks: x 31, o 20. Empty 10.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x o o x
+2- x x o o o x
+3- . x . o o o x
+4- o o o . . o o x
+5- o o x x x o x x o
+6- x x x x x x x x
+7- x x x x o o x
+8- x x x . o o
+9- x . . . o
+
+Bricks: x 30, o 22. Empty 9.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x o o x
+2- x x o o o x
+3- . x . x x o x
+4- o o o . x x o x
+5- o o x x x x x x o
+6- x x x x x x x x
+7- x x x x o o x
+8- x x x . o o
+9- x . . . o
+
+Bricks: x 35, o 18. Empty 8.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x o o x
+2- x x . o o x
+3- . x . o x o x
+4- o o o o o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x x o o x
+8- x x x . o o
+9- x . . . o
+
+Bricks: x 31, o 22. Empty 8.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . o o x
+2- x x . o o x
+3- . x x x x o x
+4- o o x x o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x x o o x
+8- x x x . o o
+9- x . . . o
+
+Bricks: x 34, o 19. Empty 8.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . . o o x
+2- x o o o o x
+3- . x o o x o x
+4- o o x x o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x x o o x
+8- x x x . o o
+9- x . . . o
+
+Bricks: x 31, o 23. Empty 7.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x x o x
+2- . x x o o x
+3- . x o o x o x
+4- o o x x o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x x o o x
+8- x x x . o o
+9- x . . . o
+
+Bricks: x 34, o 20. Empty 7.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x x o x
+2- . x x o o x
+3- . x o o x o x
+4- o o x x o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x o o o x
+8- x x o o o o
+9- x . . . o
+
+Bricks: x 32, o 23. Empty 6.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x x o x
+2- . x x o o x
+3- . x o o x o x
+4- o o x x o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x o o o x
+8- x x x x o o
+9- . . x . o
+
+Bricks: x 34, o 21. Empty 6.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x x o x
+2- . x x o o x
+3- . x o o x o x
+4- o o x x o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x o o o x
+8- x x x o o o
+9- . . o o o
+
+Bricks: x 32, o 24. Empty 5.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x x o x
+2- . x x o o x
+3- x x o o x o x
+4- x x x x o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x o o o x
+8- x x x o o o
+9- . . o o o
+
+Bricks: x 35, o 22. Empty 4.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x x o x
+2- . x x o o x
+3- x x o o x o x
+4- x x x x o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x o o o x
+8- o o x o o o
+9- o . . o o
+
+Bricks: x 33, o 24. Empty 4.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x x o x
+2- x x x o o x
+3- x x o o x o x
+4- x x x x o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x o o o x
+8- o o x o o o
+9- o . . o o
+
+Bricks: x 34, o 24. Empty 3.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o x o x
+2- o o x o o x
+3- x x . o x o x
+4- x x x x o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x o o o x
+8- o o x o o o
+9- o . . o o
+
+Bricks: x 31, o 27. Empty 3.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . o x
+2- o x x o o x
+3- x x x x x o x
+4- x x x x o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x o o o x
+8- o o x o o o
+9- o . . o o
+
+Bricks: x 33, o 25. Empty 3.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . o o o x
+2- o x o o o x
+3- x x x x x o x
+4- x x x x o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x o o o x
+8- o o x o o o
+9- o . . o o
+
+Bricks: x 32, o 26. Empty 3.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . o o o x
+2- o x o o o x
+3- x x x x x o x
+4- x x x x o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x o o o x
+8- o x x o o o
+9- x x . o o
+
+Bricks: x 35, o 24. Empty 2.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . o o o x
+2- o x o o o x
+3- x x x x x o x
+4- x x x x o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x o o o x
+8- o x o o o o
+9- x o o o .
+
+Bricks: x 33, o 26. Empty 2.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x o o x
+2- x x o o o x
+3- x x x x x o x
+4- x x x x o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x o o o x
+8- o x o o o o
+9- x o o o .
+
+Bricks: x 36, o 24. Empty 1.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x o o x
+2- x x o o o x
+3- x x x x x o x
+4- x x x x o x o x
+5- o o x o o x x x o
+6- x x x x x x x x
+7- x x x o o o x
+8- o x o o o o
+9- x o o o o
+
+Bricks: x 36, o 25. Empty 0.
+Next to move: x, Game over.
+exit 0
Added: test-suite/trunk/MultiSource/Applications/hexxagon/hexxagon.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/hexxagon/hexxagon.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/hexxagon/hexxagon.reference_output.small (added)
+++ test-suite/trunk/MultiSource/Applications/hexxagon/hexxagon.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,1980 @@
+Hexxagon board game.
+Copyright 2001.
+Erik Jonsson.
+Type "copyright" to see the copyright notice.
+
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . . o
+2- . . . . . .
+3- . . . . . . .
+4- . . . . . . . .
+5- o . . . . . . . x
+6- . . . . . . . .
+7- . . . . . . .
+8- . . . . . .
+9- x . . . o
+
+Bricks: x 3, o 3. Empty 55.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . . o
+2- . . . . . .
+3- . . . . . . .
+4- . . . . . . . .
+5- o . . . . . . . x
+6- . . . . . . . .
+7- . . . . . . .
+8- . . . . . .
+9- x . . . o
+
+Bricks: x 3, o 3. Empty 55.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . . o
+2- . . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- . . . . . . . .
+7- . . . . . . .
+8- . . . . . .
+9- x . . . o
+
+Bricks: x 4, o 3. Empty 54.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- . . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- . . . . . . . .
+7- . . . . . . .
+8- . . . . . .
+9- x . . . o
+
+Bricks: x 4, o 4. Empty 53.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- . . . . . . . .
+7- . . . . . . .
+8- . . . . . .
+9- x . . . o
+
+Bricks: x 5, o 4. Empty 52.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- o . . . . . . .
+7- . . . . . . .
+8- . . . . . .
+9- x . . . o
+
+Bricks: x 5, o 5. Empty 51.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- o . . . . . . .
+7- . . . . . . .
+8- x . . . . .
+9- x . . . o
+
+Bricks: x 6, o 5. Empty 50.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- o . . . . . . .
+7- o . . . . . .
+8- o . . . . .
+9- x . . . o
+
+Bricks: x 5, o 7. Empty 49.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- o . . . . . . .
+7- x x . . . . .
+8- x . . . . .
+9- . . . . o
+
+Bricks: x 7, o 5. Empty 49.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- o o . . . . . .
+7- o o . . . . .
+8- x . . . . .
+9- . . . . o
+
+Bricks: x 5, o 8. Empty 48.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- o x x . . . . .
+7- o x . . . . .
+8- . . . . . .
+9- . . . . o
+
+Bricks: x 7, o 6. Empty 48.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- o . . . . . . . x
+6- o x o . . . . .
+7- . o o . . . .
+8- . . . . . .
+9- . . . . o
+
+Bricks: x 5, o 8. Empty 48.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- x x . . . . . . x
+6- x x o . . . . .
+7- . o o . . . .
+8- . . . . . .
+9- . . . . o
+
+Bricks: x 8, o 6. Empty 47.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- x o o . . . . . x
+6- x o o . . . . .
+7- . o o . . . .
+8- . . . . . .
+9- . . . . o
+
+Bricks: x 6, o 9. Empty 46.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- x o o . . . . . x
+6- x x o . . . . .
+7- x x o . . . .
+8- . . . . . .
+9- . . . . o
+
+Bricks: x 9, o 7. Empty 45.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- . . . . . . .
+4- . . . . . . . x
+5- x o o . . . . . x
+6- x x o . . . . .
+7- o o . . . . .
+8- o . . . . .
+9- . . . . o
+
+Bricks: x 7, o 9. Empty 45.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- . . . . . .
+3- . . . . . . .
+4- . x . . . . . x
+5- x x x . . . . . x
+6- x x o . . . . .
+7- o o . . . . .
+8- o . . . . .
+9- . . . . o
+
+Bricks: x 9, o 7. Empty 45.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- . . . . . .
+3- . . . . . . .
+4- . o o . . . . x
+5- x x o . . . . . x
+6- x x . . . . . .
+7- o o . . . . .
+8- o . . . . .
+9- . . . . o
+
+Bricks: x 7, o 9. Empty 45.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- . . . . . .
+3- . . . . . . .
+4- . o o . . . . x
+5- x x x . . . . . x
+6- x x x . . . . .
+7- o x . . . . .
+8- o . . . . .
+9- . . . . o
+
+Bricks: x 10, o 7. Empty 44.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- . . . . . .
+3- . . . . . . .
+4- o o o . . . . x
+5- o o x . . . . . x
+6- x x x . . . . .
+7- o x . . . . .
+8- o . . . . .
+9- . . . . o
+
+Bricks: x 8, o 10. Empty 43.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- . . . . . .
+3- . . . . . . .
+4- o o x . . . . x
+5- o o x x . . . . x
+6- x x x . . . . .
+7- o x . . . . .
+8- o . . . . .
+9- . . . . o
+
+Bricks: x 10, o 9. Empty 42.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- . . . . . .
+3- . . . . . . .
+4- o o x . . . . x
+5- o o x x . . . . x
+6- x x o . . . . .
+7- . o o . . . .
+8- o . . . . .
+9- . . . . o
+
+Bricks: x 8, o 11. Empty 42.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- . . . . . .
+3- . . . . . . .
+4- o o x . . . . x
+5- o o x x . . . . x
+6- x . o . . . . .
+7- . x x . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 11, o 8. Empty 42.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- . . . . . .
+3- . . . . . . .
+4- o o x . . . . x
+5- o o x o . . . . x
+6- x . o o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 9, o 11. Empty 41.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- . . . . . .
+3- x . . . . . .
+4- x x x . . . . x
+5- o o . o . . . . x
+6- x . o o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 11, o 9. Empty 41.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- . . . . . .
+3- o o . . . . .
+4- x o o . . . . x
+5- o o . . . . . . x
+6- x . o o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 8, o 12. Empty 41.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- . . . . . .
+3- o o . . . . .
+4- x x x . . . . x
+5- o x x . . . . . x
+6- . . x o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 12, o 8. Empty 41.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- . . . . . .
+3- o o . . . . .
+4- x x o . . . . x
+5- o x o o . . . . x
+6- . . o o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 9, o 12. Empty 40.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x . . o o
+2- x . . . . .
+3- x x . . . . .
+4- x x o . . . . x
+5- o x o o . . . . x
+6- . . o o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 12, o 10. Empty 39.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o . . o o
+2- o o . . . .
+3- x o . . . . .
+4- x x . . . . . x
+5- o x o o . . . . x
+6- . . o o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 9, o 13. Empty 39.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o . . o o
+2- o o . . . .
+3- x x . . . . .
+4- x x x . . . . x
+5- o x x x . . . . x
+6- . . o o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 13, o 10. Empty 38.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o . . o o
+2- o o . . . .
+3- x o o . . . .
+4- x x o . . . . x
+5- o x x x . . . . x
+6- . . o o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 11, o 13. Empty 37.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o . . o o
+2- o o . . . .
+3- x o x . . . .
+4- x x x x . . . x
+5- o x x x . . . . x
+6- . . o o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 14, o 11. Empty 36.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o . . o o
+2- o o . . . .
+3- x o x . . . .
+4- x x x o . . . x
+5- o x x o o . . . x
+6- . . o o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 12, o 14. Empty 35.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . o o
+2- o x . . . .
+3- x o . . . . .
+4- x x x o . . . x
+5- o x x o o . . . x
+6- . . o o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 14, o 12. Empty 35.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . o o
+2- o o . . . .
+3- x o o . . . .
+4- x x o o . . . x
+5- o x x o o . . . x
+6- . . o o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 12, o 15. Empty 34.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . o o
+2- o x x . . .
+3- x o x . . . .
+4- x x o o . . . x
+5- o x x o o . . . x
+6- . . o o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 15, o 13. Empty 33.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x o . . .
+3- x o o o . . .
+4- x x o o . . . x
+5- o x x o o . . . x
+6- . . o o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 13, o 15. Empty 33.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x o . . .
+3- x o o o . . .
+4- x x o o . . . x
+5- x x . o o . . . x
+6- x . o o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 14, o 14. Empty 33.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x o . . .
+3- x o o o . . .
+4- x o o o . . . x
+5- x o o o o . . . x
+6- x . o o . . . .
+7- . x o . . . .
+8- x x . . . .
+9- . . . . o
+
+Bricks: x 12, o 17. Empty 32.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x o . . .
+3- x o o o . . .
+4- x o o o . . . x
+5- x o o o o . . . x
+6- x . o x . . . .
+7- . x x x . . .
+8- x . . . . .
+9- . . . . o
+
+Bricks: x 14, o 15. Empty 32.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x o . . .
+3- x o o o . . .
+4- x o o o . . . x
+5- x o o o o . . . x
+6- x . . o o . . .
+7- . x x o . . .
+8- x . . . . .
+9- . . . . o
+
+Bricks: x 12, o 17. Empty 32.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x o . . .
+3- x o o o . . .
+4- x o o o . . . x
+5- x o o o o . . . x
+6- x . . o x . . .
+7- . x . x x . .
+8- x . . . . .
+9- . . . . o
+
+Bricks: x 14, o 15. Empty 32.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x o . . .
+3- x o o o . . .
+4- x o o o . . . x
+5- x . o o o . . . x
+6- o . . o x . . .
+7- o o . x x . .
+8- o . . . . .
+9- . . . . o
+
+Bricks: x 11, o 18. Empty 32.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x o . . .
+3- x o o o . . .
+4- x o o o . . . x
+5- x . x x o . . . x
+6- o . x x x . . .
+7- o x . . x . .
+8- o . . . . .
+9- . . . . o
+
+Bricks: x 15, o 14. Empty 32.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x o . . .
+3- x o o o . . .
+4- x o o o . . . x
+5- x . x x o . . . x
+6- o . o o x . . .
+7- . o o . x . .
+8- o . . . . .
+9- . . . . o
+
+Bricks: x 12, o 17. Empty 32.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x o . . .
+3- x o o x . . .
+4- x o o x x . . x
+5- x . x x x . . . x
+6- o . o o . . . .
+7- . o o . x . .
+8- o . . . . .
+9- . . . . o
+
+Bricks: x 15, o 14. Empty 32.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x o . . .
+3- x o o x . . .
+4- o o o x x . . x
+5- o o o x x . . . x
+6- o . o o . . . .
+7- . . o . x . .
+8- o . . . . .
+9- . . . . o
+
+Bricks: x 12, o 17. Empty 32.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x o . . .
+3- x o o x . . .
+4- o o o x x . . x
+5- o o o . x . . . x
+6- o . x o . . . .
+7- . x x . x . .
+8- x . . . . .
+9- . . . . o
+
+Bricks: x 15, o 14. Empty 32.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x o . . .
+3- x o o x . . .
+4- o o o x x . . x
+5- o o o . x . . . x
+6- o . x . . . . .
+7- . o o . x . .
+8- o o . . . .
+9- . . . . o
+
+Bricks: x 12, o 17. Empty 32.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x o . . .
+3- x o o x . . .
+4- o o o x x . . x
+5- o x x . x . . . x
+6- x x x . . . . .
+7- . x o . x . .
+8- o o . . . .
+9- . . . . o
+
+Bricks: x 17, o 13. Empty 31.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x o . . .
+3- x o o x . . .
+4- o o o x x . . x
+5- o x x . x . . . x
+6- o o x . . . . .
+7- o o o . x . .
+8- o o . . . .
+9- . . . . o
+
+Bricks: x 14, o 17. Empty 30.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x o . . .
+3- x o o x . . .
+4- o o o x x . . x
+5- o x x . x . . . x
+6- o o . . . . . .
+7- o o x . x . .
+8- o x x . . .
+9- . . . . o
+
+Bricks: x 16, o 15. Empty 30.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x . . . .
+3- x o o o o . .
+4- o o o x o . . x
+5- o x x . x . . . x
+6- o o . . . . . .
+7- o o x . x . .
+8- o x x . . .
+9- . . . . o
+
+Bricks: x 14, o 17. Empty 30.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x . . . .
+3- x o o o x . .
+4- o o o . x x . x
+5- o x x . x . . . x
+6- o o . . . . . .
+7- o o x . x . .
+8- o x x . . .
+9- . . . . o
+
+Bricks: x 16, o 15. Empty 30.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o x . . . .
+3- x o o . x . .
+4- o o o . o o . x
+5- o x x . o o . . x
+6- o o . . . . . .
+7- o o x . x . .
+8- o x x . . .
+9- . . . . o
+
+Bricks: x 13, o 18. Empty 30.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o . . . . .
+3- x o x . x . .
+4- o o x x x o . x
+5- o x x . x o . . x
+6- o o . . . . . .
+7- o o x . x . .
+8- o x x . . .
+9- . . . . o
+
+Bricks: x 17, o 14. Empty 30.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- o . . . . .
+3- x . o o o . .
+4- o o x o o o . x
+5- o x x . x o . . x
+6- o o . . . . . .
+7- o o x . x . .
+8- o x x . . .
+9- . . . . o
+
+Bricks: x 13, o 18. Empty 30.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x . . o
+2- x . . . . .
+3- x x x o o . .
+4- o x x o o o . x
+5- o x x . x o . . x
+6- o o . . . . . .
+7- o o x . x . .
+8- o x x . . .
+9- . . . . o
+
+Bricks: x 16, o 15. Empty 30.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x . . o
+2- x . . . . .
+3- x x x o o . .
+4- o x x o o o . x
+5- o x x . x . . . x
+6- o o . . . . . .
+7- o o o o o . .
+8- o x o . . .
+9- . . . . o
+
+Bricks: x 13, o 18. Empty 30.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x . . o
+2- x . . . . .
+3- x x x o o . .
+4- o x x o o o . x
+5- o x x . x . . . x
+6- o x x . . . . .
+7- o x x o o . .
+8- o x o . . .
+9- . . . . o
+
+Bricks: x 17, o 15. Empty 29.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x . . o
+2- x . . . . .
+3- x x x o o . .
+4- o x o o o o . x
+5- o x o o o . . . x
+6- o x o . . . . .
+7- o x x . o . .
+8- o x o . . .
+9- . . . . o
+
+Bricks: x 13, o 19. Empty 29.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x . . o
+2- x . . . . .
+3- x x x o o . .
+4- o x o o o o . x
+5- o x o x x . . . x
+6- o x x x . . . .
+7- o x x . o . .
+8- o x o . . .
+9- . . . . o
+
+Bricks: x 17, o 16. Empty 28.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- . o . . o
+2- o o . . . .
+3- x o o . o . .
+4- o x o o o o . x
+5- o x o x x . . . x
+6- o x x x . . . .
+7- o x x . o . .
+8- o x o . . .
+9- . . . . o
+
+Bricks: x 13, o 20. Empty 28.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x x . . o
+2- x x . . . .
+3- . o o . o . .
+4- o x o o o o . x
+5- o x o x x . . . x
+6- o x x x . . . .
+7- o x x . o . .
+8- o x o . . .
+9- . . . . o
+
+Bricks: x 16, o 17. Empty 28.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x o . . o
+2- x o o . . .
+3- . o o . . . .
+4- o x o o o o . x
+5- o x o x x . . . x
+6- o x x x . . . .
+7- o x x . o . .
+8- o x o . . .
+9- . . . . o
+
+Bricks: x 14, o 19. Empty 28.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x o . . o
+2- x o o . . .
+3- x x o . . . .
+4- x x o o o o . x
+5- o x o x x . . . x
+6- o x x x . . . .
+7- o x x . o . .
+8- o x o . . .
+9- . . . . o
+
+Bricks: x 17, o 17. Empty 27.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x o . . o
+2- x o o . . .
+3- x x o . . . .
+4- x x o o o . . o
+5- o x o x x . . o o
+6- o x x x . . . .
+7- o x x . o . .
+8- o x o . . .
+9- . . . . o
+
+Bricks: x 15, o 19. Empty 27.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- x o . . o
+2- x o o . . .
+3- x x o . . . .
+4- x x o o o . . o
+5- o x o x x . . o o
+6- o x x x . . . .
+7- o x x . o . .
+8- x x o . . .
+9- x . . . o
+
+Bricks: x 17, o 18. Empty 26.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- x o . . o
+2- x o o . . .
+3- x x o . . . .
+4- x x o o o . . o
+5- o x o x x . . o o
+6- o x x x . . . .
+7- o x x . o . .
+8- x o o . . .
+9- o o . . o
+
+Bricks: x 15, o 21. Empty 25.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- . x x . o
+2- x o x . . .
+3- x x o . . . .
+4- x x o o o . . o
+5- o x o x x . . o o
+6- o x x x . . . .
+7- o x x . o . .
+8- x o o . . .
+9- o o . . o
+
+Bricks: x 17, o 19. Empty 25.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o x . o
+2- o o x . . .
+3- x x o . . . .
+4- x x o o o . . o
+5- o x o x x . . o o
+6- o x x x . . . .
+7- o x x . o . .
+8- x o o . . .
+9- o o . . o
+
+Bricks: x 15, o 22. Empty 24.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . . o
+2- o o x . . .
+3- x x x x . . .
+4- x x o x x . . o
+5- o x o x x . . o o
+6- o x x x . . . .
+7- o x x . o . .
+8- x o o . . .
+9- o o . . o
+
+Bricks: x 18, o 19. Empty 24.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . . o
+2- o o x . . .
+3- x x x x . . .
+4- x x o x o . . o
+5- o x o x o o . o o
+6- o x x x . . . .
+7- o x x . . . .
+8- x o o . . .
+9- o o . . o
+
+Bricks: x 16, o 21. Empty 24.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . . o
+2- o o x . . .
+3- x x x x . . .
+4- x x o x o . . o
+5- o x o x x x . o o
+6- o x x x x . . .
+7- o x . . . . .
+8- x o o . . .
+9- o o . . o
+
+Bricks: x 18, o 19. Empty 24.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . . o
+2- o o x . . .
+3- x x x x . . .
+4- x x o x o . . o
+5- o x o x x o . . o
+6- o x x x o o . .
+7- o x . . . . .
+8- x o o . . .
+9- o o . . o
+
+Bricks: x 16, o 21. Empty 24.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . . o
+2- o o x . . .
+3- x x x x . . .
+4- x x o x o . . o
+5- o x o x x o . . o
+6- o x x x o o . .
+7- o x x . . . .
+8- x x x . . .
+9- o o . . o
+
+Bricks: x 19, o 19. Empty 23.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . . o
+2- o o x . . .
+3- x x x x . . .
+4- x x o x o . . o
+5- o x o x x o . . o
+6- o x x o o . . .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 16, o 22. Empty 23.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x x . o
+2- o o x . . .
+3- x x x x . . .
+4- x x o x o . . o
+5- o x o x x o . . o
+6- o x x o o . . .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 18, o 21. Empty 22.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o . .
+2- o o o o . .
+3- x x x o . . .
+4- x x o x o . . o
+5- o x o x x o . . o
+6- o x x o o . . .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 15, o 24. Empty 22.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o . x x .
+2- o o o x . .
+3- x x x o . . .
+4- x x o x o . . o
+5- o x o x x o . . o
+6- o x x o o . . .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 17, o 22. Empty 22.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o o x .
+2- o o o x . .
+3- x x x o . . .
+4- x x o x o . . o
+5- o x o x x o . . o
+6- o x x o o . . .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 16, o 24. Empty 21.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o o x .
+2- o o o . . .
+3- x x x o . . .
+4- x x o x x x . o
+5- o x o x x x . . o
+6- o x x o o . . .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 18, o 22. Empty 21.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o o . .
+4- x x o x o o . o
+5- o x o x x x . . o
+6- o x x o o . . .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 16, o 24. Empty 21.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o o . .
+4- x x o x o x x x
+5- o x o x x . . . o
+6- o x x o o . . .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 18, o 22. Empty 21.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o o . .
+4- x x o x o o x x
+5- o x o x o o . . o
+6- o x x o o . . .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 16, o 25. Empty 20.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o o . .
+4- x x o x o x x .
+5- o x o x o x x . o
+6- o x x o o . . .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 18, o 23. Empty 20.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o o o .
+4- x x o x o o o .
+5- o x o x o x x . o
+6- o x x o o . . .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 16, o 26. Empty 19.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o o o .
+4- x x o x o o x .
+5- o x o x o . x x x
+6- o x x o o . . .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 18, o 24. Empty 19.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o o o .
+4- x x o x o . o o
+5- o x o x o . x o o
+6- o x x o o . . .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 15, o 27. Empty 19.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x .
+4- x x o x x x x o
+5- o x o x o . x o o
+6- o x x o o . . .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 20, o 23. Empty 18.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x .
+4- x x o x o o x o
+5- o x o x o o o o o
+6- o x x o o . . .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 17, o 27. Empty 17.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x .
+4- x x o x o o . o
+5- o x o x o x x o o
+6- o x x o x x . .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 20, o 24. Empty 17.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x .
+4- x x o x o . . o
+5- o x o x o x o o o
+6- o x x o x o o .
+7- o x o o . . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 18, o 26. Empty 17.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x .
+4- x x o x o . . o
+5- o x o x o x o o o
+6- o x x o x x o .
+7- o x o x x . .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 21, o 24. Empty 16.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x .
+4- x x o x o . . o
+5- o x o x o x o o o
+6- o x x o x o o .
+7- o x o x o o .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 19, o 27. Empty 15.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x .
+4- x x o x o . x x
+5- o x o x o . x x o
+6- o x x o x o o .
+7- o x o x o o .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 22, o 24. Empty 15.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o o o .
+4- x x o x o o o x
+5- o x o x . . o x o
+6- o x x o x o o .
+7- o x o x o o .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 18, o 28. Empty 15.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o o x x
+4- x x o x o o x x
+5- o x o x . . o x o
+6- o x x o x o o .
+7- o x o x o o .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 21, o 26. Empty 14.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o o x x
+4- x x o o o . x x
+5- o x o o o . o x o
+6- o x x o o o o .
+7- o x o x o o .
+8- x x o . . .
+9- o o . . o
+
+Bricks: x 18, o 29. Empty 14.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o o x x
+4- x x o o o . x x
+5- o x o o o . o x o
+6- o x x o o o o .
+7- o x o x x o .
+8- x x x x . .
+9- o o . . o
+
+Bricks: x 21, o 27. Empty 13.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o o x x
+4- x x o o o . x x
+5- o x o o o . o x o
+6- o x x o o o o .
+7- o x o x o o .
+8- x x x o o .
+9- o o . . o
+
+Bricks: x 19, o 30. Empty 12.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o o x x
+4- x x o o o . x x
+5- o x o o o . o x o
+6- o x x o o o o .
+7- o x o . o o .
+8- x x x x x .
+9- o o . x x
+
+Bricks: x 22, o 27. Empty 12.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o o x x
+4- x x o o o . x x
+5- o x o o o . o x o
+6- o x x o o o o .
+7- o x . . o o .
+8- x x o o x .
+9- o o o o x
+
+Bricks: x 19, o 30. Empty 12.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o o . x
+4- x x o o x . x x
+5- o x o o x x x x o
+6- o x x o x x o .
+7- o x . . o o .
+8- x x o o x .
+9- o o o o x
+
+Bricks: x 24, o 25. Empty 12.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o o . x
+4- x x o o o o o x
+5- o x o o x o o x o
+6- o x x o x x o .
+7- o x . . o o .
+8- x x o o x .
+9- o o o o x
+
+Bricks: x 20, o 30. Empty 11.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x x
+4- x x o o o x x x
+5- o x o o x o o x o
+6- o x x o x x o .
+7- o x . . o o .
+8- x x o o x .
+9- o o o o x
+
+Bricks: x 24, o 27. Empty 10.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x x
+4- x x o o o x x x
+5- o x o o x o o x o
+6- o x o o x x o .
+7- o o o . . o .
+8- x o o o x .
+9- o o o o x
+
+Bricks: x 21, o 30. Empty 10.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x x
+4- x x o o o x x x
+5- o x o o x o o x o
+6- o x o x x . o .
+7- o o x x . o .
+8- x o x x x .
+9- o o o o x
+
+Bricks: x 25, o 26. Empty 10.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x x
+4- x x o o o x x x
+5- o x o o x o . x o
+6- o x o x o . o .
+7- o o x o o o .
+8- x o x o o .
+9- o o o o x
+
+Bricks: x 21, o 30. Empty 10.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x x
+4- x x o o o x x x
+5- o x o o x o . x o
+6- o x o x o . o .
+7- o o x o o x .
+8- x o x o x x
+9- o o o o x
+
+Bricks: x 24, o 28. Empty 9.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x x
+4- x x o o o o o x
+5- o x o o x o o o o
+6- o x o x . . o .
+7- o o x o o x .
+8- x o x o x x
+9- o o o o x
+
+Bricks: x 21, o 31. Empty 9.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x x
+4- x x o o o o o x
+5- o x o o . x x o o
+6- o x o x . x x .
+7- o o x o x x .
+8- x o x o x x
+9- o o o o x
+
+Bricks: x 25, o 27. Empty 9.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x x
+4- x x o o o o o x
+5- o x o o . x x o .
+6- o x o x . x o .
+7- o o x o x o o
+8- x o x o x o
+9- o o o o x
+
+Bricks: x 22, o 30. Empty 9.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x x
+4- x x o o o o o .
+5- o x o o . x x x .
+6- o x o x . x x x
+7- o o x o x o x
+8- x o x o x o
+9- o o o o x
+
+Bricks: x 25, o 27. Empty 9.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x o
+4- x x o o o o o o
+5- o x o o . x x o .
+6- o x o x . x x x
+7- o o x o x o x
+8- x o x o x o
+9- o o o o x
+
+Bricks: x 23, o 30. Empty 8.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x o
+4- x x o x x o o o
+5- o x o x x x x o .
+6- o x o x . x x x
+7- o o x o . o x
+8- x o x o x o
+9- o o o o x
+
+Bricks: x 26, o 27. Empty 8.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x o
+4- x x o x x o o o
+5- o x o x o o x o .
+6- o x o o o o x x
+7- o o x o . . x
+8- x o x o x o
+9- o o o o x
+
+Bricks: x 22, o 31. Empty 8.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . x .
+2- o o o . . .
+3- x x x o x x o
+4- x x o x x o o x
+5- o x o x o o x x x
+6- o x o o o o x x
+7- o o x o . . x
+8- x o x o x o
+9- o o o o x
+
+Bricks: x 25, o 29. Empty 7.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . o .
+2- o o o . o .
+3- x x x . o o o
+4- x x o x x o o x
+5- o x o x o o x x x
+6- o x o o o o x x
+7- o o x o . . x
+8- x o x o x o
+9- o o o o x
+
+Bricks: x 22, o 32. Empty 7.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x x x .
+2- o o x . o .
+3- x x . . o o o
+4- x x o x x o o x
+5- o x o x o o x x x
+6- o x o o o o x x
+7- o o x o . . x
+8- x o x o x o
+9- o o o o x
+
+Bricks: x 25, o 29. Empty 7.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o o .
+2- o o o o o .
+3- x x . . o o o
+4- x x o x x o o x
+5- o x o x o o x x x
+6- o x o o o o x x
+7- o o x o . . x
+8- x o x o x o
+9- o o o o x
+
+Bricks: x 22, o 33. Empty 6.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o o .
+2- o x x o o .
+3- x x x . o o o
+4- x x x x . o o x
+5- o x o x o o x x x
+6- o x o o o o x x
+7- o o x o . . x
+8- x o x o x o
+9- o o o o x
+
+Bricks: x 25, o 30. Empty 6.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o o .
+2- o x x o o .
+3- x x x . o o o
+4- x x x x . o o x
+5- o x o x o o x x x
+6- o x o o o o o x
+7- o o x . . o o
+8- x o x o o o
+9- o o o o x
+
+Bricks: x 22, o 33. Empty 6.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o o .
+2- o x x o o .
+3- x x x . o o o
+4- x x x x . o o x
+5- o x o x o o x x x
+6- o x o o x x o x
+7- o o . . x x o
+8- x o x x x o
+9- o o o o x
+
+Bricks: x 27, o 28. Empty 6.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o o .
+2- o x x o o .
+3- x x x . o o o
+4- x x x x . o o x
+5- o x o x o o x x x
+6- o x . o o x o x
+7- o o . o o x o
+8- x o o o x o
+9- o o o o x
+
+Bricks: x 23, o 32. Empty 6.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o o .
+2- o x x o o .
+3- x x x . o o o
+4- x x x x . o o x
+5- o x o x o o x x x
+6- o . . x o x o x
+7- o x x x o x o
+8- x x x o x o
+9- o o o o x
+
+Bricks: x 28, o 27. Empty 6.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o o .
+2- o x x o o .
+3- x x x . o o o
+4- x x x x . o o x
+5- o x o o o o x x x
+6- o . o o o x o x
+7- . o o x o x o
+8- x x x o x o
+9- o o o o x
+
+Bricks: x 24, o 31. Empty 6.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o o .
+2- o x x o o .
+3- x x x . o o o
+4- x x x x . o o x
+5- o x x o o o x x x
+6- x x x o o x o x
+7- . x o x o x o
+8- . x x o x o
+9- o o o o x
+
+Bricks: x 28, o 27. Empty 6.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o o .
+2- o x x o o .
+3- x x x . o o o
+4- x x x x . o o x
+5- o x x o o o x x x
+6- o o x o o x o x
+7- o o . x o x o
+8- . x x o x o
+9- o o o o x
+
+Bricks: x 25, o 30. Empty 6.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o o .
+2- o x x o o .
+3- x x x . o o o
+4- x x x x . o o x
+5- o x x o o o x x x
+6- o o x x o x o x
+7- o x x x o x o
+8- . x x o x o
+9- o o o o x
+
+Bricks: x 28, o 28. Empty 5.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o o .
+2- o x x o o .
+3- x x x . o o o
+4- x x x x . o o x
+5- o x x o o o x x x
+6- o o x x o x o x
+7- o o x x o x o
+8- o o x o x o
+9- o o o o x
+
+Bricks: x 26, o 31. Empty 4.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o o .
+2- o x x o x x
+3- x x x . o x x
+4- x x x x . o o .
+5- o x x o o o x x x
+6- o o x x o x o x
+7- o o x x o x o
+8- o o x o x o
+9- o o o o x
+
+Bricks: x 29, o 28. Empty 4.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o o .
+2- o x x o x x
+3- x x x . o x o
+4- x x x x . o o o
+5- o x x o o o x o o
+6- o o x x o x o x
+7- o o x x o x o
+8- o o x o x o
+9- o o o o x
+
+Bricks: x 26, o 32. Empty 3.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o o .
+2- o x . o x x
+3- x x x . x x o
+4- x x x x x x o o
+5- o x x o x x x o o
+6- o o x x o x o x
+7- o o x x o x o
+8- o o x o x o
+9- o o o o x
+
+Bricks: x 30, o 28. Empty 3.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o o o
+2- o x . o o o
+3- x x x . x x o
+4- x x x x x x o o
+5- o x x o x x x o o
+6- o o x x o x o x
+7- o o x x o x o
+8- o o x o x o
+9- o o o o x
+
+Bricks: x 28, o 31. Empty 2.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x o o o
+2- o . . x o o
+3- x x x x x x o
+4- x x x x x x o o
+5- o x x o x x x o o
+6- o o x x o x o x
+7- o o x x o x o
+8- o o x o x o
+9- o o o o x
+
+Bricks: x 29, o 30. Empty 2.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o . o o
+2- o o . x o o
+3- x o o x x x o
+4- x x x x x x o o
+5- o x x o x x x o o
+6- o o x x o x o x
+7- o o x x o x o
+8- o o x o x o
+9- o o o o x
+
+Bricks: x 26, o 33. Empty 2.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o x x x o
+2- o o . x o o
+3- x o o . x x o
+4- x x x x x x o o
+5- o x x o x x x o o
+6- o o x x o x o x
+7- o o x x o x o
+8- o o x o x o
+9- o o o o x
+
+Bricks: x 28, o 31. Empty 2.
+Next to move: o
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o o x o
+2- o o o o o o
+3- x o o . x x o
+4- x x x x x x o o
+5- o x x o x x x o o
+6- o o x x o x o x
+7- o o x x o x o
+8- o o x o x o
+9- o o o o x
+
+Bricks: x 25, o 35. Empty 1.
+Next to move: x
+ A B C D E F G H I
+ / / / / / / / / /
+1- o o o x o
+2- o o x x o o
+3- x o x x x x o
+4- x x x x x x o o
+5- o x x o x x x o o
+6- o o x x o x o x
+7- o o x x o x o
+8- o o x o x o
+9- o o o o x
+
+Bricks: x 29, o 32. Empty 0.
+Next to move: o, Game over.
+exit 0
Added: test-suite/trunk/MultiSource/Applications/kimwitu++/kc.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/kimwitu%2B%2B/kc.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/kimwitu++/kc.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/kimwitu++/kc.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1 @@
+ee6a167a184081060436ed54d3c8c597
Added: test-suite/trunk/MultiSource/Applications/lambda-0.1.3/lambda.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/lambda-0.1.3/lambda.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/lambda-0.1.3/lambda.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/lambda-0.1.3/lambda.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,39 @@
+Copyright (c) 2000 John A. Maiorana. All rights reserved.
+lambda-0.1.3
+<< << << << << << << << << << << << << << << ==> iszero 0
+====>iszero 0
+<< ==> iszero 5
+====>iszero(5)
+<< ==> suc 0
+====>^m.^n.m(0 m n)
+<< ==> suc 1
+====>^m.^n.m((1)m n)
+<< ==> suc 2
+====>^m.^n.m((2)m n)
+<< ==> pred 3
+====>false(^m.^n.m((^p.mpair(suc(p true))(p true))((^p.mpair(suc(p true))(p true))(mpair 0 0))true m n))(2)
+<< ==> pred 2
+====>false(^m.^n.m((^p.mpair(suc(p true))(p true))(mpair 0 0)true m n))(I)
+<< ==> pred 1
+====>false(^m.^n.m(mpair 0 0 true m n))0
+<< ==> pred 0
+====>false 0 0
+<< ==> (ADD 1) 2
+====>^x.^y.(1)x((2)x y)
+<< ==> (MUL 2) 3
+====>^f.(2)((3)f)
+<< ==> (EXP 2) 3
+====>^n.(2)((2)((2)n))
+<< ==> (EXP 3) 2
+====>^n.(3)((3)n)
+<< ==> (GT 2) 3
+====>not(iszero(false(^m.^n.m((^p.mpair(suc(p true))(p true))(mpair 0 0)true m n))(I)(^p.mpair(suc(p true))(p true))(^u.u 0 0)false(^p.mpair(suc(p true))(p true))(^u.u 0 0)false))
+<< ==> (GT 3) 2
+====>not(iszero(false(^m.^n.m((^p.mpair(suc(p true))(p true))((^p.mpair(suc(p true))(p true))(mpair 0 0))true m n))(2)(^p.mpair(suc(p true))(p true))(^u.u 0 0)false))
+<< ==> (EQ 4)((ADD 2) 2)
+====>and(iszero(false(^m.^n.m((^p.mpair(suc(p true))(p true))((2)(^p.mpair(suc(p true))(p true))(mpair 0 0))true m n))(3)(^p.mpair(suc(p true))(p true))(^u.u 0 0)false(^p.mpair(suc(p true))(p true))(^u.u 0 0)false(^p.mpair(suc(p true))(p true))(^u.u 0 0)false))(iszero(false(^m.^n.m((^p.mpair(suc(p true))(p true))((2)(^p.mpair(suc(p true))(p true))(mpair 0 0))true m n))(3)(^p.mpair(suc(p true))(p true))(^u.u 0 0)false(^p.mpair(suc(p true))(p true))(^u.u 0 0)false(^p.mpair(suc(p true))(p true))(^u.u 0 0)false))
+<< ==> (EQ 5)((ADD 3) 3)
+====>and(iszero(false(^m.^n.m((^p.mpair(suc(p true))(p true))((^p.mpair(suc(p true))(p true))((3)(^p.mpair(suc(p true))(p true))(mpair 0 0)))true m n))(5)(^p.mpair(suc(p true))(p true))(^u.u 0 0)false(^p.mpair(suc(p true))(p true))(^u.u 0 0)false(^p.mpair(suc(p true))(p true))(^u.u 0 0)false(^p.mpair(suc(p true))(p true))(^u.u 0 0)false))(iszero(false(^m.^n.m((^p.mpair(suc(p true))(p true))((^p.mpair(suc(p true))(p true))((3)(^p.mpair(suc(p true))(p true))(mpair 0 0)))true m n))(5)(^p.mpair(suc(p true))(p true))(^u.u 0 0)false(^p.mpair(suc(p true))(p true))(^u.u 0 0)false(^p.mpair(suc(p true))(p true))(^u.u 0 0)false(^p.mpair(suc(p true))(p true))(^u.u 0 0)false(^p.mpair(suc(p true))(p true))(^u.u 0 0)false))
+<< ==> (EQ(ADD((MUL 2)((DIV 6)((MUL 3)((SUB 8) 2))))))(ADD((MUL 2)((DIV 6)((MUL 3)((SUB 8) 2)))))
+====>and(iszero(^y.MUL(2)(DIV(6)(MUL(3)(SUB(8)(2))))(ADD(MUL(2)(DIV(6)(MUL(3)(SUB(8)(2))))))(pred(ADD(MUL(2)(DIV(6)(MUL(3)(SUB(8)(2))))))y)))(iszero(^y.MUL(2)(DIV(6)(MUL(3)(SUB(8)(2))))(ADD(MUL(2)(DIV(6)(MUL(3)(SUB(8)(2))))))(pred(ADD(MUL(2)(DIV(6)(MUL(3)(SUB(8)(2))))))y)))
+<< exit 0
Added: test-suite/trunk/MultiSource/Applications/lemon/lemon.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/lemon/lemon.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/lemon/lemon.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/lemon/lemon.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1 @@
+1ec0c020ebeb276de5d975275c657078
Added: test-suite/trunk/MultiSource/Applications/lua/lua.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/lua/lua.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/lua/lua.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/lua/lua.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,181 @@
+run script: 'bench/ackermann.lua', with arg='9'
+Ack(3,9): 4093
+bench/ackermann.lua
+results = true
+ackermann:0.00
+run script: 'bench/ary.lua', with arg='7000'
+1000 7000000
+bench/ary.lua
+results = true
+ary:0.00
+run script: 'bench/binarytrees.lua', with arg='12'
+stretch tree of depth 13 check: -1
+8192 trees of depth 4 check: -8192
+2048 trees of depth 6 check: -2048
+512 trees of depth 8 check: -512
+128 trees of depth 10 check: -128
+32 trees of depth 12 check: -32
+long lived tree of depth 12 check: -1
+bench/binarytrees.lua
+results = true
+binarytrees:0.00
+run script: 'bench/chameneos.lua', with arg='350000'
+700000
+bench/chameneos.lua
+results = true
+chameneos:0.00
+run script: 'bench/except.lua', with arg='500000'
+Exceptions: HI=250000 / LO=250000
+bench/except.lua
+results = true
+except:0.00
+run script: 'bench/fannkuch.lua', with arg='9'
+123456789
+213456789
+231456789
+321456789
+312456789
+132456789
+234156789
+324156789
+342156789
+432156789
+423156789
+243156789
+341256789
+431256789
+413256789
+143256789
+134256789
+314256789
+412356789
+142356789
+124356789
+214356789
+241356789
+421356789
+234516789
+324516789
+342516789
+432516789
+423516789
+243516789
+Pfannkuchen(9) = 30
+bench/fannkuch.lua
+results = true
+fannkuch:0.00
+run script: 'bench/fibo.lua', with arg='31'
+2178309
+bench/fibo.lua
+results = true
+fibo:0.00
+run script: 'bench/harmonic.lua', with arg='20000000'
+17.388458521
+bench/harmonic.lua
+results = true
+harmonic:0.00
+run script: 'bench/hash.lua', with arg='200000'
+30999
+bench/hash.lua
+results = true
+hash:0.00
+run script: 'bench/hash2.lua', with arg='250'
+1 9999 250 2499750
+bench/hash2.lua
+results = true
+hash2:0.00
+run script: 'bench/heapsort.lua', with arg='150000'
+0.9999928555
+bench/heapsort.lua
+results = true
+heapsort:0.00
+run script: 'bench/hello.lua', with arg='1'
+hello world
+bench/hello.lua
+results = true
+hello:0.00
+run script: 'bench/knucleotide.lua', with arg='1'
+T 30.408
+A 30.305
+C 19.652
+G 19.635
+
+TT 9.247
+AT 9.244
+TA 9.230
+AA 9.152
+TC 6.013
+GA 5.975
+GT 5.972
+AG 5.963
+CA 5.948
+AC 5.946
+CT 5.945
+TG 5.917
+CG 3.880
+CC 3.879
+GG 3.875
+GC 3.813
+
+1190 GGT
+358 GGTA
+36 GGTATT
+0 GGTATTTTAATT
+0 GGTATTTTAATTTATAGT
+bench/knucleotide.lua
+results = true
+knucleotide:0.00
+run script: 'bench/lists.lua', with arg='35'
+10000
+bench/lists.lua
+results = true
+lists:0.00
+run script: 'bench/matrix.lua', with arg='250'
+270165 1061760 1453695 1856025
+bench/matrix.lua
+results = true
+matrix:0.00
+run script: 'bench/meteor.lua', with arg='0'
+2098 solutions found
+
+0 0 0 0 1
+ 2 2 2 0 1
+2 6 6 1 1
+ 2 6 1 5 5
+8 6 5 5 5
+ 8 6 3 3 3
+4 8 8 9 3
+ 4 4 8 9 3
+4 7 4 7 9
+ 7 7 7 9 9
+
+9 9 9 9 8
+ 9 6 6 8 5
+6 6 8 8 5
+ 6 8 2 5 5
+7 7 7 2 5
+ 7 4 7 2 0
+1 4 2 2 0
+ 1 4 4 0 3
+1 4 0 0 3
+ 1 1 3 3 3
+
+bench/meteor.lua
+results = true
+meteor:0.00
+run script: 'bench/methcall.lua', with arg='1000000'
+true
+false
+bench/methcall.lua
+results = true
+methcall:0.00
+run script: 'bench/moments.lua', with arg='1'
+lua: run_bench_tests.lua:55: bad argument #1 to 'input' (input/moments-input400000.txt: No such file or directory)
+stack traceback:
+ [C]: in function 'input'
+ run_bench_tests.lua:55: in function 'run_bench'
+ run_bench_tests.lua:262: in main chunk
+ [C]: in function 'dofile'
+ alltests.lua:1: in main chunk
+ [C]: ?
+exit 1
Added: test-suite/trunk/MultiSource/Applications/minisat/minisat.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/minisat/minisat.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/minisat/minisat.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/minisat/minisat.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,13 @@
+This is MiniSat 2.0 beta
+============================[ Problem Statistics ]=============================
+| |
+| Number of variables: 65902 |
+| Number of clauses: 218335 |
+restarts : 14
+conflicts : 53073
+decisions : 143203 (1.42 % random)
+propagations : 40392070
+conflict literals : 2133129 (40.99 % deleted)
+
+SATISFIABLE
+exit 10
Added: test-suite/trunk/MultiSource/Applications/minisat/minisat.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/minisat/minisat.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/minisat/minisat.reference_output.small (added)
+++ test-suite/trunk/MultiSource/Applications/minisat/minisat.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,13 @@
+This is MiniSat 2.0 beta
+============================[ Problem Statistics ]=============================
+| |
+| Number of variables: 17630 |
+| Number of clauses: 52081 |
+restarts : 11
+conflicts : 11722
+decisions : 29603 (1.48 % random)
+propagations : 13327606
+conflict literals : 195534 (35.90 % deleted)
+
+UNSATISFIABLE
+exit 20
Added: test-suite/trunk/MultiSource/Applications/oggenc/oggenc.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/oggenc/oggenc.reference_output?rev=105213&view=auto
==============================================================================
Binary files test-suite/trunk/MultiSource/Applications/oggenc/oggenc.reference_output (added) and test-suite/trunk/MultiSource/Applications/oggenc/oggenc.reference_output Mon May 31 03:17:08 2010 differ
Added: test-suite/trunk/MultiSource/Applications/sgefa/sgefa.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/sgefa/sgefa.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/sgefa/sgefa.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/sgefa/sgefa.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,108 @@
+Hilbert Slice. Test case 1 of size 120.
+One-Norm(A) ---------- 1.833333e+00.
+
+
+**********************************************************************
+Hilbert Slice. Test case 2 of size 240.
+One-Norm(A) ---------- 1.833333e+00.
+
+
+**********************************************************************
+Hilbert Slice. Test case 3 of size 360.
+One-Norm(A) ---------- 1.833333e+00.
+
+
+**********************************************************************
+Monoelemental. Test case 4 of size 1.
+MATRIX FOLLOWS
+ 0| 3.0000e+00
+
+SOLUTION
+ 0| 1.0000e+00
+
+RIGHT HAND SIDE
+ 0| 3.0000e+00
+
+TRANSPOSE RIGHT HAND SIDE
+ 0| 3.0000e+00
+
+One-Norm(A) ---------- 3.000000e+00.
+FACTORED MATRIX FOLLOWS
+ 0| 3.0000e+00
+
+True Solution
+ 0| 1.0000e+00
+
+Solution
+ 0| 1.0000e+00
+
+Solution to transposed system
+ 0| 1.0000e+00
+
+
+
+**********************************************************************
+Monoelemental. Test case 5 of size 1.
+MATRIX FOLLOWS
+ 0| 0.0000e+00
+
+SOLUTION
+ 0| 1.0000e+00
+
+RIGHT HAND SIDE
+ 0| 0.0000e+00
+
+TRANSPOSE RIGHT HAND SIDE
+ 0| 0.0000e+00
+
+One-Norm(A) ---------- 0.000000e+00.
+
+
+**********************************************************************
+Tridiagional. Test case 6 of size 600.
+One-Norm(A) ---------- 6.000000e+00.
+
+
+**********************************************************************
+Tridiagional. Test case 7 of size 600.
+One-Norm(A) ---------- 1.050000e+02.
+
+
+**********************************************************************
+Tridiagional. Test case 8 of size 600.
+One-Norm(A) ---------- 1.050000e+02.
+
+
+**********************************************************************
+Rank One. Test case 9 of size 200.
+One-Norm(A) ---------- inf.
+
+
+**********************************************************************
+Zero Column. Test case 10 of size 160.
+One-Norm(A) ---------- 8.879156e+02.
+
+
+**********************************************************************
+Upper Triangular. Test case 11 of size 240.
+One-Norm(A) ---------- 2.844200e+04.
+
+
+**********************************************************************
+Lower Triangular. Test case 12 of size 240.
+One-Norm(A) ---------- 2.892000e+04.
+
+
+**********************************************************************
+Near Overflow. Test case 13 of size 200. BIG = 1.000000e+38
+One-Norm(A) ---------- 5.000005e+35.
+
+
+**********************************************************************
+Near Underflow. Test case 14 of size 200. SMALL = 1.000000e-38
+One-Norm(A) ---------- 8.040000e-30.
+
+
+**********************************************************************
+MATGEN: All tests complete.
+exit 0
Added: test-suite/trunk/MultiSource/Applications/siod/siod.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/siod/siod.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/siod/siod.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/siod/siod.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,19 @@
+Content-type: text/plain
+
+10
+9
+8
+7
+6
+5
+4
+3
+2
+1
+-42 is negative
+0 is zero
+42 is positive
+the value of (get 'answer 'value) is 42
+the value of (get 'answer 'value) is xyzzy
+the 33rd Fibonacci number is 3.52458e+06
+exit 0
Added: test-suite/trunk/MultiSource/Applications/spiff/spiff.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/spiff/spiff.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/spiff/spiff.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/spiff/spiff.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,53 @@
+1c1
+< spiffword rem this file should be named Sample.3
+---
+> spiffword rem this file should be named Sample.4
+3c3
+< spiffword rem it should be compared with a file named Sample.4, to use it
+---
+> spiffword rem it should be compared with a file named Sample.3, to use it
+10c10
+< no difference --> 0.0 different --> 0.0
+---
+> no difference --> 0.0000000001 different --> 0.00000000011
+12c12
+< no difference --> 10. different --> 10.00000
+---
+> no difference --> 10.000000001 different --> 10.0000000011
+13c13
+< spiffword rem Note that spiff said that the differences were on lines 2 and 4
+---
+> spiffword rem Note that spiff said that the differences were on lines 1 and 3
+13c13
+< spiffword rem Note that spiff said that the differences were on lines 2 and 4
+---
+> spiffword rem Note that spiff said that the differences were on lines 1 and 3
+24c24
+< there should be NO differences on this line !!!! # Nah, Nah, can't see me !!
+---
+> there should be NO differences on this line !!!! # No difference here !!
+28c28
+< no difference --> 0.0 NO difference --> 0.0
+---
+> no difference --> 0.0000000001 NO difference --> 0.00000000011
+29c29
+< no difference --> 10. NO difference --> 10.00000
+---
+> no difference --> 10.000000001 NO difference --> 10.0000000011
+34c34
+< not different --> 0.0 different --> 0.0 not different --> 0.0
+---
+> not different --> 0.011 different --> 0.011 not different --> 0.011
+34c34
+< not different --> 0.0 different --> 0.0 not different --> 0.0
+---
+> not different --> 0.011 different --> 0.011 not different --> 0.011
+34c34
+< not different --> 0.0 different --> 0.0 not different --> 0.0
+---
+> not different --> 0.011 different --> 0.011 not different --> 0.011
+36c36
+< Bye, Bye.
+---
+> All done.
+exit 1
Added: test-suite/trunk/MultiSource/Applications/sqlite3/sqlite3.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/sqlite3/sqlite3.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/sqlite3/sqlite3.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/sqlite3/sqlite3.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,5201 @@
+50|446.08
+43|560.0
+40|667.9
+40|767.9
+40|868.5
+38|1018.97368421053
+42|1117.16666666667
+43|1174.72093023256
+38|1308.6052631579
+39|1426.4358974359
+40|1536.85
+43|1621.06976744186
+46|1722.60869565217
+45|1800.93333333333
+48|1920.64583333333
+44|1988.54545454545
+44|2124.25
+45|2203.28888888889
+47|2289.82978723404
+47|2394.53191489362
+47|2502.59574468085
+44|2577.90909090909
+39|2655.8717948718
+42|2771.57142857143
+40|2912.55
+46|3006.04347826087
+45|3126.82222222222
+50|3257.52
+51|3366.96078431373
+50|3458.54
+53|3580.16981132076
+56|3640.48214285714
+60|3692.36666666667
+60|3792.08333333333
+62|3891.8064516129
+60|3987.58333333333
+60|4072.6
+54|4175.96296296296
+55|4294.01818181818
+58|4393.74137931035
+59|4535.32203389831
+57|4605.82456140351
+53|4657.8679245283
+52|4760.80769230769
+48|4857.08333333333
+43|4906.06976744186
+45|5044.15555555556
+47|5133.27659574468
+48|5293.54166666667
+47|5429.68085106383
+44|5601.43181818182
+46|5684.4347826087
+52|5757.67307692308
+56|5880.33928571429
+59|5955.77966101695
+64|5993.328125
+62|6088.74193548387
+61|6160.13114754098
+57|6259.94736842105
+55|6345.89090909091
+54|6448.2962962963
+53|6531.90566037736
+50|6635.3
+48|6796.41666666667
+51|6947.33333333333
+48|7022.8125
+49|7136.26530612245
+50|7227.88
+55|7347.94545454546
+52|7397.46153846154
+51|7481.52941176471
+52|7569.63461538462
+50|7627.14
+46|7726.0
+47|7931.70212765958
+52|8018.38461538462
+48|8098.20833333333
+44|8162.54545454546
+42|8347.09523809524
+45|8403.95555555556
+43|8473.3488372093
+43|8589.86046511628
+47|8676.91489361702
+49|8761.18367346939
+41|8888.09756097561
+42|9071.97619047619
+49|9180.69387755102
+50|9210.88
+45|9306.62222222222
+48|9422.77083333334
+53|9510.30188679245
+51|9586.86274509804
+50|9697.84
+56|9845.91071428572
+56|9881.69642857143
+54|10004.8333333333
+49|10136.5918367347
+48|10167.5416666667
+51|10239.7254901961
+50|10368.2
+10053|213246.658808316
+10149|249581.751305547
+10097|287406.019609785
+10370|320236.324975892
+6377|253422.737650933
+10242|251755.469439563
+10323|253279.617649908
+10145|253206.484475111
+10349|259855.650690888
+506|226899.640316206
+486|237690.938271605
+523|221972.105162524
+509|227925.728880157
+461|232201.219088937
+499|229910.470941884
+483|225043.010351967
+471|228859.203821656
+470|227411.236170213
+459|231136.79956427
+4768|238516.982802013
+488|238653.87295082
+519|229642.034682081
+502|247513.292828685
+473|239961.665961945
+519|239681.786127168
+505|241436.859405941
+508|235081.535433071
+471|229759.87685775
+546|239603.39010989
+4737|244145.238758708
+489|231426.773006135
+511|248488.43444227
+488|252462.838114754
+496|236085.635080645
+485|251291.878350516
+505|241270.833663366
+506|245197.998023715
+488|237874.411885246
+501|246512.48502994
+4747|247933.340214873
+504|248844.968253968
+478|241370.577405858
+486|243923.495884774
+499|248979.577154309
+521|250554.809980806
+480|249225.195833333
+521|245723.687140115
+484|249815.103305785
+502|250056.209163347
+4817|254228.171891219
+524|253334.669847328
+488|258571.338114754
+480|250524.514583333
+465|255651.348387097
+511|241659.878669276
+522|244834.9348659
+534|259977.471910112
+487|258311.915811088
+517|265402.849129594
+4747|256875.049926269
+480|255735.639583333
+491|246248.928716904
+503|255981.296222664
+491|267528.541751528
+536|269208.436567164
+498|255347.020080321
+521|257790.143953935
+487|252547.301848049
+493|268549.399594321
+4690|260213.393816631
+465|257359.32688172
+491|261670.101832994
+501|264336.844311377
+507|259710.800788955
+491|259766.364562118
+497|255244.287726358
+463|270527.157667387
+502|264419.976095618
+488|265976.272540984
+4818|264127.482772935
+504|262764.107142857
+490|259590.953061225
+518|257607.652509653
+547|268148.908592322
+495|266993.854545455
+479|266442.584551148
+521|270196.800383877
+490|272618.040816327
+525|261658.278095238
+4793|274632.720216983
+560|264718.278571429
+521|275913.429942418
+503|270713.067594433
+498|291520.951807229
+489|283840.654396728
+510|271761.707843137
+505|272661.368316832
+484|265910.35123967
+505|277817.388118812
+6988|186437.340726961
+9|35.5555555555556
+6|133.666666666667
+4|243.5
+4|355.75
+7|450.571428571429
+2|532.0
+2|663.5
+8|752.875
+4|834.0
+4|970.25
+2|1048.0
+3|1146.0
+4|1243.5
+4|1361.75
+5|1427.0
+6|1544.0
+3|1639.66666666667
+3|1745.66666666667
+5|1848.0
+5|1944.8
+5|2065.6
+6|2162.0
+3|2258.66666666667
+7|2370.85714285714
+1|2440.0
+6|2539.16666666667
+4|2650.0
+5|2742.2
+5|2832.2
+5|2960.6
+2|3067.0
+1|3123.0
+6|3267.16666666667
+5|3338.4
+7|3459.42857142857
+5|3532.8
+9|3641.0
+6|3758.33333333333
+4|3843.25
+8|3953.125
+5|4050.4
+5|4159.6
+6|4264.33333333333
+7|4351.28571428572
+5|4435.8
+5|4553.0
+3|4638.33333333333
+7|4745.57142857143
+7|4862.71428571429
+9|4930.22222222222
+3|5066.66666666667
+1|5133.0
+5|5256.2
+3|5345.66666666667
+0|
+7|5541.57142857143
+5|5638.4
+8|5755.625
+6|5857.33333333333
+6|5940.0
+5|6044.2
+7|6149.71428571429
+9|6242.33333333333
+6|6354.83333333333
+5|6436.4
+5|6544.0
+4|6614.5
+4|6773.5
+4|6837.75
+5|6964.8
+4|7051.0
+4|7155.5
+7|7234.85714285714
+9|7357.22222222222
+2|7481.5
+6|7550.33333333333
+5|7635.0
+9|7759.66666666667
+1|7882.0
+4|7928.5
+5|8053.4
+2|8179.0
+3|8227.66666666667
+10|8360.9
+7|8447.0
+2|8530.0
+1|8613.0
+7|8751.85714285714
+4|8870.5
+2|8945.0
+5|9055.4
+6|9134.83333333334
+5|9233.2
+2|9361.5
+8|9467.5
+9|9543.44444444445
+2|9651.5
+2|9758.5
+7|9853.85714285714
+7|9949.0
+3|10053.6666666667
+5|10154.2
+11|10240.4545454545
+2|10363.5
+6|10437.6666666667
+4|10580.75
+1|10652.0
+5|10740.2
+6|10860.1666666667
+3|10945.6666666667
+8|11074.625
+5|11135.8
+6|11252.8333333333
+7|11347.5714285714
+4|11439.25
+6|11537.6666666667
+2|11677.5
+4|11749.5
+4|11850.0
+6|11947.1666666667
+6|12041.0
+12|12152.0833333333
+4|12251.0
+4|12368.25
+8|12459.125
+2|12552.0
+6|12636.0
+4|12758.5
+5|12866.0
+11|12960.5454545455
+4|13060.25
+7|13175.8571428571
+6|13270.6666666667
+5|13357.8
+5|13447.4
+7|13551.8571428571
+3|13684.6666666667
+7|13760.5714285714
+11|13837.6363636364
+5|13916.2
+7|14051.7142857143
+5|14162.4
+3|14225.0
+6|14347.8333333333
+3|14454.6666666667
+7|14559.4285714286
+4|14636.75
+4|14739.75
+3|14872.0
+4|14931.0
+3|15041.3333333333
+5|15149.2
+3|15229.0
+3|15369.0
+5|15439.0
+7|15533.1428571429
+5|15642.2
+3|15766.3333333333
+5|15857.4
+5|15936.6
+4|16052.25
+11|16154.5454545455
+4|16262.25
+4|16342.75
+6|16453.8333333333
+7|16522.7142857143
+3|16632.0
+7|16746.5714285714
+2|16875.0
+1|16971.0
+4|17059.25
+5|17162.6
+6|17240.5
+2|17357.5
+5|17470.6
+7|17540.2857142857
+3|17644.0
+2|17723.5
+6|17865.5
+5|17951.4
+5|18049.0
+5|18148.8
+4|18251.75
+5|18323.6
+6|18461.3333333333
+2|18551.5
+5|18676.2
+5|18770.8
+5|18848.6
+4|18963.25
+6|19052.8333333333
+2|19167.5
+6|19253.1666666667
+7|19341.0
+6|19444.8333333333
+1|19570.0
+8|19648.125
+5|19745.2
+7|19854.2857142857
+4|19947.75
+4|20054.75
+1|20186.0
+6|20241.5
+2|20347.0
+1|20479.0
+5|20550.4
+8|20642.375
+4|20727.25
+7|20830.5714285714
+8|20952.625
+4|21032.75
+5|21164.0
+8|21259.0
+3|21348.6666666667
+4|21462.25
+4|21550.75
+7|21652.8571428571
+11|21746.4545454545
+4|21848.0
+5|21945.4
+5|22047.4
+5|22159.0
+6|22243.0
+3|22354.6666666667
+5|22462.6
+6|22564.3333333333
+8|22642.125
+9|22741.3333333333
+5|22838.4
+2|22925.5
+3|23046.0
+5|23138.8
+4|23240.5
+8|23345.5
+6|23457.5
+3|23546.3333333333
+6|23632.5
+5|23741.4
+2|23805.5
+4|23972.25
+3|24059.0
+6|24144.5
+3|24261.3333333333
+6|24342.6666666667
+3|24420.0
+6|24565.6666666667
+3|24638.3333333333
+4|24740.25
+3|24828.3333333333
+3|24961.0
+4|25041.0
+7|25161.1428571429
+2|25248.0
+2|25358.5
+1|25423.0
+5|25546.2
+4|25654.5
+2|25770.5
+7|25822.1428571429
+6|25925.0
+6|26055.6666666667
+6|26136.6666666667
+4|26231.0
+4|26345.0
+5|26448.4
+5|26549.8
+6|26646.1666666667
+4|26754.0
+6|26852.1666666667
+5|26958.2
+4|27067.5
+4|27148.0
+4|27242.75
+9|27344.7777777778
+7|27445.7142857143
+4|27532.25
+3|27635.3333333333
+5|27758.4
+7|27865.2857142857
+2|27930.5
+3|28038.6666666667
+7|28153.1428571429
+5|28275.0
+1|28307.0
+1|28478.0
+8|28524.375
+3|28638.6666666667
+7|28739.2857142857
+9|28848.1111111111
+4|28965.0
+3|29060.0
+4|29153.0
+4|29258.25
+8|29341.0
+5|29442.4
+6|29559.1666666667
+5|29656.0
+5|29749.0
+7|29840.0
+3|29973.6666666667
+5|30026.2
+4|30149.5
+4|30238.75
+2|30329.5
+4|30468.5
+4|30552.5
+8|30646.125
+3|30748.6666666667
+6|30848.1666666667
+4|30969.0
+10|31044.6
+5|31145.2
+4|31257.75
+7|31335.7142857143
+5|31443.2
+8|31539.5
+4|31635.5
+7|31763.4285714286
+6|31823.3333333333
+6|31933.0
+4|32061.0
+2|32114.5
+5|32245.8
+5|32333.0
+7|32432.8571428571
+3|32543.6666666667
+6|32644.5
+4|32758.25
+5|32844.8
+1|32918.0
+9|33035.4444444445
+7|33141.7142857143
+3|33237.3333333333
+5|33354.4
+3|33467.6666666667
+6|33559.3333333333
+6|33649.1666666667
+3|33746.0
+4|33842.0
+7|33951.0
+5|34039.2
+5|34143.6
+4|34252.25
+3|34338.0
+4|34454.5
+7|34541.5714285714
+5|34646.4
+3|34739.0
+12|34850.8333333333
+4|34954.25
+7|35057.0
+5|35150.8
+5|35260.8
+6|35344.5
+4|35455.25
+9|35547.0
+3|35629.3333333333
+7|35749.4285714286
+12|35854.5833333333
+2|35980.0
+5|36061.8
+5|36175.8
+5|36279.6
+9|36341.5555555556
+6|36441.1666666667
+8|36547.875
+4|36653.75
+7|36746.1428571429
+5|36859.8
+5|36923.0
+6|37073.5
+6|37157.0
+8|37232.5
+2|37346.0
+3|37481.6666666667
+6|37578.6666666667
+3|37659.0
+7|37744.5714285714
+7|37838.1428571429
+7|37944.4285714286
+4|38047.25
+5|38145.8
+6|38246.5
+2|38317.0
+2|38467.0
+4|38554.5
+6|38655.8333333333
+8|38767.875
+8|38839.5
+3|38974.6666666667
+6|39058.5
+4|39150.0
+6|39259.0
+3|39356.0
+5|39452.4
+6|39544.8333333333
+1|39686.0
+6|39750.8333333333
+6|39836.6666666667
+3|39980.3333333333
+7|40068.7142857143
+6|40158.8333333333
+5|40273.6
+4|40345.75
+4|40461.5
+3|40560.0
+2|40634.5
+5|40756.0
+3|40873.3333333333
+0|
+4|41058.75
+7|41149.5714285714
+5|41257.2
+4|41332.5
+8|41463.0
+5|41533.6
+4|41653.25
+3|41748.0
+2|41840.0
+4|41940.5
+7|42047.5714285714
+6|42143.8333333333
+8|42247.75
+5|42351.2
+4|42467.25
+5|42534.2
+4|42664.25
+6|42748.3333333333
+5|42847.8
+7|42955.2857142857
+6|43059.0
+4|43173.5
+4|43236.0
+7|43344.7142857143
+4|43438.5
+8|43543.25
+6|43665.8333333333
+4|43727.5
+5|43855.0
+4|43954.5
+6|44036.5
+4|44142.25
+7|44245.5714285714
+9|44344.5555555556
+5|44431.8
+4|44528.0
+7|44658.1428571429
+5|44743.2
+3|44830.3333333333
+0|
+5|45064.0
+6|45145.1666666667
+6|45255.6666666667
+6|45344.5
+3|45438.0
+2|45591.0
+6|45632.6666666667
+6|45742.6666666667
+5|45853.4
+9|45921.8888888889
+4|46047.0
+6|46156.6666666667
+5|46263.6
+3|46352.6666666667
+6|46457.0
+1|46580.0
+3|46653.0
+8|46750.25
+4|46826.75
+5|46939.6
+7|47043.0
+8|47154.5
+6|47242.6666666667
+4|47334.75
+4|47426.5
+3|47567.0
+9|47645.3333333333
+8|47760.5
+4|47852.5
+4|47957.5
+4|48025.0
+5|48176.4
+4|48252.0
+3|48337.0
+11|48437.7272727273
+7|48563.5714285714
+2|48652.5
+9|48754.6666666667
+4|48831.5
+2|48910.5
+3|49082.3333333333
+5|49144.2
+1|49270.0
+7|49353.2857142857
+5|49440.8
+3|49553.3333333333
+5|49664.6
+7|49745.7142857143
+4|49845.75
+4|49930.0
+6|50058.6666666667
+1|50114.0
+6|50237.6666666667
+4|50341.25
+9|50451.8888888889
+6|50538.8333333333
+2|50678.0
+4|50750.25
+5|50863.8
+4|50958.5
+5|51042.2
+5|51122.4
+8|51228.625
+4|51368.5
+2|51401.5
+2|51563.5
+8|51654.625
+5|51740.8
+6|51841.1666666667
+2|51991.0
+4|52049.5
+7|52135.8571428572
+4|52248.75
+6|52362.5
+0|
+4|52531.25
+3|52639.3333333333
+3|52752.3333333333
+5|52858.6
+1|52959.0
+7|53055.8571428572
+4|53170.5
+9|53249.8888888889
+3|53358.3333333333
+4|53477.0
+2|53521.5
+4|53631.5
+3|53777.0
+5|53858.6
+4|53973.0
+5|54046.2
+2|54129.0
+6|54256.3333333333
+8|54361.0
+5|54465.8
+8|54552.625
+4|54636.75
+11|54758.6363636364
+7|54843.1428571429
+6|54949.0
+10|55062.0
+5|55154.0
+5|55261.6
+6|55351.3333333333
+7|55456.5714285714
+11|55565.8181818182
+3|55631.0
+7|55744.1428571429
+4|55851.5
+6|55966.5
+3|56059.0
+7|56148.5714285714
+5|56256.4
+7|56343.2857142857
+3|56462.6666666667
+6|56550.0
+3|56665.6666666667
+5|56766.4
+6|56848.6666666667
+6|56943.6666666667
+3|57043.3333333333
+5|57149.8
+3|57247.0
+3|57365.0
+4|57457.25
+2|57523.5
+4|57626.25
+4|57751.75
+10|57831.4
+2|57985.0
+1|58040.0
+6|58130.0
+4|58247.75
+7|58367.4285714286
+6|58469.0
+4|58578.25
+2|58612.5
+6|58748.3333333333
+2|58863.5
+6|58971.8333333333
+8|59058.125
+8|59167.75
+2|59240.5
+5|59350.2
+6|59456.5
+4|59557.25
+6|59649.5
+3|59772.6666666667
+5|59837.2
+5|59959.6
+8|60037.125
+4|60147.5
+7|60260.0
+3|60357.6666666667
+4|60441.25
+5|60536.4
+4|60660.5
+1|60761.0
+3|60843.0
+4|60971.75
+5|61043.2
+4|61129.0
+7|61263.8571428572
+6|61352.3333333333
+5|61441.4
+6|61545.3333333333
+1|61612.0
+8|61760.0
+2|61869.0
+7|61936.2857142857
+4|62054.5
+7|62142.1428571429
+8|62240.875
+8|62357.875
+7|62442.5714285714
+5|62549.0
+6|62643.3333333333
+8|62753.375
+3|62882.0
+3|62972.3333333333
+10|63030.8
+5|63132.8
+4|63232.25
+2|63370.5
+3|63442.0
+9|63555.7777777778
+4|63668.0
+1|63774.0
+8|63839.0
+7|63948.5714285714
+7|64047.4285714286
+3|64178.6666666667
+3|64232.6666666667
+9|64341.5555555556
+3|64456.6666666667
+8|64557.75
+2|64624.5
+5|64741.6
+5|64843.6
+4|64937.0
+11|65051.1818181818
+7|65152.1428571429
+5|65246.4
+5|65341.2
+4|65445.0
+1|65557.0
+1|65632.0
+5|65749.6
+2|65814.5
+5|65936.6
+5|66062.4
+5|66163.4
+2|66263.5
+4|66340.75
+9|66440.3333333333
+5|66547.0
+3|66666.6666666667
+6|66737.8333333333
+2|66874.0
+7|66939.0
+5|67053.0
+4|67140.0
+5|67250.6
+7|67359.5714285714
+3|67475.0
+6|67566.3333333333
+10|67652.1
+6|67745.3333333333
+5|67839.4
+5|67960.6
+7|68041.2857142857
+7|68162.2857142857
+11|68245.3636363636
+4|68356.25
+8|68456.25
+3|68572.6666666667
+6|68655.0
+4|68754.5
+6|68847.8333333333
+2|68948.0
+4|69020.0
+0|
+0|
+4|69346.0
+2|69425.5
+6|69570.6666666667
+1|69614.0
+7|69752.1428571429
+3|69845.3333333333
+6|69949.3333333333
+1|70092.0
+6|70154.6666666667
+6|70264.5
+8|70346.0
+10|70450.5
+4|70565.25
+7|70646.7142857143
+4|70762.75
+4|70822.5
+7|70957.7142857143
+7|71043.7142857143
+6|71154.1666666667
+3|71253.6666666667
+6|71325.0
+6|71459.5
+5|71558.4
+5|71664.0
+5|71742.4
+4|71850.25
+6|71932.5
+5|72043.4
+4|72128.25
+4|72262.75
+2|72350.5
+8|72455.5
+1|72515.0
+5|72650.6
+8|72757.75
+4|72823.5
+11|72940.8181818182
+9|73054.4444444445
+3|73112.3333333333
+7|73222.1428571429
+11|73344.8181818182
+4|73455.0
+3|73535.6666666667
+2|73658.0
+4|73744.5
+6|73864.1666666667
+5|73963.4
+7|74053.7142857143
+1|74180.0
+7|74264.7142857143
+6|74344.6666666667
+5|74437.8
+8|74539.125
+2|74653.5
+1|74737.0
+2|74809.0
+8|74942.75
+5|75042.4
+6|75126.1666666667
+5|75260.0
+6|75350.6666666667
+1|75408.0
+5|75531.8
+3|75623.6666666667
+4|75769.5
+3|75847.6666666667
+6|75949.0
+6|76053.6666666667
+3|76166.0
+6|76260.1666666667
+4|76341.0
+9|76429.3333333333
+3|76522.3333333333
+3|76618.3333333333
+5|76775.4
+5|76860.0
+8|76947.875
+6|77056.1666666667
+5|77147.4
+2|77215.0
+7|77370.5714285715
+3|77435.3333333333
+5|77516.6
+6|77629.0
+3|77758.6666666667
+3|77838.6666666667
+7|77953.7142857143
+7|78044.1428571429
+4|78164.25
+6|78253.8333333333
+2|78339.0
+5|78428.0
+5|78527.0
+10|78656.5
+7|78741.4285714286
+6|78847.1666666667
+1|78939.0
+10|79035.2
+2|79157.5
+7|79235.4285714286
+1|79343.0
+9|79442.2222222222
+4|79562.75
+4|79644.25
+2|79767.5
+4|79865.25
+5|79961.8
+6|80042.3333333333
+10|80145.0
+5|80229.8
+4|80342.5
+7|80451.0
+7|80541.2857142857
+6|80642.8333333333
+3|80777.6666666667
+5|80858.4
+9|80967.7777777778
+5|81063.4
+3|81154.3333333333
+4|81255.0
+6|81341.6666666667
+7|81434.5714285715
+4|81525.0
+7|81642.8571428572
+5|81739.6
+5|81847.2
+2|81943.0
+2|82010.0
+3|82139.6666666667
+4|82234.25
+7|82361.0
+6|82458.5
+7|82548.0
+5|82674.2
+6|82717.6666666667
+7|82844.5714285715
+9|82952.2222222222
+9|83051.6666666667
+4|83164.25
+4|83216.75
+3|83372.3333333333
+6|83432.1666666667
+4|83562.0
+9|83641.0
+7|83730.4285714286
+4|83855.75
+5|83944.0
+9|84050.0
+6|84137.0
+9|84235.2222222222
+7|84364.7142857143
+6|84428.3333333333
+3|84535.0
+4|84643.5
+7|84746.4285714286
+6|84849.5
+7|84953.4285714286
+4|85071.25
+6|85153.1666666667
+4|85242.5
+6|85355.3333333333
+8|85448.75
+3|85569.6666666667
+6|85633.3333333333
+10|85738.7
+5|85854.2
+6|85958.3333333333
+4|86028.0
+8|86146.75
+5|86247.8
+2|86344.5
+2|86477.0
+5|86547.0
+9|86655.4444444445
+6|86734.0
+6|86855.3333333333
+1|86970.0
+5|87041.0
+7|87146.5714285715
+4|87244.5
+6|87348.5
+7|87464.1428571429
+7|87564.0
+6|87649.0
+7|87744.5714285715
+6|87849.3333333333
+5|87953.6
+9|88050.2222222222
+5|88151.8
+4|88236.5
+6|88352.6666666667
+3|88467.0
+5|88542.2
+2|88631.0
+3|88738.6666666667
+4|88841.25
+3|88921.3333333333
+8|89056.625
+6|89147.6666666667
+5|89236.4
+4|89331.0
+3|89465.0
+6|89552.1666666667
+6|89644.8333333333
+5|89752.6
+2|89871.0
+6|89947.5
+5|90042.2
+2|90120.5
+3|90222.6666666667
+5|90353.4
+5|90447.4
+3|90562.6666666667
+2|90647.0
+3|90760.3333333333
+4|90822.75
+8|90950.75
+5|91074.4
+10|91155.6
+6|91243.1666666667
+6|91330.3333333333
+6|91427.6666666667
+4|91540.5
+7|91623.1428571429
+5|91745.2
+6|91847.3333333333
+5|91949.6
+5|92043.8
+7|92156.1428571429
+5|92257.2
+4|92345.0
+10|92470.6
+5|92541.8
+6|92634.6666666667
+7|92737.0
+7|92878.8571428572
+6|92968.0
+4|93040.5
+2|93158.0
+3|93230.3333333333
+15|93353.0
+5|93485.0
+6|93538.8333333333
+6|93655.0
+5|93765.8
+7|93847.2857142857
+2|93968.5
+3|94040.0
+5|94165.0
+5|94244.4
+3|94348.3333333333
+5|94448.4
+4|94564.0
+3|94651.6666666667
+6|94734.3333333333
+3|94857.0
+4|94938.5
+7|95060.2857142857
+4|95142.75
+4|95255.75
+1|95387.0
+6|95446.6666666667
+4|95554.5
+6|95649.6666666667
+3|95749.3333333333
+5|95817.2
+4|95945.5
+7|96059.5714285715
+3|96146.0
+4|96236.25
+9|96336.3333333333
+6|96457.1666666667
+4|96552.25
+6|96655.0
+3|96748.0
+7|96843.4285714286
+5|96971.4
+3|97070.3333333334
+5|97162.0
+5|97232.8
+9|97362.7777777778
+7|97457.7142857143
+6|97548.0
+8|97643.875
+5|97745.2
+6|97869.0
+8|97971.5
+9|98064.0
+4|98127.5
+5|98276.4
+7|98323.5714285715
+7|98450.7142857143
+3|98551.3333333334
+6|98634.0
+3|98761.6666666667
+7|98845.4285714286
+7|98947.0
+4|99039.25
+8|99171.5
+1|99268.0
+6|99333.3333333334
+3|99459.0
+6|99530.0
+7|99635.4285714286
+3|99743.0
+4|99845.5
+0|
+2|100044.5
+8|100159.375
+8|100238.75
+2|100344.0
+7|100457.571428571
+5|100543.2
+2|100611.0
+5|100756.8
+7|100848.714285714
+4|100951.25
+4|101052.5
+4|101158.75
+8|101232.25
+1|101312.0
+6|101454.333333333
+2|101581.5
+9|101642.666666667
+3|101769.0
+6|101831.5
+7|101959.857142857
+10|102051.5
+11|102150.636363636
+2|102245.0
+7|102366.142857143
+7|102456.142857143
+2|102560.5
+14|102649.714285714
+2|102753.0
+4|102869.5
+4|102952.75
+5|103049.8
+8|103158.75
+4|103261.75
+3|103348.333333333
+3|103446.666666667
+2|103521.5
+5|103637.0
+1|103747.0
+9|103846.444444444
+9|103947.555555556
+7|104059.428571429
+4|104112.25
+6|104236.666666667
+7|104346.142857143
+5|104458.0
+8|104552.75
+5|104653.4
+6|104750.5
+3|104847.666666667
+4|104950.25
+8|105062.75
+2|105152.0
+7|105259.285714286
+1|105354.0
+4|105417.75
+3|105550.333333333
+5|105651.4
+2|105723.5
+3|105848.666666667
+3|105914.666666667
+3|106055.333333333
+8|106143.125
+3|106246.333333333
+7|106339.142857143
+7|106457.857142857
+4|106565.0
+9|106642.555555556
+4|106770.25
+5|106846.4
+6|106949.0
+6|107024.166666667
+2|107132.0
+6|107257.333333333
+6|107346.0
+6|107462.333333333
+6|107556.666666667
+4|107615.25
+4|107759.75
+5|107832.4
+5|107953.0
+5|108041.0
+9|108155.444444444
+4|108250.0
+8|108348.375
+4|108455.0
+5|108539.0
+3|108628.333333333
+10|108748.0
+5|108843.2
+1|108957.0
+5|109038.0
+4|109153.0
+6|109251.0
+3|109364.666666667
+6|109459.666666667
+4|109566.75
+6|109650.166666667
+6|109750.833333333
+6|109862.166666667
+6|109941.0
+7|110053.285714286
+7|110145.857142857
+9|110244.444444444
+6|110340.0
+8|110442.5
+6|110540.5
+3|110633.666666667
+6|110758.666666667
+3|110813.333333333
+3|110948.0
+3|111049.333333333
+4|111144.0
+8|111264.625
+6|111364.5
+7|111439.285714286
+2|111595.0
+5|111662.4
+4|111744.25
+6|111865.333333333
+6|111935.5
+6|112039.833333333
+10|112145.6
+9|112241.111111111
+6|112352.666666667
+6|112462.333333333
+5|112581.0
+5|112671.2
+6|112770.666666667
+5|112869.0
+4|112952.75
+9|113041.333333333
+4|113165.0
+7|113264.857142857
+4|113371.25
+4|113430.5
+6|113533.5
+9|113652.888888889
+7|113746.285714286
+7|113859.285714286
+7|113974.142857143
+6|114055.666666667
+7|114134.428571429
+7|114268.571428571
+4|114323.25
+3|114465.333333333
+5|114560.0
+3|114649.333333333
+1|114788.0
+3|114815.666666667
+3|114960.666666667
+5|115059.6
+3|115187.333333333
+3|115247.666666667
+8|115357.5
+5|115437.0
+8|115557.375
+7|115654.0
+6|115745.333333333
+3|115835.0
+2|115928.0
+6|116078.333333333
+2|116160.0
+5|116245.4
+4|116357.5
+5|116445.8
+3|116554.666666667
+6|116640.166666667
+3|116737.666666667
+4|116853.25
+9|116944.0
+5|117037.6
+3|117143.666666667
+5|117259.2
+9|117367.777777778
+8|117436.625
+2|117575.5
+3|117648.333333333
+7|117768.285714286
+5|117838.6
+6|117938.333333333
+4|118048.25
+8|118147.875
+5|118267.0
+1|118371.0
+6|118446.333333333
+5|118557.4
+6|118654.5
+2|118780.5
+4|118856.0
+3|118940.666666667
+3|119039.0
+3|119136.333333333
+8|119264.875
+2|119346.0
+4|119446.0
+2|119554.0
+2|119638.0
+6|119750.0
+4|119852.75
+3|119980.0
+3|120049.666666667
+3|120160.333333333
+4|120261.5
+6|120359.833333333
+7|120453.428571429
+6|120565.833333333
+7|120652.0
+6|120729.166666667
+2|120877.0
+5|120969.6
+3|121036.333333333
+7|121151.857142857
+8|121254.125
+2|121367.0
+7|121447.142857143
+7|121534.571428571
+3|121664.666666667
+1|121710.0
+4|121872.25
+5|121940.0
+5|122049.6
+3|122146.666666667
+5|122227.6
+3|122368.666666667
+3|122417.0
+9|122572.444444444
+6|122645.333333333
+6|122746.833333333
+6|122845.833333333
+6|122951.5
+4|123060.25
+7|123162.714285714
+5|123233.8
+5|123351.6
+3|123449.0
+4|123545.0
+8|123646.5
+3|123751.666666667
+6|123876.333333333
+2|123917.5
+6|124050.333333333
+3|124137.333333333
+6|124226.666666667
+5|124380.4
+3|124415.666666667
+3|124562.0
+9|124633.111111111
+3|124714.0
+6|124843.0
+7|124929.857142857
+4|125020.5
+3|125151.333333333
+6|125247.333333333
+7|125361.428571429
+1|125431.0
+2|125555.0
+4|125661.25
+5|125749.0
+4|125859.25
+2|125950.0
+4|126041.25
+5|126163.2
+2|126210.0
+6|126346.5
+8|126445.375
+4|126542.5
+2|126643.0
+3|126766.0
+4|126852.75
+4|126944.5
+8|127048.125
+4|127158.25
+5|127267.4
+6|127353.0
+5|127446.6
+8|127536.75
+6|127640.5
+6|127729.5
+1|127870.0
+4|127962.75
+5|128033.6
+9|128142.444444444
+3|128265.333333333
+12|128342.916666667
+4|128457.0
+5|128551.4
+6|128642.333333333
+7|128737.714285714
+1|128830.0
+5|128921.6
+3|129060.0
+2|129153.0
+5|129250.4
+5|129346.0
+8|129445.0
+5|129547.6
+7|129642.571428571
+8|129742.875
+2|129857.5
+7|129962.142857143
+5|130044.2
+0|
+9|130261.444444444
+1|130337.0
+5|130476.8
+6|130551.333333333
+3|130614.333333333
+1|130742.0
+4|130842.5
+6|130966.0
+5|131035.0
+4|131151.75
+3|131252.333333333
+3|131346.666666667
+3|131436.666666667
+8|131549.625
+8|131673.0
+6|131766.0
+9|131841.222222222
+9|131959.111111111
+4|132041.25
+2|132163.0
+4|132244.5
+7|132356.0
+7|132452.857142857
+5|132551.8
+6|132645.833333333
+6|132748.0
+8|132857.75
+5|132944.2
+3|133047.333333333
+4|133136.0
+1|133249.0
+3|133343.333333333
+4|133446.75
+5|133545.4
+2|133680.0
+3|133727.0
+3|133857.333333333
+10|133956.7
+4|134032.0
+5|134163.0
+5|134245.6
+3|134347.333333333
+9|134432.0
+6|134529.666666667
+6|134661.333333333
+4|134776.5
+7|134844.857142857
+2|134930.5
+4|135026.0
+5|135135.4
+4|135239.25
+4|135362.25
+0|
+7|135565.285714286
+6|135643.5
+9|135755.888888889
+3|135866.0
+4|135948.0
+5|136045.4
+3|136160.666666667
+7|136250.857142857
+7|136352.428571429
+4|136458.5
+7|136543.142857143
+3|136636.666666667
+4|136735.0
+8|136838.125
+3|136948.666666667
+5|137028.6
+1|137146.0
+3|137276.0
+2|137360.0
+4|137422.0
+1|137513.0
+4|137675.0
+6|137744.333333333
+6|137860.166666667
+5|137954.6
+3|138036.0
+6|138146.666666667
+1|138247.0
+3|138361.0
+5|138451.0
+8|138543.0
+5|138654.6
+3|138769.666666667
+10|138851.8
+6|138948.166666667
+11|139046.454545455
+4|139160.5
+8|139251.625
+1|139356.0
+5|139458.0
+3|139554.333333333
+6|139664.666666667
+7|139737.714285714
+6|139856.5
+2|139950.5
+4|140060.75
+5|140154.6
+5|140230.6
+6|140346.0
+5|140455.6
+5|140567.0
+6|140635.833333333
+3|140743.333333333
+6|140863.833333333
+3|140946.0
+3|141079.666666667
+5|141136.2
+7|141252.142857143
+4|141360.75
+5|141460.2
+1|141544.0
+3|141664.666666667
+2|141752.5
+10|141833.4
+3|141971.0
+7|142057.857142857
+4|142154.75
+5|142257.4
+10|142349.2
+2|142465.0
+4|142550.5
+2|142625.0
+5|142763.8
+5|142842.8
+5|142930.6
+2|143024.0
+4|143140.0
+6|143254.333333333
+4|143326.25
+2|143460.5
+5|143548.0
+6|143658.333333333
+5|143750.2
+5|143838.0
+5|143930.6
+4|144044.75
+7|144183.571428571
+7|144244.428571429
+4|144344.0
+9|144435.111111111
+9|144543.666666667
+9|144644.444444444
+5|144754.8
+4|144864.0
+7|144956.428571429
+5|145063.2
+5|145154.4
+3|145258.0
+5|145367.0
+1|145400.0
+7|145565.428571429
+6|145650.833333333
+5|145752.6
+6|145835.0
+5|145954.2
+8|146038.5
+7|146130.714285714
+6|146252.833333333
+4|146357.5
+9|146450.888888889
+6|146549.0
+2|146676.0
+8|146760.25
+7|146864.714285714
+3|146910.333333333
+5|147051.2
+3|147162.0
+2|147282.5
+4|147348.75
+9|147443.444444444
+2|147551.5
+6|147645.5
+5|147757.6
+4|147832.75
+4|147951.75
+4|148065.25
+5|148142.2
+3|148254.0
+4|148353.75
+7|148425.0
+5|148539.8
+4|148670.0
+3|148760.666666667
+5|148846.2
+5|148970.2
+6|149039.166666667
+4|149175.0
+4|149248.25
+1|149384.0
+9|149446.0
+3|149535.666666667
+7|149635.0
+8|149753.25
+5|149830.6
+5|149953.4
+3|150021.333333333
+5|150157.4
+2|150269.5
+4|150334.75
+2|150430.5
+6|150539.333333333
+5|150645.0
+6|150768.333333333
+7|150858.857142857
+5|150964.8
+7|151052.285714286
+2|151147.5
+4|151244.25
+3|151353.333333333
+2|151454.5
+7|151552.571428571
+6|151649.333333333
+6|151762.0
+9|151829.222222222
+6|151945.833333333
+11|152066.818181818
+5|152136.0
+3|152244.0
+0|
+5|152460.6
+4|152554.75
+9|152639.666666667
+3|152761.666666667
+1|152868.0
+10|152947.7
+8|153052.75
+4|153132.0
+4|153251.25
+3|153327.0
+7|153442.142857143
+3|153518.0
+1|153679.0
+4|153775.5
+2|153857.0
+5|153942.2
+2|154052.5
+3|154157.0
+5|154249.6
+9|154344.666666667
+2|154452.0
+6|154550.0
+3|154659.333333333
+4|154759.25
+3|154818.333333333
+4|154956.75
+5|155046.6
+5|155143.0
+6|155245.0
+6|155345.333333333
+9|155460.111111111
+2|155563.0
+6|155654.333333333
+5|155734.8
+4|155832.0
+2|155988.0
+2|156062.0
+7|156166.142857143
+3|156208.666666667
+9|156340.555555556
+5|156455.6
+3|156527.0
+5|156650.4
+6|156746.0
+4|156862.0
+11|156948.0
+8|157035.625
+8|157157.875
+6|157226.5
+8|157312.375
+3|157432.333333333
+7|157556.857142857
+6|157669.5
+2|157755.0
+5|157847.0
+7|157955.0
+6|158045.333333333
+5|158153.6
+1|158229.0
+8|158359.625
+3|158431.333333333
+7|158549.571428571
+3|158675.333333333
+5|158757.2
+6|158861.166666667
+10|158933.0
+3|159060.0
+6|159145.5
+7|159262.714285714
+1|159348.0
+8|159449.25
+3|159521.333333333
+1|159605.0
+10|159732.7
+5|159844.2
+5|159951.6
+6|160045.333333333
+3|160121.0
+4|160261.75
+11|160352.363636364
+4|160450.25
+3|160576.0
+6|160656.0
+6|160749.666666667
+3|160850.333333333
+3|160949.333333333
+4|161049.0
+7|161148.0
+4|161257.25
+3|161355.666666667
+6|161435.833333333
+3|161540.333333333
+8|161662.625
+9|161742.888888889
+7|161858.142857143
+4|161949.0
+2|162097.5
+3|162137.333333333
+6|162254.0
+3|162371.666666667
+4|162444.0
+2|162564.0
+6|162629.5
+6|162749.333333333
+3|162858.333333333
+8|162943.5
+3|163029.0
+3|163148.0
+3|163243.333333333
+5|163362.0
+3|163459.333333333
+5|163540.6
+6|163650.166666667
+6|163727.666666667
+6|163837.333333333
+8|163950.125
+6|164059.833333333
+4|164137.5
+4|164226.0
+7|164352.142857143
+2|164449.5
+8|164541.25
+1|164624.0
+6|164750.0
+5|164847.8
+5|164931.6
+6|165064.333333333
+4|165159.0
+5|165263.8
+4|165357.75
+7|165447.142857143
+5|165546.6
+6|165652.666666667
+6|165752.666666667
+5|165854.4
+6|165944.5
+3|166046.0
+7|166146.571428571
+5|166260.6
+10|166349.2
+5|166465.0
+1|166594.0
+5|166648.4
+10|166747.6
+6|166845.0
+7|166960.142857143
+6|167036.166666667
+8|167154.125
+2|167256.5
+4|167347.25
+4|167467.5
+3|167552.0
+6|167636.166666667
+8|167748.75
+4|167819.5
+1|167911.0
+7|168049.285714286
+4|168150.75
+11|168252.272727273
+3|168344.0
+6|168450.833333333
+5|168543.4
+6|168624.5
+3|168775.666666667
+5|168874.0
+3|168972.666666667
+4|169049.5
+4|169147.0
+7|169247.142857143
+3|169349.666666667
+7|169431.571428571
+3|169539.0
+7|169628.714285714
+6|169765.833333333
+5|169835.0
+6|169942.5
+3|170042.333333333
+7|170166.857142857
+7|170247.571428571
+2|170331.0
+5|170458.2
+4|170541.25
+3|170663.333333333
+5|170746.2
+11|170830.545454545
+6|170943.333333333
+4|171055.25
+4|171144.25
+3|171240.666666667
+2|171326.0
+5|171447.2
+5|171549.0
+7|171666.0
+5|171750.0
+4|171843.25
+3|171934.666666667
+4|172049.5
+2|172160.5
+6|172252.166666667
+4|172334.5
+1|172448.0
+4|172537.75
+2|172656.5
+3|172723.0
+6|172836.833333333
+7|172955.0
+4|173043.5
+7|173140.857142857
+5|173249.2
+5|173369.8
+4|173447.25
+7|173547.428571429
+4|173644.0
+3|173749.0
+5|173845.2
+6|173946.5
+9|174031.222222222
+4|174165.25
+3|174223.0
+3|174321.0
+11|174441.636363636
+8|174544.5
+5|174645.0
+1|174744.0
+7|174852.142857143
+10|174961.5
+1|175087.0
+3|175146.666666667
+5|175206.8
+5|175345.4
+3|175441.0
+6|175555.833333333
+4|175674.25
+4|175745.25
+3|175856.666666667
+8|175940.75
+12|176040.25
+10|176141.7
+1|176208.0
+10|176338.0
+5|176450.0
+6|176557.666666667
+6|176677.833333333
+5|176747.6
+3|176839.333333333
+4|176936.0
+5|177059.6
+4|177146.25
+5|177216.6
+1|177384.0
+3|177438.0
+3|177564.0
+5|177645.8
+4|177781.5
+5|177847.2
+3|177942.0
+3|178053.0
+7|178164.714285714
+1|178260.0
+4|178351.25
+1|178476.0
+4|178562.75
+7|178666.714285714
+9|178757.666666667
+3|178846.666666667
+4|178954.0
+4|179070.0
+6|179148.0
+6|179261.0
+4|179316.25
+3|179427.0
+6|179564.166666667
+3|179638.0
+4|179765.75
+4|179871.25
+3|179927.666666667
+7|180056.428571429
+7|180137.0
+5|180256.6
+10|180343.3
+3|180455.0
+5|180565.6
+0|
+2|180720.0
+6|180825.5
+5|180952.0
+5|181063.2
+7|181142.571428571
+6|181240.5
+6|181351.5
+5|181443.0
+8|181557.625
+7|181664.0
+6|181753.333333333
+3|181845.666666667
+2|181961.5
+7|182033.285714286
+4|182139.75
+2|182286.5
+4|182324.25
+2|182442.0
+5|182542.4
+3|182610.333333333
+13|182749.923076923
+5|182831.6
+6|182954.833333333
+9|183054.111111111
+8|183155.75
+10|183246.3
+3|183363.666666667
+4|183451.75
+8|183552.5
+2|183668.5
+7|183763.285714286
+4|183879.0
+4|183945.25
+3|184081.333333333
+4|184154.25
+4|184239.75
+10|184346.3
+3|184416.333333333
+8|184539.75
+5|184653.4
+4|184751.25
+6|184827.666666667
+6|184935.0
+8|185049.75
+13|185147.692307692
+7|185248.285714286
+5|185345.0
+3|185439.333333333
+3|185537.333333333
+4|185668.25
+2|185750.5
+5|185848.4
+6|185953.5
+6|186041.5
+3|186129.0
+3|186254.0
+5|186368.2
+6|186451.166666667
+9|186547.222222222
+6|186661.666666667
+1|186788.0
+3|186852.0
+5|186948.8
+4|187054.0
+6|187140.833333333
+6|187247.166666667
+3|187331.333333333
+1|187432.0
+6|187549.666666667
+3|187638.666666667
+5|187726.0
+8|187851.125
+3|187930.666666667
+5|188074.2
+6|188158.333333333
+8|188259.625
+5|188342.8
+7|188466.714285714
+7|188554.714285714
+4|188670.75
+5|188763.6
+4|188872.5
+3|188979.666666667
+8|189051.625
+6|189134.0
+3|189231.333333333
+4|189324.25
+7|189453.857142857
+2|189563.0
+3|189648.333333333
+10|189751.6
+6|189841.0
+5|189923.2
+6|190062.5
+4|190147.25
+8|190225.25
+3|190351.666666667
+4|190464.0
+3|190551.333333333
+3|190652.0
+5|190745.2
+2|190817.5
+3|190968.666666667
+11|191062.272727273
+8|191143.0
+4|191232.0
+5|191343.6
+7|191457.857142857
+6|191556.666666667
+11|191657.818181818
+5|191750.4
+7|191842.714285714
+2|191918.5
+6|192057.333333333
+6|192164.0
+4|192235.25
+5|192336.8
+2|192451.0
+8|192561.25
+6|192631.166666667
+8|192745.625
+3|192866.0
+2|192933.5
+6|193051.5
+4|193153.5
+4|193261.5
+4|193366.5
+7|193432.285714286
+5|193547.4
+9|193653.555555556
+3|193748.0
+7|193843.857142857
+5|193955.2
+4|194068.75
+5|194138.4
+4|194235.0
+3|194342.0
+6|194424.0
+5|194565.4
+6|194640.5
+7|194751.571428571
+6|194840.333333333
+6|194938.333333333
+5|195029.2
+5|195169.6
+4|195249.5
+3|195311.666666667
+7|195466.571428571
+2|195554.0
+4|195630.5
+12|195753.833333333
+4|195873.5
+2|195911.5
+1|196063.0
+1|196105.0
+6|196230.166666667
+7|196357.857142857
+3|196464.333333333
+5|196561.2
+1|196657.0
+5|196728.0
+3|196852.333333333
+5|196944.2
+10|197059.9
+5|197127.6
+5|197237.4
+2|197370.0
+6|197467.166666667
+4|197570.25
+4|197642.5
+6|197737.5
+5|197840.6
+7|197944.285714286
+0|
+4|198153.5
+4|198250.5
+5|198339.8
+4|198442.5
+7|198548.857142857
+9|198642.222222222
+4|198743.0
+6|198841.666666667
+4|198950.75
+1|199033.0
+4|199134.25
+3|199221.666666667
+2|199348.0
+4|199441.5
+8|199554.25
+7|199639.0
+4|199751.5
+2|199842.5
+1|199914.0
+2|200043.0
+5|200128.6
+8|200242.625
+3|200323.666666667
+5|200431.4
+4|200520.5
+10|200634.4
+3|200762.0
+7|200833.285714286
+6|200968.333333333
+5|201042.4
+7|201132.857142857
+2|201258.0
+2|201363.5
+3|201434.666666667
+3|201546.0
+4|201637.5
+4|201725.5
+4|201827.0
+5|201950.0
+3|202047.666666667
+2|202116.0
+3|202258.0
+6|202359.666666667
+6|202468.166666667
+5|202545.0
+5|202652.4
+6|202753.666666667
+5|202846.4
+8|202945.0
+1|203026.0
+4|203169.75
+4|203253.5
+3|203360.0
+6|203451.333333333
+6|203547.333333333
+6|203650.833333333
+4|203755.0
+3|203879.0
+4|203941.5
+1|204067.0
+2|204112.0
+7|204255.0
+10|204358.2
+8|204429.875
+8|204554.625
+5|204654.2
+3|204754.333333333
+9|204850.555555556
+9|204939.444444444
+4|205047.75
+3|205175.333333333
+3|205230.333333333
+1|205379.0
+7|205437.0
+3|205537.0
+6|205649.5
+3|205780.333333333
+6|205836.166666667
+5|205932.6
+7|206067.142857143
+4|206146.75
+4|206276.25
+8|206345.375
+6|206428.333333333
+7|206541.428571429
+4|206623.25
+5|206752.2
+2|206835.0
+4|206958.25
+7|207051.0
+8|207149.625
+6|207250.0
+3|207325.0
+4|207446.25
+7|207550.714285714
+4|207643.75
+7|207736.285714286
+2|207863.5
+4|207924.25
+5|208040.8
+4|208163.75
+7|208252.0
+8|208362.875
+5|208423.2
+8|208558.0
+7|208644.0
+7|208748.428571429
+9|208849.444444444
+6|208931.333333333
+5|209048.8
+3|209163.333333333
+3|209262.0
+7|209352.571428571
+9|209456.333333333
+2|209561.5
+2|209636.0
+7|209746.714285714
+7|209856.857142857
+6|209943.5
+7|210069.142857143
+6|210122.333333333
+2|210216.5
+6|210350.0
+6|210446.333333333
+5|210553.0
+2|210619.0
+9|210765.222222222
+4|210852.75
+4|210946.75
+5|211060.0
+4|211164.25
+3|211231.666666667
+6|211325.666666667
+5|211461.6
+3|211560.666666667
+3|211641.333333333
+2|211722.0
+6|211845.666666667
+2|211955.0
+2|212064.0
+7|212155.285714286
+6|212227.333333333
+2|212335.5
+5|212469.6
+4|212538.5
+10|212642.3
+7|212755.857142857
+7|212860.428571429
+5|212943.4
+4|213035.0
+6|213139.0
+4|213242.25
+2|213361.0
+6|213458.5
+4|213547.25
+5|213641.8
+4|213778.0
+8|213859.125
+3|213955.0
+4|214058.0
+5|214166.8
+5|214236.8
+5|214337.4
+4|214446.5
+4|214568.5
+6|214641.0
+4|214751.0
+6|214858.833333333
+5|214970.6
+5|215044.2
+4|215154.25
+2|215243.5
+3|215363.0
+7|215451.285714286
+6|215549.166666667
+2|215629.0
+3|215758.666666667
+5|215848.2
+5|215957.4
+1|216083.0
+7|216158.428571429
+4|216263.75
+8|216350.75
+10|216452.9
+1|216590.0
+1|216681.0
+9|216755.222222222
+3|216839.0
+7|216938.714285714
+7|217042.142857143
+3|217136.0
+3|217262.0
+3|217344.666666667
+2|217472.0
+5|217551.0
+5|217657.0
+6|217753.0
+5|217872.2
+3|217968.333333333
+1|218075.0
+4|218128.5
+6|218269.5
+7|218359.428571429
+9|218451.888888889
+5|218543.6
+5|218659.4
+9|218746.222222222
+4|218835.5
+3|218944.333333333
+6|219053.833333333
+8|219144.5
+3|219251.333333333
+5|219351.8
+7|219445.714285714
+8|219575.75
+4|219656.75
+5|219737.0
+5|219848.4
+2|219908.0
+5|220058.4
+3|220142.333333333
+3|220246.0
+2|220355.5
+6|220449.5
+5|220524.2
+2|220686.0
+7|220751.428571429
+4|220849.5
+3|220923.0
+3|221040.333333333
+4|221140.0
+1|221254.0
+3|221354.333333333
+8|221448.25
+3|221548.333333333
+7|221642.428571429
+6|221742.666666667
+7|221868.285714286
+2|221927.5
+2|222027.0
+4|222160.5
+5|222241.2
+4|222363.5
+7|222453.714285714
+7|222545.428571429
+11|222648.727272727
+7|222744.857142857
+6|222865.166666667
+6|222946.333333333
+4|223040.5
+7|223157.857142857
+4|223245.75
+1|223308.0
+8|223449.5
+5|223577.6
+9|223647.444444445
+10|223752.8
+2|223809.5
+4|223939.75
+4|224053.5
+4|224140.5
+3|224270.0
+5|224347.6
+7|224453.714285714
+8|224538.625
+5|224660.6
+4|224748.5
+3|224845.333333333
+7|224949.571428571
+2|225050.0
+4|225169.0
+8|225263.625
+12|225368.166666667
+5|225459.4
+9|225546.777777778
+11|225659.818181818
+4|225752.25
+5|225864.6
+3|225922.666666667
+4|226065.25
+3|226133.0
+10|226248.4
+7|226353.0
+6|226448.666666667
+4|226556.5
+3|226615.0
+1|226778.0
+13|226851.538461539
+5|226950.2
+6|227045.333333333
+4|227167.5
+6|227257.333333333
+1|227314.0
+3|227468.333333333
+3|227542.666666667
+5|227647.4
+5|227753.0
+4|227850.0
+6|227957.833333333
+5|228065.0
+4|228135.0
+3|228291.666666667
+5|228361.0
+5|228440.6
+4|228554.25
+5|228648.4
+5|228754.6
+5|228834.6
+1|228911.0
+4|229046.0
+3|229144.333333333
+9|229248.444444445
+3|229355.0
+7|229437.0
+6|229554.166666667
+7|229640.142857143
+6|229757.833333333
+0|
+6|229961.833333333
+3|230058.666666667
+5|230135.4
+2|230255.0
+7|230369.857142857
+1|230431.0
+3|230544.666666667
+5|230649.6
+10|230735.0
+6|230817.0
+5|230948.2
+1|231087.0
+5|231158.8
+6|231253.833333333
+3|231350.0
+6|231447.666666667
+1|231584.0
+8|231647.375
+5|231730.2
+3|231852.666666667
+6|231930.166666667
+10|232038.3
+4|232153.25
+2|232267.5
+4|232359.0
+7|232439.142857143
+6|232546.333333333
+4|232636.25
+3|232760.0
+2|232870.0
+3|232957.0
+8|233058.75
+2|233160.5
+5|233247.6
+9|233354.222222222
+5|233464.0
+5|233553.4
+4|233634.75
+4|233752.25
+4|233834.5
+4|233944.25
+7|234062.285714286
+4|234164.0
+3|234227.0
+4|234366.5
+4|234445.0
+2|234555.0
+3|234635.666666667
+10|234749.0
+4|234848.5
+5|234954.4
+4|235040.5
+10|235157.8
+6|235248.166666667
+5|235336.8
+2|235495.0
+3|235559.333333333
+7|235650.714285714
+2|235741.0
+4|235840.5
+3|235932.0
+8|236057.625
+2|236178.5
+2|236225.0
+3|236351.0
+4|236447.5
+8|236542.5
+4|236659.5
+6|236722.666666667
+4|236856.5
+11|236942.545454546
+5|237064.6
+7|237161.714285714
+4|237232.5
+3|237341.333333333
+8|237452.125
+4|237538.25
+9|237649.222222222
+7|237757.428571429
+3|237878.666666667
+2|237951.0
+8|238036.75
+2|238137.5
+4|238271.5
+7|238348.857142857
+4|238453.75
+7|238556.428571429
+2|238645.5
+7|238750.0
+9|238870.555555556
+4|238932.25
+7|239042.428571429
+3|239146.666666667
+4|239247.25
+6|239368.666666667
+5|239417.0
+4|239570.5
+6|239655.666666667
+4|239761.25
+5|239833.6
+6|239955.666666667
+1|240068.0
+3|240145.0
+3|240262.333333333
+4|240352.0
+4|240446.75
+4|240546.0
+8|240659.5
+7|240739.714285714
+3|240844.0
+9|240964.0
+11|241061.818181818
+5|241140.0
+5|241234.4
+2|241341.5
+4|241427.0
+3|241531.333333333
+7|241657.142857143
+5|241749.8
+6|241841.666666667
+11|241960.545454546
+4|242043.75
+4|242138.5
+6|242253.833333333
+4|242352.5
+5|242462.0
+7|242538.714285714
+5|242646.8
+4|242747.25
+5|242845.6
+6|242970.0
+1|243089.0
+3|243142.333333333
+2|243247.5
+4|243366.25
+2|243468.0
+8|243543.625
+6|243633.666666667
+2|243725.5
+6|243865.0
+7|243943.0
+6|244032.166666667
+7|244173.0
+3|244235.333333333
+4|244379.0
+1|244403.0
+3|244578.666666667
+5|244645.6
+4|244743.0
+3|244838.333333333
+7|244951.428571429
+7|245039.857142857
+7|245148.714285714
+3|245265.333333333
+10|245342.9
+5|245454.6
+2|245532.0
+4|245653.75
+4|245741.0
+9|245841.666666667
+5|245950.2
+7|246044.857142857
+6|246148.0
+4|246245.25
+5|246351.4
+2|246434.0
+1|246522.0
+2|246637.0
+4|246734.0
+2|246867.0
+4|246969.25
+5|247058.8
+10|247166.1
+8|247247.375
+9|247352.666666667
+3|247461.666666667
+9|247537.666666667
+4|247642.5
+3|247780.333333333
+6|247857.666666667
+6|247959.5
+7|248047.714285714
+3|248115.666666667
+8|248241.375
+4|248346.0
+5|248442.4
+1|248567.0
+5|248649.4
+7|248744.571428571
+5|248831.0
+4|248920.5
+5|249078.8
+8|249153.125
+5|249260.2
+7|249354.142857143
+2|249458.5
+5|249554.6
+6|249653.166666667
+6|249727.166666667
+3|249858.0
+8|249931.375
+5|250054.0
+7|250141.142857143
+2|250275.0
+5|250356.6
+5|250452.4
+3|250555.333333333
+6|250652.833333333
+6|250757.333333333
+6|250861.666666667
+7|250945.428571429
+1|251052.0
+5|251169.6
+4|251234.5
+4|251348.0
+0|
+5|251547.6
+8|251644.75
+4|251755.0
+5|251867.4
+7|251934.0
+4|252044.75
+6|252153.833333333
+3|252268.0
+4|252358.75
+4|252457.75
+7|252556.428571429
+5|252644.8
+3|252758.333333333
+4|252846.25
+7|252951.428571429
+6|253043.5
+5|253186.2
+7|253235.714285714
+5|253350.2
+7|253443.285714286
+4|253559.5
+4|253629.25
+4|253727.5
+1|253824.0
+6|253963.166666667
+5|254043.8
+3|254180.666666667
+5|254224.0
+7|254340.857142857
+6|254458.166666667
+4|254548.75
+7|254648.0
+8|254761.75
+9|254844.0
+3|254963.666666667
+5|255043.4
+5|255174.0
+2|255278.5
+12|255352.416666667
+3|255453.333333333
+4|255533.5
+10|255659.4
+6|255762.5
+3|255856.666666667
+4|255961.5
+4|256033.75
+4|256123.75
+11|256249.636363636
+5|256336.4
+7|256452.0
+6|256542.833333333
+6|256647.666666667
+3|256764.333333333
+6|256854.0
+8|256933.0
+7|257044.571428571
+3|257135.666666667
+5|257248.6
+9|257353.222222222
+9|257460.111111111
+7|257558.0
+3|257661.0
+8|257740.75
+7|257862.571428571
+3|257939.666666667
+9|258049.666666667
+7|258137.285714286
+7|258241.714285714
+5|258362.8
+2|258472.0
+4|258532.75
+5|258660.4
+5|258758.2
+3|258886.333333333
+4|258938.25
+6|259052.166666667
+4|259152.75
+7|259248.857142857
+8|259341.25
+4|259461.75
+11|259544.818181818
+4|259631.25
+4|259741.0
+3|259870.0
+1|259980.0
+6|260037.333333333
+7|260131.428571429
+6|260260.166666667
+4|260341.5
+6|260453.833333333
+4|260556.0
+4|260625.25
+8|260765.75
+5|260833.0
+5|260967.4
+5|261060.0
+1|261127.0
+8|261254.875
+5|261338.2
+3|261439.0
+5|261560.0
+3|261649.0
+2|261736.5
+8|261844.25
+4|261975.5
+5|262082.6
+7|262150.285714286
+9|262250.111111111
+3|262353.333333333
+4|262470.0
+4|262536.75
+3|262660.666666667
+5|262735.6
+6|262839.333333333
+5|262929.6
+5|263063.8
+6|263140.0
+6|263229.166666667
+7|263351.285714286
+5|263439.0
+4|263509.5
+2|263665.5
+9|263747.888888889
+6|263843.5
+5|263918.2
+4|264024.5
+4|264159.75
+4|264244.5
+7|264363.0
+5|264436.2
+2|264575.0
+7|264661.714285714
+5|264771.2
+7|264842.428571429
+4|264948.75
+4|265038.75
+3|265164.333333333
+4|265272.0
+5|265352.2
+9|265461.888888889
+6|265548.666666667
+4|265656.0
+6|265750.0
+7|265847.428571429
+3|265955.333333333
+0|
+5|266148.6
+5|266232.6
+4|266351.75
+5|266435.2
+8|266548.0
+2|266641.0
+6|266742.5
+4|266848.75
+5|266946.2
+3|267040.333333333
+3|267155.0
+2|267245.0
+6|267331.0
+4|267454.0
+11|267541.909090909
+6|267654.166666667
+6|267761.833333333
+6|267839.333333333
+8|267934.75
+5|268061.0
+6|268148.333333333
+2|268261.0
+3|268319.666666667
+3|268463.0
+4|268534.5
+3|268666.333333333
+2|268761.0
+6|268882.5
+7|268963.142857143
+4|269067.0
+3|269128.666666667
+5|269265.2
+3|269330.333333333
+5|269439.6
+4|269564.5
+5|269645.0
+6|269745.0
+6|269866.166666667
+5|269971.4
+9|270052.333333333
+3|270162.333333333
+3|270258.333333333
+3|270345.333333333
+5|270445.6
+2|270521.0
+6|270645.0
+6|270757.666666667
+4|270873.5
+4|270946.0
+3|271030.666666667
+5|271137.8
+4|271238.0
+6|271352.5
+3|271453.666666667
+6|271566.666666667
+8|271639.875
+4|271751.75
+6|271861.333333333
+5|271958.0
+9|272025.0
+3|272127.666666667
+6|272265.666666667
+7|272358.142857143
+2|272488.0
+4|272537.0
+6|272634.166666667
+3|272745.333333333
+10|272848.3
+5|272940.6
+7|273050.428571429
+5|273138.8
+6|273253.166666667
+11|273347.454545455
+8|273445.5
+3|273558.0
+6|273652.5
+6|273722.333333333
+4|273866.25
+5|273968.4
+6|274039.833333333
+3|274149.333333333
+4|274247.75
+3|274377.0
+5|274449.2
+5|274534.2
+6|274656.0
+5|274733.8
+3|274856.666666667
+7|274933.142857143
+10|275040.5
+2|275132.0
+6|275253.166666667
+4|275320.75
+3|275437.666666667
+5|275546.0
+5|275657.6
+4|275753.75
+6|275847.833333333
+9|275947.222222222
+8|276036.5
+3|276144.333333333
+2|276269.5
+6|276352.5
+4|276439.5
+4|276522.25
+2|276638.0
+5|276754.8
+4|276821.0
+9|276958.222222222
+5|277044.8
+4|277148.5
+5|277243.4
+4|277357.75
+4|277454.25
+1|277588.0
+7|277655.714285714
+5|277760.0
+3|277864.333333333
+10|277948.2
+5|278025.6
+6|278157.666666667
+5|278255.0
+2|278381.0
+5|278454.6
+8|278564.625
+1|278656.0
+3|278742.0
+7|278843.571428571
+3|278979.0
+6|279045.166666667
+7|279152.857142857
+1|279202.0
+2|279371.0
+7|279460.0
+4|279547.0
+4|279630.25
+4|279756.75
+9|279850.777777778
+7|279947.571428571
+6|280059.0
+4|280156.5
+3|280236.0
+1|280395.0
+6|280458.166666667
+5|280548.8
+5|280635.2
+2|280788.5
+1|280857.0
+8|280936.75
+2|281071.5
+8|281155.0
+5|281225.0
+4|281347.5
+3|281461.333333333
+1|281510.0
+5|281630.2
+7|281738.0
+2|281848.0
+5|281934.0
+3|282040.666666667
+0|
+2|282259.0
+10|282347.2
+3|282468.333333333
+8|282546.5
+5|282653.0
+4|282739.25
+10|282848.7
+3|282942.666666667
+8|283066.125
+6|283153.0
+3|283263.666666667
+2|283369.5
+8|283444.125
+6|283557.166666667
+3|283619.0
+6|283757.833333333
+6|283842.333333333
+5|283953.2
+9|284052.666666667
+4|284141.0
+5|284229.0
+6|284354.333333333
+4|284450.25
+4|284554.25
+8|284661.25
+6|284757.833333333
+7|284852.857142857
+6|284960.666666667
+2|285074.5
+5|285140.6
+3|285231.0
+8|285341.875
+5|285458.0
+5|285527.6
+3|285639.0
+4|285739.75
+6|285847.5
+5|285938.6
+5|286042.4
+6|286149.666666667
+4|286241.25
+5|286342.4
+3|286441.666666667
+4|286539.75
+7|286639.285714286
+6|286729.333333333
+1|286825.0
+2|286989.5
+4|287047.0
+8|287153.5
+7|287233.571428571
+9|287379.666666667
+3|287457.666666667
+5|287518.4
+5|287646.0
+5|287770.0
+9|287835.555555556
+6|287967.833333333
+3|288047.0
+4|288165.75
+6|288224.0
+8|288359.375
+7|288470.142857143
+10|288529.8
+1|288692.0
+6|288737.5
+5|288830.4
+7|288963.714285714
+9|289049.444444445
+7|289148.285714286
+4|289250.75
+3|289362.666666667
+3|289459.666666667
+5|289570.0
+13|289652.923076923
+9|289751.888888889
+6|289841.333333333
+4|289946.0
+8|290059.875
+12|290165.75
+4|290246.0
+7|290345.571428572
+7|290451.0
+6|290544.166666667
+3|290629.333333333
+3|290784.0
+7|290864.0
+5|290924.2
+4|291060.25
+5|291146.8
+5|291240.8
+3|291378.0
+2|291433.5
+9|291540.555555556
+7|291645.857142857
+9|291767.777777778
+7|291841.857142857
+6|291946.666666667
+3|292067.666666667
+8|292124.375
+6|292235.333333333
+4|292341.0
+3|292432.333333333
+8|292552.0
+6|292626.166666667
+8|292758.375
+3|292862.666666667
+4|292941.5
+5|293051.6
+10|293148.9
+5|293242.4
+6|293355.833333333
+1|293493.0
+5|293548.8
+5|293661.0
+4|293745.5
+10|293846.0
+6|293938.0
+7|294057.714285714
+4|294136.75
+1|294212.0
+3|294340.666666667
+7|294435.142857143
+3|294546.333333333
+1|294644.0
+6|294750.166666667
+6|294840.5
+7|294955.0
+3|295020.0
+5|295141.2
+5|295230.2
+4|295342.0
+5|295458.6
+5|295530.4
+5|295640.6
+6|295736.5
+4|295840.5
+7|295952.714285714
+6|296053.166666667
+6|296157.833333333
+7|296243.285714286
+6|296361.333333333
+6|296450.333333333
+5|296545.2
+3|296659.666666667
+2|296734.5
+3|296836.666666667
+5|296962.6
+6|297049.666666667
+4|297151.5
+5|297260.4
+3|297342.666666667
+8|297469.5
+3|297560.333333333
+5|297673.8
+2|297797.0
+4|297836.0
+5|297950.0
+9|298034.444444445
+4|298154.75
+5|298244.0
+11|298351.636363636
+4|298469.75
+6|298528.5
+1|298696.0
+8|298753.75
+7|298862.857142857
+2|298953.5
+8|299045.375
+5|299162.4
+4|299256.25
+6|299356.166666667
+8|299449.375
+9|299553.666666667
+4|299664.0
+3|299738.333333333
+6|299837.666666667
+3|299950.0
+3|300044.0
+4|300169.5
+9|300233.222222222
+6|300351.833333333
+6|300466.333333333
+6|300563.5
+2|300643.5
+2|300746.0
+6|300840.5
+2|300961.5
+10|301052.5
+9|301153.555555556
+4|301221.5
+5|301345.8
+1|301435.0
+6|301549.333333333
+8|301661.625
+6|301759.5
+5|301850.6
+4|301972.5
+2|302045.5
+7|302144.142857143
+2|302258.5
+3|302330.666666667
+6|302452.5
+3|302538.0
+1|302672.0
+7|302734.428571429
+3|302890.666666667
+6|302942.166666667
+7|303047.714285714
+8|303156.125
+6|303259.166666667
+9|303357.444444445
+11|303437.363636364
+2|303556.0
+6|303654.5
+3|303770.0
+8|303865.0
+5|303935.8
+6|304046.0
+7|304144.857142857
+5|304253.8
+7|304347.285714286
+4|304455.0
+3|304511.0
+5|304626.0
+6|304747.666666667
+2|304894.0
+1|304995.0
+5|305049.6
+4|305165.75
+6|305250.833333333
+5|305368.0
+6|305454.5
+3|305535.666666667
+5|305657.6
+5|305731.4
+8|305853.5
+3|305977.0
+8|306054.875
+7|306159.0
+7|306226.285714286
+6|306351.833333333
+11|306456.727272727
+5|306533.8
+0|
+2|306734.0
+3|306831.333333333
+6|306950.5
+3|307033.0
+3|307121.0
+6|307260.833333333
+7|307348.428571429
+3|307437.666666667
+0|
+6|307657.833333333
+13|307743.846153846
+5|307844.8
+4|307974.25
+3|308077.0
+7|308150.857142857
+3|308259.333333333
+0|
+1|308449.0
+5|308560.2
+6|308637.333333333
+5|308729.4
+8|308844.5
+4|308932.75
+4|309028.0
+4|309120.0
+4|309215.5
+8|309350.125
+4|309446.5
+6|309545.166666667
+6|309644.666666667
+4|309727.0
+4|309827.75
+9|309949.555555556
+7|310028.571428572
+5|310151.6
+7|310265.571428572
+11|310340.727272727
+7|310450.714285714
+10|310542.6
+6|310643.166666667
+2|310746.0
+6|310843.333333333
+4|310936.25
+3|311072.666666667
+9|311152.555555556
+4|311255.5
+4|311362.0
+6|311440.833333333
+4|311535.25
+6|311660.0
+2|311740.5
+2|311841.0
+3|311936.333333333
+4|312045.0
+5|312141.8
+3|312273.333333333
+5|312341.0
+6|312445.833333333
+6|312553.333333333
+4|312667.75
+6|312748.0
+2|312839.0
+6|312977.333333333
+4|313071.25
+3|313169.333333333
+8|313269.5
+7|313357.285714286
+8|313448.875
+4|313553.5
+8|313635.5
+4|313750.75
+2|313875.0
+3|313960.333333333
+5|314050.8
+5|314163.4
+5|314252.8
+5|314375.6
+7|314455.571428572
+6|314554.333333333
+3|314629.333333333
+2|314739.5
+3|314848.0
+7|314939.428571429
+5|315063.2
+7|315147.428571429
+7|315259.0
+3|315333.333333333
+6|315436.5
+4|315543.5
+4|315664.75
+4|315720.0
+3|315838.333333333
+3|315936.0
+7|316066.857142857
+5|316139.8
+6|316266.5
+8|316347.125
+6|316450.666666667
+5|316546.6
+7|316663.857142857
+4|316741.5
+3|316838.333333333
+4|316964.0
+2|317055.0
+3|317120.666666667
+4|317265.25
+0|
+4|317466.5
+2|317544.0
+5|317635.8
+5|317747.0
+4|317841.25
+5|317952.8
+4|318068.75
+3|318129.666666667
+5|318246.2
+5|318338.4
+5|318458.4
+6|318550.166666667
+1|318638.0
+3|318723.0
+1|318870.0
+4|318954.75
+6|319060.5
+7|319145.428571429
+4|319255.75
+1|319304.0
+4|319482.75
+4|319553.5
+2|319666.0
+3|319770.666666667
+6|319867.833333333
+5|319934.4
+8|320071.0
+7|320164.714285714
+5|320236.4
+11|320351.545454546
+2|320459.0
+1|320549.0
+9|320665.555555556
+4|320766.75
+9|320847.111111111
+4|320963.0
+7|321060.428571429
+5|321171.2
+5|321243.4
+5|321353.2
+5|321449.4
+4|321542.75
+6|321639.833333333
+4|321723.5
+4|321842.0
+5|321950.4
+5|322054.6
+4|322145.0
+7|322239.428571429
+9|322353.777777778
+2|322432.0
+4|322540.5
+6|322637.333333333
+6|322765.0
+3|322857.0
+9|322940.666666667
+3|323053.0
+1|323179.0
+2|323242.5
+9|323349.444444445
+7|323452.285714286
+4|323559.25
+8|323665.375
+4|323744.0
+7|323836.142857143
+4|323942.25
+8|324047.75
+6|324154.833333333
+4|324218.75
+5|324346.0
+3|324472.666666667
+3|324513.333333333
+4|324647.75
+4|324770.75
+5|324862.6
+3|324949.333333333
+3|325072.666666667
+7|325146.857142857
+4|325261.75
+13|325337.769230769
+4|325446.0
+5|325565.0
+5|325649.6
+5|325766.8
+5|325845.2
+3|325927.666666667
+5|326051.2
+3|326159.333333333
+8|326239.625
+8|326333.5
+6|326477.333333333
+3|326536.0
+2|326632.0
+4|326749.0
+4|326863.75
+5|326953.6
+5|327054.4
+2|327168.0
+5|327263.4
+8|327347.5
+4|327457.75
+7|327567.857142857
+9|327647.777777778
+4|327737.5
+3|327855.666666667
+7|327952.0
+4|328067.0
+5|328144.4
+5|328238.8
+7|328344.857142857
+6|328459.0
+3|328548.333333333
+4|328653.25
+7|328725.142857143
+6|328848.166666667
+6|328940.666666667
+7|329047.142857143
+6|329164.333333333
+3|329220.333333333
+7|329339.857142857
+7|329451.0
+4|329557.5
+2|329620.0
+10|329749.1
+4|329841.5
+3|329961.666666667
+7|330032.428571429
+3|330152.666666667
+2|330264.5
+10|330339.8
+6|330468.0
+5|330555.4
+4|330656.5
+7|330755.857142857
+4|330872.5
+5|330952.4
+4|331040.0
+4|331151.5
+4|331237.5
+1|331361.0
+2|331451.5
+5|331556.4
+3|331635.333333333
+3|331738.333333333
+2|331887.5
+4|331970.75
+1|332032.0
+8|332152.25
+5|332245.6
+9|332332.666666667
+9|332448.0
+4|332549.5
+4|332637.25
+7|332769.0
+10|332837.6
+5|332946.0
+4|333052.0
+5|333176.0
+5|333273.6
+2|333325.5
+4|333435.5
+9|333552.222222222
+4|333672.25
+7|333756.714285714
+6|333864.666666667
+3|333980.666666667
+4|334061.75
+4|334147.75
+7|334256.714285714
+6|334342.0
+8|334446.125
+2|334529.0
+2|334662.0
+3|334773.666666667
+6|334843.833333333
+3|334937.666666667
+3|335021.0
+5|335136.6
+4|335255.25
+7|335361.714285714
+6|335451.833333333
+9|335538.666666667
+5|335659.6
+4|335761.25
+8|335844.25
+4|335932.75
+7|336050.428571429
+5|336128.6
+3|336270.666666667
+2|336338.0
+7|336458.857142857
+4|336523.75
+3|336635.333333333
+2|336716.5
+5|336850.8
+4|336942.5
+6|337054.666666667
+4|337140.75
+5|337260.2
+7|337353.285714286
+5|337448.6
+2|337524.5
+6|337653.666666667
+4|337756.75
+6|337852.833333333
+3|337958.666666667
+5|338070.6
+3|338133.666666667
+5|338253.8
+4|338356.25
+5|338456.6
+2|338515.5
+5|338653.0
+4|338762.25
+7|338848.285714286
+3|338931.333333333
+7|339050.714285714
+7|339139.714285714
+2|339248.5
+6|339353.666666667
+7|339435.571428572
+7|339555.571428572
+2|339664.5
+4|339760.25
+7|339872.285714286
+5|339948.0
+4|340031.75
+6|340146.0
+6|340234.666666667
+3|340369.333333333
+5|340453.0
+4|340559.5
+4|340669.5
+4|340735.5
+2|340847.0
+1|340983.0
+10|341049.9
+3|341147.666666667
+7|341256.0
+6|341341.166666667
+3|341439.333333333
+1|341539.0
+6|341650.833333333
+6|341775.5
+2|341848.0
+4|341947.0
+5|342044.4
+1|342185.0
+6|342252.666666667
+8|342336.0
+5|342460.8
+6|342564.166666667
+3|342656.666666667
+3|342731.0
+6|342850.166666667
+3|342945.666666667
+2|343032.0
+8|343149.375
+8|343254.375
+7|343349.285714286
+1|343419.0
+7|343535.428571429
+5|343661.2
+9|343758.444444445
+6|343864.666666667
+5|343956.8
+5|344017.6
+4|344150.0
+6|344261.0
+5|344383.0
+5|344448.4
+4|344565.5
+5|344653.6
+6|344759.833333333
+6|344842.833333333
+5|344967.8
+7|345066.285714286
+7|345156.714285714
+4|345256.5
+3|345364.333333333
+10|345457.3
+6|345560.666666667
+8|345638.5
+5|345732.2
+3|345843.333333333
+5|345968.4
+6|346047.333333333
+3|346160.666666667
+4|346256.25
+4|346351.75
+2|346441.0
+7|346543.0
+13|346645.307692308
+6|346752.333333333
+4|346845.75
+7|346943.714285714
+3|347079.333333333
+3|347138.0
+7|347267.714285714
+1|347309.0
+4|347428.25
+4|347561.0
+3|347638.0
+2|347787.5
+2|347858.5
+1|347995.0
+3|348041.333333333
+11|348160.818181818
+8|348230.0
+3|348383.0
+6|348447.666666667
+4|348526.5
+3|348644.333333333
+5|348734.2
+6|348855.5
+3|348947.666666667
+4|349060.75
+5|349151.8
+5|349235.2
+5|349345.2
+5|349430.6
+7|349539.857142857
+7|349634.428571429
+4|349767.5
+3|349830.0
+2|349947.5
+6|350064.666666667
+6|350136.0
+5|350250.0
+5|350337.0
+8|350464.0
+3|350576.333333333
+4|350631.0
+3|350774.333333333
+9|350865.222222222
+2|350964.5
+4|351024.75
+9|351138.222222222
+6|351247.166666667
+7|351361.857142857
+10|351441.3
+6|351566.666666667
+13|351651.692307692
+4|351738.75
+3|351825.0
+9|351944.666666667
+3|352065.666666667
+5|352131.2
+2|352265.0
+4|352356.0
+2|352420.5
+4|352552.75
+8|352634.5
+7|352750.142857143
+3|352846.333333333
+7|352939.857142857
+4|353075.75
+5|353148.4
+6|353247.666666667
+8|353348.625
+5|353444.8
+6|353553.833333333
+4|353660.5
+3|353742.333333333
+5|353852.8
+7|353938.571428572
+1|354056.0
+6|354173.5
+4|354249.25
+6|354348.0
+5|354441.0
+7|354548.428571429
+6|354658.833333333
+5|354732.4
+3|354853.666666667
+4|354955.5
+2|355056.5
+9|355158.222222222
+3|355247.666666667
+9|355356.444444445
+2|355481.5
+3|355537.666666667
+8|355667.125
+4|355745.75
+4|355858.25
+6|355954.833333333
+5|356053.8
+2|356178.0
+1|356224.0
+4|356324.75
+3|356409.666666667
+4|356536.75
+7|356640.857142857
+7|356761.0
+6|356872.0
+4|356910.5
+2|357064.5
+7|357146.142857143
+12|357261.583333333
+8|357353.5
+3|357441.0
+5|357543.6
+4|357657.75
+11|357745.454545455
+6|357844.666666667
+4|357969.25
+0|
+2|358160.0
+6|358259.5
+8|358330.625
+8|358457.625
+2|358545.5
+2|358631.5
+5|358763.6
+2|358874.5
+4|358951.25
+2|359041.5
+1|359160.0
+3|359239.666666667
+3|359362.666666667
+6|359445.666666667
+6|359562.166666667
+4|359626.75
+7|359749.428571429
+6|359857.666666667
+4|359930.5
+4|360071.5
+1|360154.0
+3|360252.333333333
+5|360342.6
+4|360451.75
+7|360548.285714286
+4|360631.5
+3|360753.666666667
+7|360850.428571429
+1|360959.0
+3|361079.666666667
+5|361145.8
+5|361253.2
+5|361358.6
+3|361419.0
+6|361550.0
+3|361654.333333333
+3|361732.666666667
+8|361844.25
+5|361965.8
+3|362078.333333333
+6|362145.0
+8|362236.375
+4|362345.75
+5|362464.4
+4|362550.5
+5|362646.0
+3|362724.666666667
+4|362852.75
+6|362939.833333333
+5|363069.8
+6|363154.5
+3|363278.666666667
+5|363331.2
+6|363456.5
+2|363528.0
+8|363655.875
+2|363762.0
+3|363858.0
+6|363930.5
+5|364071.0
+8|364152.0
+6|364253.5
+6|364361.5
+7|364465.0
+3|364528.666666667
+3|364652.0
+4|364759.25
+4|364843.75
+4|364955.5
+6|365037.333333333
+4|365178.25
+2|365250.5
+6|365362.166666667
+9|365453.333333333
+5|365544.2
+9|365648.444444445
+4|365759.25
+6|365851.5
+7|365956.0
+4|366083.25
+2|366185.5
+5|366251.4
+5|366354.4
+5|366452.2
+5|366550.8
+3|366622.0
+3|366740.666666667
+8|366844.625
+5|366950.0
+3|367043.333333333
+2|367124.5
+8|367241.375
+5|367344.8
+3|367462.333333333
+3|367560.0
+5|367638.0
+5|367750.0
+3|367856.333333333
+6|367963.333333333
+6|368071.5
+7|368165.285714286
+1|368274.0
+6|368332.5
+3|368476.0
+8|368550.75
+7|368633.571428572
+2|368765.0
+2|368872.5
+7|368928.571428572
+6|369056.666666667
+7|369139.714285714
+4|369270.0
+2|369385.5
+5|369468.4
+4|369560.25
+6|369645.5
+6|369733.333333333
+5|369835.6
+2|369956.5
+3|370061.666666667
+4|370150.25
+2|370248.0
+3|370355.666666667
+4|370434.75
+7|370569.714285714
+4|370673.25
+4|370748.0
+5|370835.4
+2|370946.0
+6|371036.166666667
+4|371135.75
+2|371278.5
+6|371345.333333333
+7|371445.285714286
+7|371576.714285714
+8|371646.25
+3|371737.666666667
+3|371817.666666667
+3|371927.333333333
+7|372044.571428572
+6|372131.333333333
+16|372247.8125
+4|372354.5
+0|
+1|372560.0
+7|372638.428571429
+5|372750.4
+3|372863.0
+6|372957.333333333
+7|373044.285714286
+7|373126.571428572
+3|373252.333333333
+2|373364.0
+10|373449.0
+4|373523.0
+5|373627.6
+6|373772.0
+6|373835.5
+5|373935.8
+5|374065.0
+4|374139.25
+8|374241.375
+1|374318.0
+11|374448.909090909
+8|374545.75
+5|374657.2
+8|374752.125
+4|374849.75
+5|374981.6
+4|375067.5
+3|375165.0
+5|375264.4
+1|375332.0
+5|375439.6
+7|375551.0
+2|375621.5
+5|375765.2
+4|375844.0
+8|375977.875
+6|376055.0
+3|376158.666666667
+3|376241.333333333
+5|376361.6
+5|376466.6
+5|376555.8
+6|376648.833333333
+5|376745.6
+1|376873.0
+2|376930.5
+5|377042.0
+4|377145.75
+3|377267.666666667
+6|377345.833333333
+4|377441.75
+4|377555.5
+4|377642.0
+8|377751.5
+8|377863.125
+2|377908.0
+4|378053.25
+3|378156.0
+4|378241.75
+5|378329.6
+5|378475.6
+6|378549.0
+3|378655.333333333
+7|378744.857142857
+4|378858.5
+6|378941.5
+7|379057.714285714
+3|379139.666666667
+5|379245.8
+5|379335.6
+8|379438.0
+3|379558.333333333
+2|379642.0
+5|379744.0
+4|379859.5
+4|379954.25
+6|380062.666666667
+4|380159.0
+4|380235.25
+7|380349.714285714
+10|380443.7
+2|380556.5
+2|380632.5
+8|380751.25
+4|380865.75
+7|380959.714285714
+3|381077.0
+11|381158.272727273
+4|381257.75
+5|381355.4
+10|381439.5
+7|381535.0
+2|381671.0
+6|381750.833333333
+5|381836.8
+5|381946.8
+3|382046.666666667
+2|382142.0
+7|382264.285714286
+7|382371.142857143
+5|382457.2
+2|382592.0
+10|382641.9
+5|382733.8
+2|382830.0
+8|382973.25
+7|383060.0
+7|383149.571428572
+2|383245.5
+7|383356.571428572
+5|383459.0
+4|383570.5
+2|383660.0
+5|383722.6
+6|383859.166666667
+7|383924.571428572
+5|384046.8
+8|384166.375
+3|384271.666666667
+4|384332.5
+5|384436.8
+4|384565.5
+3|384631.666666667
+9|384739.777777778
+4|384852.25
+7|384950.857142857
+3|385044.333333333
+4|385158.5
+3|385250.666666667
+7|385345.714285714
+10|385457.2
+4|385541.0
+7|385649.571428572
+2|385729.5
+7|385845.714285714
+6|385960.0
+6|386039.0
+5|386141.0
+4|386244.25
+10|386337.8
+3|386483.666666667
+5|386540.2
+5|386621.6
+10|386744.0
+3|386844.666666667
+2|386946.0
+6|387045.5
+7|387163.857142857
+8|387264.0
+3|387348.666666667
+8|387456.875
+7|387544.428571429
+5|387666.0
+2|387729.5
+6|387847.666666667
+5|387961.2
+5|388048.0
+8|388165.75
+4|388254.0
+6|388360.333333333
+8|388454.75
+6|388546.0
+4|388623.25
+6|388736.666666667
+1|388861.0
+10|388943.5
+3|389052.333333333
+4|389146.0
+5|389240.2
+4|389330.75
+7|389444.285714286
+5|389535.6
+4|389646.75
+9|389745.333333333
+7|389840.285714286
+4|389937.5
+5|390049.6
+8|390126.875
+8|390268.0
+3|390331.666666667
+6|390449.0
+4|390587.0
+2|390683.0
+5|390753.0
+4|390840.0
+4|390957.5
+10|391058.1
+4|391169.25
+10|391250.4
+7|391338.571428572
+6|391424.0
+3|391524.666666667
+6|391639.5
+7|391752.857142857
+9|391854.888888889
+6|391934.833333333
+7|392053.428571429
+10|392158.3
+8|392270.0
+3|392360.666666667
+8|392459.75
+5|392552.2
+3|392646.666666667
+5|392739.0
+8|392845.375
+1|392915.0
+3|393053.666666667
+3|393136.333333333
+6|393259.5
+6|393353.333333333
+4|393445.25
+0|
+4|393663.5
+10|393742.2
+7|393854.142857143
+4|393944.75
+9|394047.444444445
+6|394159.0
+1|394215.0
+4|394368.0
+2|394445.5
+3|394573.666666667
+5|394642.2
+3|394765.0
+2|394879.0
+4|394959.0
+4|395055.0
+6|395146.833333333
+7|395272.142857143
+5|395339.6
+3|395450.666666667
+6|395545.0
+4|395636.75
+3|395739.0
+6|395847.833333333
+5|395955.0
+3|396042.333333333
+5|396136.8
+10|396235.2
+4|396342.5
+6|396433.666666667
+6|396541.5
+5|396629.2
+5|396760.4
+4|396872.25
+8|396949.25
+5|397056.8
+5|397142.8
+9|397234.333333333
+3|397385.0
+3|397485.666666667
+4|397541.75
+4|397664.25
+5|397761.8
+4|397859.75
+4|397952.75
+6|398047.666666667
+3|398140.666666667
+4|398259.25
+6|398341.5
+5|398460.6
+5|398560.6
+2|398674.5
+6|398760.5
+4|398825.5
+6|398944.833333333
+4|399031.75
+7|399148.285714286
+10|399262.8
+6|399323.666666667
+5|399448.2
+4|399554.0
+2|399693.0
+6|399752.5
+1|399885.0
+5|399955.8
+4|400030.0
+7|400148.142857143
+4|400259.5
+3|400382.333333333
+4|400440.25
+5|400559.2
+8|400653.5
+5|400767.4
+9|400849.0
+11|400943.909090909
+7|401041.857142857
+3|401137.0
+3|401276.666666667
+7|401335.428571429
+6|401457.666666667
+1|401552.0
+3|401616.0
+6|401744.833333333
+6|401873.666666667
+2|401954.5
+9|402046.444444445
+7|402144.857142857
+2|402239.0
+5|402321.4
+3|402454.333333333
+7|402545.0
+2|402637.0
+4|402744.25
+3|402861.666666667
+10|402939.6
+3|403025.333333333
+1|403177.0
+6|403250.833333333
+3|403367.666666667
+6|403464.0
+2|403565.0
+3|403639.0
+6|403748.833333333
+6|403847.833333333
+4|403935.5
+8|404055.5
+3|404156.666666667
+6|404243.5
+6|404344.0
+6|404452.666666667
+3|404540.666666667
+5|404669.0
+3|404758.0
+2|404876.0
+5|404936.8
+5|405067.2
+6|405145.666666667
+10|405249.6
+8|405362.25
+7|405455.714285714
+4|405565.25
+5|405643.6
+4|405764.0
+4|405835.75
+3|405927.0
+6|406034.666666667
+4|406134.25
+5|406242.6
+2|406331.0
+5|406447.4
+5|406575.0
+9|406640.888888889
+2|406773.0
+5|406846.6
+8|406965.875
+3|407066.666666667
+7|407142.285714286
+7|407250.428571429
+6|407341.0
+2|407424.5
+7|407545.428571429
+7|407659.142857143
+3|407737.333333333
+4|407865.75
+5|407954.4
+6|408026.833333333
+2|408143.5
+5|408251.4
+7|408355.857142857
+4|408465.25
+8|408536.125
+2|408671.5
+5|408747.4
+6|408862.0
+5|408949.4
+6|409034.166666667
+4|409147.75
+3|409237.0
+6|409347.333333333
+6|409466.833333333
+5|409563.8
+5|409651.6
+7|409767.857142857
+3|409833.333333333
+4|409946.25
+12|410060.166666667
+3|410159.333333333
+3|410245.333333333
+5|410339.6
+6|410450.666666667
+5|410540.6
+5|410641.6
+3|410742.666666667
+7|410839.285714286
+3|410949.666666667
+8|411039.25
+4|411166.0
+4|411267.0
+2|411380.0
+6|411444.5
+7|411548.0
+7|411635.714285714
+7|411744.714285714
+4|411849.5
+5|411930.0
+7|412058.571428572
+5|412123.6
+6|412255.333333333
+2|412341.0
+5|412470.2
+3|412551.666666667
+5|412674.8
+3|412782.666666667
+5|412869.8
+8|412954.125
+7|413044.714285714
+3|413126.0
+1|413239.0
+2|413369.5
+3|413421.666666667
+4|413560.0
+5|413658.0
+0|
+4|413826.25
+8|413942.625
+4|414050.5
+3|414154.333333333
+5|414219.0
+5|414376.6
+4|414435.5
+9|414538.555555556
+3|414655.333333333
+6|414747.166666667
+5|414843.2
+7|414966.0
+4|415058.0
+4|415160.0
+3|415228.0
+10|415344.9
+3|415420.0
+7|415550.571428572
+2|415679.5
+6|415745.0
+5|415873.8
+4|415959.5
+5|416071.6
+8|416141.0
+5|416229.2
+3|416357.666666667
+4|416455.75
+7|416539.428571429
+10|416643.6
+2|416783.5
+2|416814.5
+4|416945.75
+2|417061.5
+6|417164.0
+6|417255.5
+5|417361.8
+5|417456.4
+8|417539.125
+3|417671.333333333
+2|417790.5
+1|417804.0
+4|417949.75
+4|418063.0
+4|418148.0
+4|418259.75
+7|418354.571428572
+5|418436.6
+3|418558.333333333
+3|418652.0
+6|418761.5
+3|418851.0
+6|418950.333333333
+2|419037.0
+5|419144.4
+6|419240.833333333
+7|419357.0
+5|419439.4
+6|419553.166666667
+6|419656.166666667
+4|419789.0
+2|419892.0
+5|419929.2
+0|
+1|420147.0
+1|420211.0
+7|420325.428571429
+4|420433.0
+4|420568.25
+3|420694.0
+1|420729.0
+5|420866.2
+4|420952.25
+5|421047.8
+8|421143.5
+4|421241.75
+4|421347.25
+7|421458.142857143
+3|421564.666666667
+7|421673.0
+4|421745.0
+6|421835.333333333
+5|421930.2
+7|422056.428571429
+2|422102.5
+5|422237.0
+5|422365.8
+3|422418.666666667
+2|422505.0
+3|422637.0
+4|422765.25
+5|422841.4
+2|422939.5
+7|423035.0
+4|423159.0
+5|423244.6
+5|423369.4
+6|423450.0
+7|423547.0
+9|423647.111111111
+7|423740.428571429
+7|423855.714285714
+8|423948.5
+6|424055.0
+4|424175.75
+6|424259.833333333
+7|424352.571428572
+0|
+4|424552.25
+3|424671.0
+4|424736.5
+4|424865.5
+11|424951.818181818
+6|425051.0
+6|425139.5
+4|425259.75
+3|425328.666666667
+7|425457.714285714
+6|425542.166666667
+3|425652.333333333
+5|425759.2
+3|425830.333333333
+6|425949.833333333
+3|426060.333333333
+5|426153.0
+4|426265.75
+10|426334.7
+5|426468.0
+4|426556.75
+5|426658.4
+1|426743.0
+6|426832.5
+4|426948.0
+6|427018.0
+6|427149.833333333
+9|427260.222222222
+4|427332.25
+4|427439.0
+3|427534.0
+6|427630.0
+5|427741.0
+5|427839.8
+4|427928.75
+5|428043.2
+5|428147.8
+9|428249.777777778
+2|428341.0
+5|428450.6
+6|428558.333333333
+2|428638.0
+2|428732.5
+3|428839.0
+3|428977.333333333
+5|429033.4
+8|429144.75
+7|429236.0
+9|429360.0
+3|429446.333333333
+8|429555.25
+5|429646.2
+5|429766.0
+11|429850.272727273
+3|429935.333333333
+7|430050.571428572
+3|430133.666666667
+8|430244.375
+7|430343.0
+7|430440.714285714
+4|430566.75
+4|430635.25
+10|430733.5
+3|430847.333333333
+3|430945.0
+5|431073.6
+5|431166.4
+2|431297.0
+6|431350.166666667
+5|431466.6
+3|431564.333333333
+4|431662.5
+8|431747.75
+7|431859.714285714
+6|431951.166666667
+6|432035.5
+5|432143.0
+5|432252.2
+6|432332.0
+3|432459.666666667
+5|432554.6
+4|432653.5
+8|432758.875
+6|432839.833333333
+5|432954.4
+5|433049.2
+9|433155.0
+6|433248.5
+7|433349.714285714
+4|433433.0
+8|433544.25
+7|433636.0
+3|433733.333333333
+7|433850.714285714
+6|433955.166666667
+3|434080.666666667
+1|434119.0
+1|434263.0
+6|434366.833333333
+7|434464.0
+6|434531.666666667
+5|434646.0
+2|434749.5
+5|434849.6
+5|434936.8
+5|435058.4
+9|435151.111111111
+8|435248.125
+6|435378.833333333
+4|435444.0
+4|435563.75
+6|435631.5
+5|435748.4
+3|435878.0
+6|435934.666666667
+7|436018.571428572
+6|436158.833333333
+8|436247.375
+6|436364.0
+2|436475.0
+4|436558.0
+7|436655.0
+2|436761.5
+0|
+4|436942.75
+8|437051.5
+7|437134.857142857
+3|437267.666666667
+6|437361.666666667
+4|437475.75
+8|437553.0
+7|437642.285714286
+3|437763.333333333
+9|437849.444444445
+7|437951.142857143
+5|438041.8
+3|438162.333333333
+4|438235.0
+8|438343.5
+4|438446.75
+4|438543.25
+2|438622.0
+3|438749.666666667
+3|438867.0
+6|438951.666666667
+7|439036.428571429
+5|439148.0
+5|439242.0
+2|439352.5
+5|439443.6
+5|439526.4
+3|439668.666666667
+7|439762.428571429
+5|439836.4
+2|439913.5
+1|440058.0
+1|440139.0
+3|440225.666666667
+6|440342.5
+2|440483.0
+3|440553.333333333
+1|440605.0
+9|440760.222222222
+4|440865.75
+8|440952.375
+6|441046.666666667
+6|441145.5
+6|441261.666666667
+4|441355.0
+4|441433.25
+3|441577.0
+9|441652.0
+3|441743.333333333
+4|441850.5
+4|441917.0
+5|442038.8
+4|442161.0
+2|442260.0
+1|442363.0
+4|442416.5
+8|442543.125
+7|442619.571428572
+5|442752.0
+4|442830.5
+7|442962.0
+6|443064.0
+2|443181.0
+2|443277.0
+6|443346.666666667
+4|443439.5
+5|443554.6
+3|443637.666666667
+7|443743.714285714
+8|443866.875
+6|443931.0
+6|444051.833333333
+5|444157.6
+5|444238.4
+11|444336.454545455
+5|444451.4
+8|444541.125
+2|444625.5
+5|444760.0
+5|444818.0
+4|444945.0
+1|445049.0
+7|445155.857142857
+7|445237.714285714
+4|445329.0
+4|445452.75
+7|445539.0
+9|445633.222222222
+3|445756.0
+5|445861.4
+5|445968.0
+4|446071.75
+2|446108.5
+6|446246.666666667
+3|446364.666666667
+3|446466.0
+4|446556.25
+6|446647.5
+4|446751.5
+6|446838.333333333
+4|446944.0
+7|447031.0
+4|447145.0
+4|447234.5
+7|447326.142857143
+4|447446.25
+8|447537.75
+4|447656.75
+8|447748.625
+9|447850.888888889
+3|447971.333333333
+4|448023.0
+8|448165.625
+3|448265.666666667
+0|
+4|448457.25
+4|448523.5
+9|448654.555555556
+7|448750.142857143
+3|448853.666666667
+7|448935.571428572
+6|449053.0
+5|449135.4
+3|449234.0
+4|449343.0
+4|449421.75
+4|449548.25
+11|449656.727272727
+4|449742.75
+3|449882.666666667
+5|449951.4
+8|450039.375
+8|450157.5
+10|450242.0
+6|450364.0
+8|450458.125
+4|450532.5
+2|450638.0
+1|450710.0
+4|450867.0
+5|450955.8
+2|451043.0
+5|451142.4
+4|451222.75
+6|451346.0
+5|451442.4
+6|451557.333333333
+3|451646.0
+4|451756.75
+5|451834.2
+5|451948.0
+4|452064.75
+9|452146.222222222
+3|452288.0
+2|452387.5
+3|452449.666666667
+5|452553.2
+5|452637.0
+6|452761.333333333
+7|452853.571428572
+6|452966.333333333
+2|453054.5
+2|453149.5
+7|453243.285714286
+6|453348.333333333
+4|453453.0
+4|453533.25
+5|453653.4
+5|453759.4
+7|453871.428571429
+5|453931.4
+7|454050.857142857
+7|454147.428571429
+9|454262.333333333
+2|454331.0
+7|454460.428571429
+6|454564.666666667
+3|454656.666666667
+4|454739.0
+2|454838.5
+5|454959.2
+5|455048.2
+0|
+3|455257.0
+10|455362.4
+5|455443.4
+5|455538.0
+7|455631.428571429
+4|455724.0
+3|455855.333333333
+1|455931.0
+5|456044.4
+7|456138.714285714
+4|456266.0
+7|456348.142857143
+4|456452.5
+5|456540.6
+6|456666.5
+6|456751.333333333
+3|456849.666666667
+1|456962.0
+4|457070.75
+7|457136.285714286
+1|457256.0
+8|457346.75
+0|
+3|457552.333333333
+4|457675.5
+11|457739.545454546
+5|457848.2
+8|457940.375
+4|458069.0
+4|458160.25
+6|458231.0
+2|458375.5
+6|458448.166666667
+7|458544.714285714
+4|458662.75
+5|458738.2
+8|458840.125
+3|458967.333333333
+3|459021.333333333
+6|459134.166666667
+10|459244.3
+7|459345.714285714
+8|459438.0
+4|459548.0
+7|459642.714285714
+7|459769.0
+4|459843.5
+4|459945.75
+3|460078.666666667
+5|460144.4
+4|460250.75
+2|460302.0
+6|460451.0
+6|460533.5
+3|460657.0
+3|460744.333333333
+2|460839.0
+2|460986.5
+3|461048.333333333
+4|461146.0
+5|461266.2
+6|461372.0
+8|461466.5
+6|461541.166666667
+4|461668.25
+5|461749.2
+5|461858.8
+7|461949.142857143
+5|462038.0
+2|462145.0
+4|462236.0
+2|462338.5
+5|462441.4
+3|462551.666666667
+2|462657.0
+4|462760.0
+6|462851.666666667
+1|462979.0
+3|463030.333333333
+2|463120.5
+5|463265.2
+6|463345.666666667
+4|463446.75
+7|463567.571428572
+5|463650.6
+3|463715.0
+4|463864.75
+5|463941.8
+3|464055.333333333
+7|464156.142857143
+6|464273.166666667
+5|464366.4
+3|464453.333333333
+7|464540.428571429
+6|464632.166666667
+5|464762.6
+8|464848.75
+6|464961.166666667
+3|465058.333333333
+9|465140.555555556
+8|465245.75
+4|465338.5
+4|465443.25
+7|465546.857142857
+4|465647.0
+4|465737.75
+6|465857.166666667
+7|465958.428571429
+4|466062.5
+5|466146.8
+5|466236.8
+7|466327.714285714
+6|466446.833333333
+6|466551.166666667
+8|466641.0
+3|466745.333333333
+2|466860.5
+9|466960.888888889
+3|467037.666666667
+6|467133.333333333
+4|467261.0
+7|467349.428571429
+8|467440.5
+8|467556.875
+6|467669.333333333
+9|467765.666666667
+4|467857.75
+8|467954.375
+3|468037.0
+6|468149.666666667
+7|468254.428571429
+6|468354.833333333
+4|468462.5
+6|468561.833333333
+4|468654.5
+2|468753.5
+3|468887.333333333
+6|468968.333333333
+3|469034.333333333
+8|469152.625
+3|469214.0
+8|469347.0
+6|469456.0
+11|469564.363636364
+7|469647.142857143
+7|469757.571428572
+5|469837.6
+3|469950.0
+4|470032.75
+2|470167.0
+6|470238.5
+9|470344.444444445
+5|470458.2
+4|470545.25
+5|470644.4
+1|470730.0
+3|470822.0
+2|470977.5
+8|471044.375
+3|471172.0
+4|471256.75
+4|471353.0
+7|471460.571428572
+5|471544.6
+4|471648.0
+2|471726.0
+1|471882.0
+5|471960.2
+5|472075.8
+5|472141.8
+6|472233.166666667
+6|472343.5
+9|472438.333333333
+6|472519.166666667
+6|472651.5
+2|472782.5
+1|472822.0
+6|472944.5
+5|473054.0
+6|473172.5
+4|473244.0
+7|473346.428571429
+4|473481.0
+9|473560.888888889
+3|473649.333333333
+6|473763.0
+3|473858.0
+4|473945.5
+5|474034.4
+5|474136.6
+5|474222.4
+5|474351.4
+4|474422.25
+3|474543.333333333
+5|474650.4
+4|474747.5
+3|474862.333333333
+5|474936.0
+4|475065.0
+6|475143.833333333
+5|475253.4
+4|475346.0
+5|475474.8
+3|475515.666666667
+4|475638.75
+4|475741.25
+5|475851.8
+2|475909.5
+5|476051.8
+6|476120.166666667
+5|476259.0
+3|476355.666666667
+6|476440.833333333
+5|476589.2
+4|476660.25
+4|476768.5
+6|476858.666666667
+4|476952.0
+6|477056.5
+9|477170.222222222
+7|477256.285714286
+4|477347.75
+5|477448.8
+6|477529.833333333
+4|477662.0
+6|477743.666666667
+2|477890.5
+3|477931.666666667
+4|478070.75
+4|478167.0
+11|478246.909090909
+3|478359.666666667
+5|478445.8
+2|478538.0
+5|478650.8
+9|478753.111111111
+1|478890.0
+6|478957.0
+4|479060.75
+5|479143.0
+5|479237.6
+5|479362.0
+8|479438.625
+1|479562.0
+4|479641.25
+8|479749.25
+5|479831.0
+5|479930.0
+2|480045.5
+4|480144.75
+6|480272.5
+3|480348.333333333
+2|480477.5
+3|480538.666666667
+5|480651.8
+6|480751.5
+6|480850.666666667
+7|480957.142857143
+5|481069.0
+4|481148.5
+2|481262.0
+6|481352.666666667
+7|481452.714285714
+6|481549.333333333
+5|481633.0
+3|481756.0
+4|481843.5
+1|481919.0
+4|482040.75
+2|482154.0
+0|
+6|482345.333333333
+5|482432.0
+5|482537.2
+9|482652.111111111
+1|482761.0
+8|482850.5
+3|482935.333333333
+7|483059.571428572
+3|483150.333333333
+5|483243.4
+8|483332.875
+3|483436.0
+4|483543.25
+5|483664.8
+14|483752.571428572
+3|483841.333333333
+4|483957.75
+5|484039.0
+5|484166.2
+6|484244.5
+5|484352.8
+5|484442.4
+6|484543.5
+7|484644.428571429
+4|484753.75
+7|484848.428571429
+5|484945.0
+2|485019.0
+3|485138.333333333
+9|485246.555555556
+1|485397.0
+1|485459.0
+5|485554.2
+5|485650.4
+6|485747.0
+7|485850.714285714
+5|485971.2
+3|486054.333333333
+6|486147.666666667
+6|486247.0
+6|486335.666666667
+3|486467.666666667
+5|486583.4
+4|486656.5
+4|486773.0
+6|486849.333333333
+4|486952.5
+6|487058.5
+3|487125.666666667
+3|487239.666666667
+11|487352.181818182
+3|487424.333333333
+4|487530.25
+6|487666.666666667
+4|487740.75
+6|487871.333333333
+2|487965.0
+6|488066.833333333
+7|488143.142857143
+4|488268.5
+4|488368.25
+0|
+6|488551.666666667
+1|488622.0
+5|488748.6
+5|488835.6
+4|488944.75
+7|489046.142857143
+5|489138.4
+3|489263.0
+8|489336.875
+7|489441.571428572
+2|489527.0
+4|489654.75
+5|489748.0
+3|489869.333333333
+2|489959.0
+8|490060.875
+6|490184.666666667
+3|490238.333333333
+4|490324.25
+6|490455.333333333
+8|490562.375
+7|490655.285714286
+5|490750.6
+6|490857.5
+6|490956.333333333
+10|491061.5
+4|491120.5
+4|491235.25
+3|491352.333333333
+4|491443.25
+6|491536.0
+3|491654.0
+5|491763.6
+5|491869.2
+9|491951.111111111
+3|492036.333333333
+6|492148.166666667
+4|492232.75
+8|492341.25
+9|492437.0
+7|492551.142857143
+4|492635.0
+9|492743.0
+5|492866.2
+7|492925.571428572
+5|493053.0
+6|493151.666666667
+4|493252.5
+6|493359.0
+4|493474.75
+3|493542.0
+8|493653.125
+7|493747.428571429
+7|493877.285714286
+10|493959.7
+6|494049.333333333
+12|494147.0
+5|494253.0
+4|494331.75
+5|494440.2
+4|494554.5
+6|494637.333333333
+7|494754.285714286
+11|494836.181818182
+7|494955.142857143
+0|
+9|495132.444444445
+6|495269.333333333
+1|495308.0
+4|495454.0
+4|495547.5
+4|495638.5
+4|495773.5
+8|495849.0
+11|495956.545454546
+5|496070.8
+6|496148.333333333
+6|496234.333333333
+8|496373.0
+8|496448.375
+1|496587.0
+6|496647.333333333
+3|496758.0
+9|496839.777777778
+5|496936.4
+1|497030.0
+8|497145.25
+6|497231.0
+8|497371.125
+4|497431.0
+4|497535.25
+9|497654.0
+8|497752.75
+6|497853.166666667
+1|497990.0
+3|498018.666666667
+4|498164.5
+1|498244.0
+4|498351.75
+8|498438.125
+5|498559.8
+4|498658.25
+6|498755.333333333
+1|498891.0
+4|498955.5
+1|499025.0
+11|499141.818181818
+4|499262.25
+10|499360.4
+5|499464.2
+8|499541.0
+3|499656.666666667
+3|499776.333333333
+1|499830.0
+9|499965.555555556
+exit 0
Added: test-suite/trunk/MultiSource/Applications/sqlite3/sqlite3.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/sqlite3/sqlite3.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/sqlite3/sqlite3.reference_output.small (added)
+++ test-suite/trunk/MultiSource/Applications/sqlite3/sqlite3.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,521 @@
+9|445.333333333333
+7|567.0
+7|714.285714285714
+6|783.833333333333
+6|783.833333333333
+6|960.5
+6|960.5
+7|1190.85714285714
+6|1258.33333333333
+4|1472.5
+994|207059.187122736
+1011|251093.65578635
+1017|287117.761061947
+998|323619.903807615
+686|244428.944606414
+995|249975.440201005
+1018|249374.089390963
+1039|255383.95572666
+1022|258354.545988258
+49|215260.244897959
+2|19.5
+1|137.0
+1|297.0
+0|
+1|439.0
+0|
+1|650.0
+1|786.0
+2|830.0
+0|
+0|
+1|1168.0
+0|
+0|
+1|1499.0
+0|
+2|1611.5
+0|
+0|
+1|1909.0
+0|
+2|2113.5
+0|
+1|2388.0
+1|2407.0
+1|2590.0
+0|
+1|2794.0
+0|
+0|
+1|3039.0
+1|3170.0
+1|3278.0
+0|
+1|3480.0
+1|3503.0
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+1|4673.0
+1|4782.0
+1|4803.0
+0|
+0|
+0|
+0|
+0|
+0|
+1|5571.0
+1|5658.0
+2|5777.0
+0|
+0|
+0|
+1|6181.0
+1|6230.0
+0|
+0|
+1|6571.0
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+1|7475.0
+0|
+0|
+0|
+0|
+0|
+1|8037.0
+0|
+0|
+0|
+0|
+0|
+1|8613.0
+1|8758.0
+1|8892.0
+1|8972.0
+0|
+1|9125.0
+0|
+0|
+1|9458.0
+1|9546.0
+0|
+0|
+0|
+0|
+0|
+0|
+2|10215.0
+0|
+0|
+0|
+0|
+0|
+2|10855.0
+0|
+2|11062.5
+1|11125.0
+3|11236.6666666667
+2|11381.0
+0|
+0|
+0|
+1|11737.0
+0|
+1|11930.0
+1|12083.0
+2|12158.5
+0|
+1|12384.0
+1|12496.0
+0|
+0|
+0|
+0|
+0|
+1|13000.0
+1|13169.0
+0|
+0|
+1|13438.0
+0|
+0|
+0|
+0|
+1|13900.0
+0|
+1|14187.0
+0|
+0|
+0|
+2|14545.0
+1|14677.0
+0|
+1|14817.0
+0|
+1|15020.0
+1|15189.0
+0|
+0|
+0|
+2|15551.0
+1|15627.0
+1|15701.0
+2|15823.5
+1|15919.0
+0|
+2|16151.5
+0|
+0|
+1|16478.0
+3|16521.6666666667
+0|
+0|
+0|
+0|
+0|
+1|17121.0
+0|
+1|17334.0
+1|17485.0
+1|17529.0
+0|
+1|17793.0
+0|
+0|
+0|
+1|18183.0
+0|
+0|
+0|
+0|
+0|
+1|18745.0
+1|18841.0
+0|
+0|
+0|
+0|
+1|19329.0
+0|
+0|
+0|
+0|
+2|19852.5
+0|
+0|
+0|
+0|
+0|
+0|
+1|20537.0
+1|20653.0
+1|20710.0
+1|20801.0
+1|20942.0
+0|
+0|
+0|
+0|
+0|
+1|21579.0
+0|
+3|21739.0
+0|
+0|
+0|
+1|22187.0
+0|
+1|22331.0
+0|
+0|
+1|22670.0
+1|22760.0
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+1|23593.0
+1|23626.0
+0|
+1|23819.0
+0|
+0|
+1|24132.0
+0|
+1|24348.0
+0|
+0|
+0|
+0|
+0|
+0|
+1|25021.0
+1|25196.0
+2|25243.0
+1|25301.0
+0|
+1|25588.0
+0|
+0|
+1|25808.0
+2|25951.5
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+1|26788.0
+3|26862.0
+0|
+0|
+1|27148.0
+0|
+0|
+1|27404.0
+0|
+1|27639.0
+0|
+1|27803.0
+0|
+1|28067.0
+0|
+1|28220.0
+0|
+0|
+0|
+0|
+1|28737.0
+1|28861.0
+0|
+0|
+1|29181.0
+0|
+0|
+0|
+3|29570.3333333333
+1|29673.0
+1|29753.0
+0|
+1|29979.0
+1|30071.0
+2|30125.5
+1|30214.0
+0|
+0|
+0|
+0|
+0|
+2|30869.0
+0|
+0|
+0|
+0|
+0|
+1|31443.0
+2|31531.5
+0|
+0|
+0|
+1|31901.0
+0|
+0|
+1|32266.0
+1|32316.0
+0|
+1|32596.0
+2|32645.5
+0|
+0|
+0|
+0|
+1|33145.0
+0|
+0|
+1|33424.0
+0|
+0|
+0|
+0|
+0|
+0|
+1|34131.0
+0|
+0|
+0|
+0|
+1|34683.0
+0|
+0|
+0|
+0|
+1|35167.0
+0|
+1|35317.0
+1|35475.0
+1|35531.0
+0|
+0|
+1|35818.0
+1|35990.0
+0|
+0|
+0|
+1|36317.0
+2|36430.5
+2|36555.0
+0|
+1|36755.0
+1|36856.0
+1|36925.0
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+1|38410.0
+0|
+2|38644.5
+1|38768.0
+0|
+0|
+0|
+2|39119.0
+0|
+0|
+1|39470.0
+0|
+0|
+0|
+0|
+1|39958.0
+0|
+2|40168.5
+0|
+1|40327.0
+0|
+2|40516.0
+1|40663.0
+1|40797.0
+1|40868.0
+0|
+0|
+3|41181.6666666667
+2|41275.5
+0|
+0|
+1|41542.0
+0|
+0|
+0|
+0|
+0|
+1|42119.0
+0|
+1|42386.0
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+1|43302.0
+1|43406.0
+0|
+0|
+0|
+0|
+1|43959.0
+0|
+0|
+0|
+1|44337.0
+2|44449.5
+0|
+0|
+0|
+0|
+1|44926.0
+0|
+0|
+0|
+1|45372.0
+1|45495.0
+0|
+0|
+1|45766.0
+1|45872.0
+2|45910.0
+1|46086.0
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+1|46821.0
+0|
+1|47000.0
+0|
+1|47274.0
+0|
+0|
+0|
+0|
+0|
+0|
+0|
+1|48003.0
+0|
+2|48241.5
+0|
+2|48435.0
+1|48581.0
+0|
+1|48716.0
+0|
+0|
+0|
+0|
+0|
+0|
+1|49428.0
+1|49587.0
+0|
+1|49774.0
+0|
+1|49932.0
+exit 0
Added: test-suite/trunk/MultiSource/Applications/treecc/treecc.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/treecc/treecc.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/treecc/treecc.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/treecc/treecc.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1 @@
+exit 0
Added: test-suite/trunk/MultiSource/Applications/viterbi/viterbi.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/viterbi/viterbi.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/viterbi/viterbi.reference_output (added)
+++ test-suite/trunk/MultiSource/Applications/viterbi/viterbi.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,51 @@
+Opened file Dist_demux for matrix reading
+1.69071e-10
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux for matrix reading
+1.69071e-10
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux for matrix reading
+1.69071e-10
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux for matrix reading
+1.69071e-10
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux for matrix reading
+1.69071e-10
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux for matrix reading
+1.69071e-10
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux for matrix reading
+1.69071e-10
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux for matrix reading
+1.69071e-10
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux for matrix reading
+1.69071e-10
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux for matrix reading
+1.69071e-10
+File read and closed
+Starting Viterbi
+Viterbi finished
+exit 0
Added: test-suite/trunk/MultiSource/Applications/viterbi/viterbi.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Applications/viterbi/viterbi.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Applications/viterbi/viterbi.reference_output.small (added)
+++ test-suite/trunk/MultiSource/Applications/viterbi/viterbi.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,51 @@
+Opened file Dist_demux_small for matrix reading
+1.00008
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux_small for matrix reading
+1.00008
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux_small for matrix reading
+1.00008
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux_small for matrix reading
+1.00008
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux_small for matrix reading
+1.00008
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux_small for matrix reading
+1.00008
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux_small for matrix reading
+1.00008
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux_small for matrix reading
+1.00008
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux_small for matrix reading
+1.00008
+File read and closed
+Starting Viterbi
+Viterbi finished
+Opened file Dist_demux_small for matrix reading
+1.00008
+File read and closed
+Starting Viterbi
+Viterbi finished
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/ASCI_Purple/SMG2000/smg2000.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/ASCI_Purple/SMG2000/smg2000.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/ASCI_Purple/SMG2000/smg2000.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/ASCI_Purple/SMG2000/smg2000.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,67 @@
+Running with these driver parameters:
+ (nx, ny, nz) = (100, 40, 100)
+ (Px, Py, Pz) = (1, 1, 1)
+ (bx, by, bz) = (1, 1, 1)
+ (cx, cy, cz) = (0.100000, 1.000000, 10.000000)
+ (n_pre, n_post) = (1, 1)
+ dim = 3
+ solver ID = 0
+=============================================
+Struct Interface:
+=============================================
+Struct Interface:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+=============================================
+Setup phase times:
+=============================================
+SMG Setup:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SMG:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SMGRelax:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SMGResidual:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+CyclicReduction:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SemiInterp:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SemiRestrict:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+=============================================
+Solve phase times:
+=============================================
+SMG Solve:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SMG:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SMGRelax:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SMGResidual:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+CyclicReduction:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SemiInterp:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SemiRestrict:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+
+Iterations = 7
+Final Relative Residual Norm = 1.101113e-07
+
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/ASCI_Purple/SMG2000/smg2000.reference_output.small
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/ASCI_Purple/SMG2000/smg2000.reference_output.small?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/ASCI_Purple/SMG2000/smg2000.reference_output.small (added)
+++ test-suite/trunk/MultiSource/Benchmarks/ASCI_Purple/SMG2000/smg2000.reference_output.small Mon May 31 03:17:08 2010
@@ -0,0 +1,67 @@
+Running with these driver parameters:
+ (nx, ny, nz) = (30, 15, 30)
+ (Px, Py, Pz) = (1, 1, 1)
+ (bx, by, bz) = (1, 1, 1)
+ (cx, cy, cz) = (0.100000, 1.000000, 10.000000)
+ (n_pre, n_post) = (1, 1)
+ dim = 3
+ solver ID = 0
+=============================================
+Struct Interface:
+=============================================
+Struct Interface:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+=============================================
+Setup phase times:
+=============================================
+SMG Setup:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SMG:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SMGRelax:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SMGResidual:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+CyclicReduction:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SemiInterp:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SemiRestrict:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+=============================================
+Solve phase times:
+=============================================
+SMG Solve:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SMG:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SMGRelax:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SMGResidual:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+CyclicReduction:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SemiInterp:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+SemiRestrict:
+ wall clock time = 0.000000 seconds
+ cpu clock time = 0.000000 seconds
+
+Iterations = 6
+Final Relative Residual Norm = 8.148859e-08
+
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/ASC_Sequoia/AMGmk/AMGmk.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/ASC_Sequoia/AMGmk/AMGmk.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/ASC_Sequoia/AMGmk/AMGmk.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/ASC_Sequoia/AMGmk/AMGmk.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,25 @@
+
+//------------
+//
+// Sequoia Benchmark Version 1.0
+//
+//------------
+
+//------------
+//
+// MATVEC
+//
+//------------
+
+//------------
+//
+// Relax
+//
+//------------
+
+//------------
+//
+// Axpy
+//
+//------------
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/ASC_Sequoia/CrystalMk/CrystalMk.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/ASC_Sequoia/CrystalMk/CrystalMk.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/ASC_Sequoia/CrystalMk/CrystalMk.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/ASC_Sequoia/CrystalMk/CrystalMk.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,15 @@
+
+Sequoia benchmark version 1.0
+
+***** results
+returnVal = 1.199696
+i = 0 j = 0 dtcdgd[i][j] = 1.529052e-01
+i = 0 j = 4 dtcdgd[i][j] = 1.080000e-02
+i = 0 j = 8 dtcdgd[i][j] = 1.080000e-02
+i = 4 j = 0 dtcdgd[i][j] = 7.586401e-02
+i = 4 j = 4 dtcdgd[i][j] = 1.563261e-01
+i = 4 j = 8 dtcdgd[i][j] = 8.868500e-03
+i = 8 j = 0 dtcdgd[i][j] = 8.109601e-02
+i = 8 j = 4 dtcdgd[i][j] = 6.064326e-02
+i = 8 j = 8 dtcdgd[i][j] = 1.600819e-01
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/ASC_Sequoia/IRSmk/IRSmk.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/ASC_Sequoia/IRSmk/IRSmk.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/ASC_Sequoia/IRSmk/IRSmk.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/ASC_Sequoia/IRSmk/IRSmk.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,22 @@
+
+Sequoia Benchmark Version 1.0
+
+***** input
+kmin = 2 kmax = 27
+jmin = 2 jmax = 27
+imin = 2 imax = 27
+kp = 841 jp = 29
+
+
+***** array bounds
+i_lb = 1742 i_ub = 22647 x_size = 24399
+
+
+***** results
+i = 0 b[i] = 0.000000e+00
+i = 4529 b[i] = 1.111094e+09
+i = 9058 b[i] = 4.437192e+09
+i = 13587 b[i] = 9.978568e+09
+i = 18116 b[i] = 1.773522e+10
+i = 22645 b[i] = 2.770716e+10
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/BitBench/drop3/drop3.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/BitBench/drop3/drop3.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/BitBench/drop3/drop3.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/BitBench/drop3/drop3.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,2 @@
+1006908
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/BitBench/five11/five11.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/BitBench/five11/five11.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/BitBench/five11/five11.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/BitBench/five11/five11.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,2 @@
+2003051
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/BitBench/uudecode/uudecode.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/BitBench/uudecode/uudecode.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/BitBench/uudecode/uudecode.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/BitBench/uudecode/uudecode.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,2 @@
+542623
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/BitBench/uuencode/uuencode.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/BitBench/uuencode/uuencode.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/BitBench/uuencode/uuencode.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/BitBench/uuencode/uuencode.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,2 @@
+9377
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/Bullet/bullet.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/Bullet/bullet.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/Bullet/bullet.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/Bullet/bullet.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,29 @@
+BenchmarkDemo: 3000 fall, Frame: 0
+BenchmarkDemo: 3000 fall, Frame: 25
+BenchmarkDemo: 3000 fall, Frame: 50
+BenchmarkDemo: 3000 fall, Frame: 75
+BenchmarkDemo: 1000 stack, Frame: 0
+BenchmarkDemo: 1000 stack, Frame: 25
+BenchmarkDemo: 1000 stack, Frame: 50
+BenchmarkDemo: 1000 stack, Frame: 75
+BenchmarkDemo: 136 ragdolls, Frame: 0
+BenchmarkDemo: 136 ragdolls, Frame: 25
+BenchmarkDemo: 136 ragdolls, Frame: 50
+BenchmarkDemo: 136 ragdolls, Frame: 75
+BenchmarkDemo: 1000 convex, Frame: 0
+BenchmarkDemo: 1000 convex, Frame: 25
+BenchmarkDemo: 1000 convex, Frame: 50
+BenchmarkDemo: 1000 convex, Frame: 75
+BenchmarkDemo: prim-trimesh, Frame: 0
+BenchmarkDemo: prim-trimesh, Frame: 25
+BenchmarkDemo: prim-trimesh, Frame: 50
+BenchmarkDemo: prim-trimesh, Frame: 75
+BenchmarkDemo: convex-trimesh, Frame: 0
+BenchmarkDemo: convex-trimesh, Frame: 25
+BenchmarkDemo: convex-trimesh, Frame: 50
+BenchmarkDemo: convex-trimesh, Frame: 75
+BenchmarkDemo: raytests, Frame: 0
+BenchmarkDemo: raytests, Frame: 25
+BenchmarkDemo: raytests, Frame: 50
+BenchmarkDemo: raytests, Frame: 75
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/Fhourstones-3.1/fhourstones3.1.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/Fhourstones-3.1/fhourstones3.1.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/Fhourstones-3.1/fhourstones3.1.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/Fhourstones-3.1/fhourstones3.1.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,12 @@
+Fhourstones 3.1 (C)
+Boardsize = 7x6
+Using 8306069 transposition table entries.
+
+Solving 8-ply position after 45461667 . . .
+score = 5 (+) work = 14
+- 0.281 < 0.000 = 0.001 > 0.001 + 0.716
+
+Solving 8-ply position after 35333571 . . .
+score = 1 (-) work = 21
+- 0.271 < 0.036 = 0.020 > 0.089 + 0.584
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/Fhourstones/fhourstones.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/Fhourstones/fhourstones.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/Fhourstones/fhourstones.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/Fhourstones/fhourstones.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,12 @@
+Fhourstones 2.0
+Using 1050011 transposition table entries with 8 probes.
+Solving 9-ply position after 444333377 . . .
+score = -2 (-) work = 22
+7321073 pos / 2 msec = 3660536.5 Kpos/sec
+store rate = 0.697
+- 0.236 < 0.168 = 0.037 > 0.240 + 0.319
+ 422 97347 184228 270877 218810 132097 72059 37601
+ 18645 9200 4460 2230 1034 502 271 121
+ 55 28 11 6 4 2 1 0
+ 0 0 0 0 0 0 0 0
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/FreeBench/analyzer/analyzer.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/FreeBench/analyzer/analyzer.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/FreeBench/analyzer/analyzer.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/FreeBench/analyzer/analyzer.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,15 @@
+Compile date: today
+Compiler switches:
+Num_epochs: 576
+Time for loop: 23035 issues
+Time for program: 23056 issues
+Loop is 99.9 % of program
+OPTIMUM RESTART RESULTS
+Time for speculative loop is 40 issues
+Potential speedup for loop: 576 times
+Potential speedup for program: 378 times
+REALISTIC RESTART RESULTS -- Unlimited amount of CPUs
+Time for speculative loop is 40 issues
+Potential speedup for loop: 576 times
+Potential speedup for program: 378 times
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/FreeBench/distray/distray.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/FreeBench/distray/distray.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/FreeBench/distray/distray.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/FreeBench/distray/distray.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1 @@
+78a70b660bcdf47a8dc16ba0db75ba2a
Added: test-suite/trunk/MultiSource/Benchmarks/FreeBench/fourinarow/fourinarow.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/FreeBench/fourinarow/fourinarow.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/FreeBench/fourinarow/fourinarow.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/FreeBench/fourinarow/fourinarow.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,178 @@
+Compile date: today
+Compiler switches:
+Recursion depth: 7
+Alpha-Beta pruning: on
+Using pruning method 2
+ 0 0 0 0 0 0 0
+5 . . . . . . .
+4 . . . . . . .
+3 . . . . . . .
+2 . . . . . . .
+1 . . . . . . .
+0 . . . . . . .
+ 0 1 2 3 4 5 6
+----------------
+ 0 0 0 1 1 0 0
+5 . . . . . . .
+4 . . . . . . .
+3 . . . . . . .
+2 . . . . . . .
+1 . . . . . . .
+0 . . . x o . .
+ 0 1 2 3 4 5 6
+----------------
+ 0 0 0 2 2 0 0
+5 . . . . . . .
+4 . . . . . . .
+3 . . . . . . .
+2 . . . . . . .
+1 . . . o x . .
+0 . . . x o . .
+ 0 1 2 3 4 5 6
+----------------
+ 0 0 0 3 3 0 0
+5 . . . . . . .
+4 . . . . . . .
+3 . . . . . . .
+2 . . . o x . .
+1 . . . o x . .
+0 . . . x o . .
+ 0 1 2 3 4 5 6
+----------------
+ 0 0 2 3 3 0 0
+5 . . . . . . .
+4 . . . . . . .
+3 . . . . . . .
+2 . . . o x . .
+1 . . x o x . .
+0 . . o x o . .
+ 0 1 2 3 4 5 6
+----------------
+ 0 0 2 5 3 0 0
+5 . . . . . . .
+4 . . . x . . .
+3 . . . o . . .
+2 . . . o x . .
+1 . . x o x . .
+0 . . o x o . .
+ 0 1 2 3 4 5 6
+----------------
+ 1 0 3 5 3 0 0
+5 . . . . . . .
+4 . . . x . . .
+3 . . . o . . .
+2 . . o o x . .
+1 . . x o x . .
+0 x . o x o . .
+ 0 1 2 3 4 5 6
+----------------
+ 2 0 4 5 3 0 0
+5 . . . . . . .
+4 . . . x . . .
+3 . . o o . . .
+2 . . o o x . .
+1 x . x o x . .
+0 x . o x o . .
+ 0 1 2 3 4 5 6
+----------------
+ 3 0 5 5 3 0 0
+5 . . . . . . .
+4 . . o x . . .
+3 . . o o . . .
+2 x . o o x . .
+1 x . x o x . .
+0 x . o x o . .
+ 0 1 2 3 4 5 6
+----------------
+ 4 0 6 5 3 0 0
+5 . . x . . . .
+4 . . o x . . .
+3 o . o o . . .
+2 x . o o x . .
+1 x . x o x . .
+0 x . o x o . .
+ 0 1 2 3 4 5 6
+----------------
+ 4 0 6 5 3 1 1
+5 . . x . . . .
+4 . . o x . . .
+3 o . o o . . .
+2 x . o o x . .
+1 x . x o x . .
+0 x . o x o x o
+ 0 1 2 3 4 5 6
+----------------
+ 4 0 6 5 3 1 3
+5 . . x . . . .
+4 . . o x . . .
+3 o . o o . . .
+2 x . o o x . x
+1 x . x o x . o
+0 x . o x o x o
+ 0 1 2 3 4 5 6
+----------------
+ 4 0 6 5 3 2 4
+5 . . x . . . .
+4 . . o x . . .
+3 o . o o . . o
+2 x . o o x . x
+1 x . x o x x o
+0 x . o x o x o
+ 0 1 2 3 4 5 6
+----------------
+ 4 0 6 5 4 3 4
+5 . . x . . . .
+4 . . o x . . .
+3 o . o o x . o
+2 x . o o x o x
+1 x . x o x x o
+0 x . o x o x o
+ 0 1 2 3 4 5 6
+----------------
+ 5 0 6 5 5 3 4
+5 . . x . . . .
+4 x . o x o . .
+3 o . o o x . o
+2 x . o o x o x
+1 x . x o x x o
+0 x . o x o x o
+ 0 1 2 3 4 5 6
+----------------
+ 5 0 6 5 5 5 4
+5 . . x . . . .
+4 x . o x o x .
+3 o . o o x o o
+2 x . o o x o x
+1 x . x o x x o
+0 x . o x o x o
+ 0 1 2 3 4 5 6
+----------------
+ 6 0 6 5 5 5 5
+5 x . x . . . .
+4 x . o x o x o
+3 o . o o x o o
+2 x . o o x o x
+1 x . x o x x o
+0 x . o x o x o
+ 0 1 2 3 4 5 6
+----------------
+ 6 0 6 6 5 5 6
+5 x . x x . . o
+4 x . o x o x o
+3 o . o o x o o
+2 x . o o x o x
+1 x . x o x x o
+0 x . o x o x o
+ 0 1 2 3 4 5 6
+----------------
+ 6 0 6 6 6 6 6
+5 x . x x x o o
+4 x . o x o x o
+3 o . o o x o o
+2 x . o o x o x
+1 x . x o x x o
+0 x . o x o x o
+ 0 1 2 3 4 5 6
+----------------
+The player is the winner.
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/FreeBench/mason/mason.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/FreeBench/mason/mason.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/FreeBench/mason/mason.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/FreeBench/mason/mason.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,19 @@
+Compile date: today
+Compiler switches:
+Trying 2
+Trying 4
+Trying 6
+Trying 8
+Trying 10
+Trying 12
+Trying 14
+Trying 16
+Trying 18
+Trying 20
+Trying 22
+Trying 24
+Trying 26
+Gul: 0 1 2
+bin+art: 14 15
+02 1021 2121 0201 2121 0202 0120
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/FreeBench/neural/neural.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/FreeBench/neural/neural.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/FreeBench/neural/neural.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/FreeBench/neural/neural.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,19 @@
+Compile date: today
+Compiler switches:
+Matrix size is 20x28
+Vectors read from file!
+Checking hamming distances...
+Generating T matrix...
+Delta learning...
+Store check...
+Pattern 0 stored.
+Pattern 1 stored.
+Pattern 2 stored.
+Pattern 3 stored.
+Pattern 4 stored.
+Pattern 5 stored.
+Pattern 6 stored.
+Pattern 7 stored.
+Pattern 8 stored.
+Pattern 9 stored.
+exit 0
Added: test-suite/trunk/MultiSource/Benchmarks/FreeBench/pcompress2/pcompress2.reference_output
URL: http://llvm.org/viewvc/llvm-project/test-suite/trunk/MultiSource/Benchmarks/FreeBench/pcompress2/pcompress2.reference_output?rev=105213&view=auto
==============================================================================
--- test-suite/trunk/MultiSource/Benchmarks/FreeBench/pcompress2/pcompress2.reference_output (added)
+++ test-suite/trunk/MultiSource/Benchmarks/FreeBench/pcompress2/pcompress2.reference_output Mon May 31 03:17:08 2010
@@ -0,0 +1,23 @@
+Compile date: today
+Compiler switches:
+PI calculation to estimate the FFT benchmarks
+initializing...
+nfft= 16384
+radix= 100000
+calculating 81920 digits of PI...
+AGM iteration
+precision= 40
+precision= 80
+precision= 180
+precision= 340
+precision= 700
+precision= 1400
+precision= 2780
+precision= 5580
+precision= 11160
+precision= 22340
+precision= 44700
+precision= 89400
+3.141592653589793238462643383279502884197169399375105820974944592307816406286208998628034825342117067982148086513282306647093844609550582231725359408128481117450284102701938521105559644622948954930381964428810975665933446128475648233786783165271201909145648566923460348610454326648213393607260249141273724587006606315588174881520920962829254091715364367892590360011330530548820466521384146951941511609433057270365759591953092186117381932611793105118548074462379962749567351885752724891227938183011949129833673362440656643086021394946395224737190702179860943702770539217176293176752384674818467669405132000568127145263560827785771342757789609173637178721468440901224953430146549585371050792279689258923542019956112129021960864034418159813629774771309960518707211349999998372978049951059731732816096318595024459455346908302642522308253344685035261931188171010003137838752886587533208381420617177669147303598253490428755468731159562863882353787593751957781857780532171226806613001927876611195
90921642019893809525720106548586327886593615338182796823030195203530185296899577362259941389124972177528347913151557485724245415069595082953311686172785588907509838175463746493931925506040092770167113900984882401285836160356370766010471018194295559619894676783744944825537977472684710404753464620804668425906949129331367702898915210475216205696602405803815019351125338243003558764024749647326391419927260426992279678235478163600934172164121992458631503028618297455570674983850549458858692699569092721079750930295532116534498720275596023648066549911988183479775356636980742654252786255181841757467289097777279380008164706001614524919217321721477235014144197356854816136115735255213347574184946843852332390739414333454776241686251898356948556209921922218427255025425688767179049460165346680498862723279178608578438382796797668145410095388378636095068006422512520511739298489608412848862694560424196528502221066118630674427862203919494504712371378696095636437191728746776465757396241389086583
26459958133904780275900994657640789512694683983525957098258226205224894077267194782684826014769909026401363944374553050682034962524517493996514314298091906592509372216964615157098583874105978859597729754989301617539284681382686838689427741559918559252459539594310499725246808459872736446958486538367362226260991246080512438843904512441365497627807977156914359977001296160894416948685558484063534220722258284886481584560285060168427394522674676788952521385225499546667278239864565961163548862305774564980355936345681743241125150760694794510965960940252288797108931456691368672287489405601015033086179286809208747609178249385890097149096759852613655497818931297848216829989487226588048575640142704775551323796414515237462343645428584447952658678210511413547357395231134271661021359695362314429524849371871101457654035902799344037420073105785390621983874478084784896833214457138687519435064302184531910484810053706146806749192781911979399520614196634287544406437451237181921799983910159195618
14675142691239748940907186494231961567945208095146550225231603881930142093762137855956638937787083039069792077346722182562599661501421503068038447734549202605414665925201497442850732518666002132434088190710486331734649651453905796268561005508106658796998163574736384052571459102897064140110971206280439039759515677157700420337869936007230558763176359421873125147120532928191826186125867321579198414848829164470609575270695722091756711672291098169091528017350671274858322287183520935396572512108357915136988209144421006751033467110314126711136990865851639831501970165151168517143765761835155650884909989859982387345528331635507647918535893226185489632132933089857064204675259070915481416549859461637180270981994309924488957571282890592323326097299712084433573265489382391193259746366730583604142813883032038249037589852437441702913276561809377344403070746921120191302033038019762110110044929321516084244485963766983895228684783123552658213144957685726243344189303968642624341077322697802807
31891544110104468232527162010526522721116603966655730925471105578537634668206531098965269186205647693125705863566201855810072936065987648611791045334885034611365768675324944166803962657978771855608455296541266540853061434443185867697514566140680070023787765913440171274947042056223053899456131407112700040785473326993908145466464588079727082668306343285878569830523580893306575740679545716377525420211495576158140025012622859413021647155097925923099079654737612551765675135751782966645477917450112996148903046399471329621073404375189573596145890193897131117904297828564750320319869151402870808599048010941214722131794764777262241425485454033215718530614228813758504306332175182979866223717215916077166925474873898665494945011465406284336639379003976926567214638530673609657120918076383271664162748888007869256029022847210403172118608204190004229661711963779213375751149595015660496318629472654736425230817703675159067350235072835405670403867435136222247715891504953098444893330963408780769
32599397805419341447377441842631298608099888687413260472156951623965864573021631598193195167353812974167729478672422924654366800980676928238280689964004824354037014163149658979409243237896907069779422362508221688957383798623001593776471651228935786015881617557829735233446042815126272037343146531977774160319906655418763979293344195215413418994854447345673831624993419131814809277771038638773431772075456545322077709212019051660962804909263601975988281613323166636528619326686336062735676303544776280350450777235547105859548702790814356240145171806246436267945612753181340783303362542327839449753824372058353114771199260638133467768796959703098339130771098704085913374641442822772634659470474587847787201927715280731767907707157213444730605700733492436931138350493163128404251219256517980694113528013147013047816437885185290928545201165839341965621349143415956258658655705526904965209858033850722426482939728584783163057777560688876446248246857926039535277348030480290058760758251047470916
43961362676044925627420420832085661190625454337213153595845068772460290161876679524061634252257719542916299193064553779914037340432875262888963995879475729174642635745525407909145135711136941091193932519107602082520261879853188770584297259167781314969900901921169717372784768472686084900337702424291651300500516832336435038951702989392233451722013812806965011784408745196012122859937162313017114448464090389064495444006198690754851602632750529834918740786680881833851022833450850486082503930213321971551843063545500766828294930413776552793975175461395398468339363830474611996653858153842056853386218672523340283087112328278921250771262946322956398989893582116745627010218356462201349671518819097303811980049734072396103685406643193950979019069963955245300545058068550195673022921913933918568034490398205955100226353536192041994745538593810234395544959778377902374216172711172364343543947822181852862408514006660443325888569867054315470696574745855033232334210730154594051655379068662733379
95851156257843229882737231989875714159578111963583300594087306812160287649628674460477464915995054973742562690104903778198683593814657412680492564879855614537234786733039046883834363465537949864192705638729317487233208376011230299113679386270894387993620162951541337142489283072201269014754668476535761647737946752004907571555278196536213239264061601363581559074220202031872776052772190055614842555187925303435139844253223415762336106425063904975008656271095359194658975141310348227693062474353632569160781547818115284366795706110861533150445212747392454494542368288606134084148637767009612071512491404302725386076482363414334623518975766452164137679690314950191085759844239198629164219399490723623464684411739403265918404437805133389452574239950829659122850855582157250310712570126683024029295252201187267675622041542051618416348475651699981161410100299607838690929160302884002691041407928862150784245167090870006992821206604183718065355672525325675328612910424877618258297651579598470356
22262934860034158722980534989650226291748788202734209222245339856264766914905562842503912757710284027998066365825488926488025456610172967026640765590429099456815065265305371829412703369313785178609040708667114965583434347693385781711386455873678123014587687126603489139095620099393610310291616152881384379099042317473363948045759314931405297634757481193567091101377517210080315590248530906692037671922033229094334676851422144773793937517034436619910403375111735471918550464490263655128162288244625759163330391072253837421821408835086573917715096828874782656995995744906617583441375223970968340800535598491754173818839994469748676265516582765848358845314277568790029095170283529716344562129640435231176006651012412006597558512761785838292041974844236080071930457618932349229279650198751872127267507981255470958904556357921221033346697499235630254947802490114195212382815309114079073860251522742995818072471625916685451333123948049470791191532673430282441860414263639548000448002670496248201
79289647669758318327131425170296923488962766844032326092752496035799646925650493681836090032380929345958897069536534940603402166544375589004563288225054525564056448246515187547119621844396582533754388569094113031509526179378002974120766514793942590298969594699556576121865619673378623625612521632086286922210327488921865436480229678070576561514463204692790682120738837781423356282360896320806822246801224826117718589638140918390367367222088832151375560037279839400415297002878307667094447456013455641725437090697939612257142989467154357846878861444581231459357198492252847160504922124247014121478057345510500801908699603302763478708108175450119307141223390866393833952942578690507643100638351983438934159613185434754649556978103829309716465143840700707360411237359984345225161050702705623526601276484830840761183013052793205427462865403603674532865105706587488225698157936789766974220575059683440869735020141020672358502007245225632651341055924019027421624843914035998953539459094407046912
09140938700126456001623742880210927645793106579229552498872758461012648369998922569596881592056001016552563756785667227966198857827948488558343975187445455129656344348039664205579829368043522027709842942325330225763418070394769941597915945300697521482933665556615678736400536665641654732170439035213295435291694145990416087532018683793702348886894791510716378529023452924407736594956305100742108714261349745956151384987137570471017879573104229690666702144986374645952808243694457897723300487647652413390759204340196340391147320233807150952220106825634274716460243354400515212669324934196739770415956837535551667302739007497297363549645332888698440611964961627734495182736955882207573551766515898551909866653935494810688732068599075407923424023009259007017319603622547564789406475483466477604114632339056513433068449539790709030234604614709616968868850140834704054607429586991382966824681857103188790652870366508324319744047718556789348230894310682870272280973624809399627060747264553992539
94428081137369433887294063079261595995462624629707062594845569034711972996409089418059534393251236235508134949004364278527138315912568989295196427287573946914272534366941532361004537304881985517065941217352462589548730167600298865925786628561249665523533829428785425340483083307016537228563559152534784459818313411290019992059813522051173365856407826484942764411376393866924803118364453698589175442647399882284621844900877769776312795722672655562596282542765318300134070922334365779160128093179401718598599933849235495640057099558561134980252499066984233017350358044081168552653117099570899427328709258487894436460050410892266917835258707859512983441729535195378855345737426085902908176515578039059464087350612322611200937310804854852635722825768203416050484662775045003126200800799804925485346941469775164932709504934639382432227188515974054702148289711177792376122578873477188196825462981268685817050740272550263329044976277894423621674119186269439650671515779586756482399391760426017633
87045499017614364120469218237076488783419689686118155815873606293860381017121585527266830082383404656475880405138080163363887421637140643549556186896411228214075330265510042410489678352858829024367090488711819090949453314421828766181031007354770549815968077200947469613436092861484941785017180779306810854690009445899527942439813921350558642219648349151263901280383200109773868066287792397180146134324457264009737425700735921003154150893679300816998053652027600727749674584002836240534603726341655425902760183484030681138185510597970566400750942608788573579603732451414678670368809880609716425849759513806930944940151542222194329130217391253835591503100333032511174915696917450271494331515588540392216409722910112903552181576282328318234254832611191280092825256190205263016391147724733148573910777587442538761174657867116941477642144111126358355387136101102326798775641024682403226483464176636980663785768134920453022408197278564719839630878154322116691224641591177673225326433568614618654
52226812688726844596844241610785401676814208088502800541436131462308210259417375623899420757136275167457318918945628352570441335437585753426986994725470316566139919996826282472706413362221789239031760854289437339356188916512504244040089527198378738648058472689546243882343751788520143956005710481194988423906061369573423155907967034614914344788636041031823507365027785908975782727313050488939890099239135033732508559826558670892426124294736701939077271307068691709264625484232407485503660801360466895118400936686095463250021458529309500009071510582362672932645373821049387249966993394246855164832611341461106802674466373343753407642940266829738652209357016263846485285149036293201991996882851718395366913452224447080459239660281715655156566611135982311225062890585491450971575539002439315351909021071194573002438801766150352708626025378817975194780610137150044899172100222013350131060163915415895780371177927752259787428919179155224171895853616805947412341933984202187456492564434623925319
53135103311476394911995072858430658361935369329699289837914941939406085724863968836903265564364216644257607914710869984315733749648835292769328220762947282381537409961545598798259891093717126218283025848112389011968221429457667580718653806506487026133892822994972574530332838963818439447707794022843598834100358385423897354243956475556840952248445541392394100016207693636846776413017819659379971557468541946334893748439129742391433659360410035234377706588867781139498616478747140793263858738624732889645643598774667638479466504074111825658378878454858148962961273998413442726086061872455452360643153710112746809778704464094758280348769758948328241239292960582948619196670918958089833201210318430340128495116203534280144127617285830243559830032042024512072872535581195840149180969253395075778400067465526031446167050827682772223534191102634163157147406123850425845988419907611287258059113935689601431668283176323567325417073420817332230462987992804908514094790368878687894930546955703072619
00950207643349335910602454508645362893545686295853131533718386826561786227363716975774183023986006591481616404944965011732131389574706208847480236537103115089842799275442685327797431139514357417221975979935968525228574526379628961269157235798662057340837576687388426640599099350500081337543245463596750484423528487470144354541957625847356421619813407346854111766883118654489377697956651727966232671481033864391375186594673002443450054499539974237232871249483470604406347160632583064982979551010954183623503030945309733583446283947630477564501500850757894954893139394489921612552559770143685894358587752637962559708167764380012543650237141278346792610199558522471722017772370041780841942394872540680155603599839054898572354674564239058585021671903139526294455439131663134530893906204678438778505423939052473136201294769187497519101147231528932677253391814660730008902776896311481090220972452075916729700785058071718638105496797310016787085069420709223290807038326345345203802786099055690013
41371823683709919495164896007550493412678764367463849020639640197666855923356546391383631857456981471962108410809618846054560390384553437291414465134749407848844237721751543342603066988317683310011331086904219390310801437843341513709243530136776310849135161564226984750743032971674696406665315270353254671126675224605511995818319637637076179919192035795820075956053023462677579439363074630569010801149427141009391369138107258137813578940055995001835425118417213605572752210352680373572652792241737360575112788721819084490061780138897107708229310027976659358387589093956881485602632243937265624727760378908144588378550197028437793624078250527048758164703245812908783952324532378960298416692254896497156069811921865849267704039564812781021799132174163058105545988013004845629976511212415363745150056350701278159267142413421033015661653560247338078430286552572227530499988370153487930080626018096238151613669033411113865385109193673938352293458883225508870645075394739520439680790670868064450
96986548801682874343786126453815834280753061845485903798217994599681154419742536344399602902510015888272164745006820704193761584547123183460072629339550548239557137256840232268213012476794522644820910235647752723082081063518899152692889108455571126603965034397896278250016110153235160519655904211844949907789992007329476905868577878720982901352956613978884860509786085957017731298155314951681467176959760994210036183559138777817698458758104466283998806006162298486169353373865787735983361613384133853684211978938900185295691967804554482858483701170967212535338758621582310133103877668272115726949518179589754693992642197915523385766231676275475703546994148929041301863861194391962838870543677743224276809132365449485366768000001065262485473055861598999140170769838548318875014293890899506854530765116803337322265175662207526951791442252808165171667766727930354851542040238174608923283917032754257508676551178593950027933895920576682789677644531840404185540104351348389531201326378369283580
82719378312654961745997056745071833206503455664403449045362756001125018433560736122276594927839370647842645676338818807565612168960504161139039063960162022153684941092605387688714837989559999112099164646441191856827700457424343402167227644558933012778158686952506949936461017568506016714535431581480105458860564550133203758645485840324029871709348091055621167154684847780394475697980426318099175642280987399876697323769573701580806822904599212366168902596273043067931653114940176473769387351409336183321614280214976339918983548487562529875242387307755955595546519639440182184099841248982623673771467226061633643296406335728107078875816404381485018841143188598827694490119321296827158884133869434682859006664080631407775772570563072940049294030242049841656547973670548558044586572022763784046682337985282710578431975354179501134727362577408021347682604502285157979579764746702284099956160156910890384582450267926594205550395879229818526480070683765041836562094555434613513415257006597488191
63413595567196496540321872716026485930490397874895890661272507948282769389535217536218507962977851461884327192232238101587444505286652380225328438913752738458923844225354726530981715784478342158223270206902872323300538621634798850946954720047952311201504329322662827276321779088400878614802214753765781058197022263097174950721272484794781695729614236585957820908307332335603484653187302930266596450137183754288975579714499246540386817992138934692447419850973346267933210726868707680626399193619650440995421676278409146698569257150743157407938053239252394775574415918458215625181921552337096074833292349210345146264374498055961033079941453477845746999921285999993996122816152193148887693880222810830019860165494165426169685867883726095877456761825072759929508931805218729246108676399589161458550583972742098090978172932393010676638682404011130402470073508578287246271349463685318154696904669686939254725194139929146524238577625500474852954768147954670070503479995888676950161249722820403039
95463278830695976249361510102436555352230690612949388599015734661023712235478911292547696176005047974928060721268039226911027772261025441492215765045081206771735712027180242968106203776578837166909109418074487814049075517820385653909910477594141321543284406250301802757169650820964273484146957263978842560084531214065935809041271135920041975985136254796160632288736181367373244506079244117639975974619383584574915988097667447093006546342423460634237474666080431701260052055928493695941434081468529815053947178900451835755154125223590590687264878635752541911288877371766374860276606349603536794702692322971868327717393236192007774522126247518698334951510198642698878471719396649769070825217423365662725928440620430214113719922785269984698847702323823840055655517889087661360130477098438611687052310553149162517283732728676007248172987637569816335415074608838663640693470437206688651275688266149730788657015685016918647488541679154596507234287730699853713904300266530783987763850323818215535
59732353068604301067576083890862704984188859513809103042359578249514398859011318583584066747237029714978508414585308578133915627076035639076394731145549583226694570249413983163433237897595568085683629725386791327505554252449194358912840504522695381217913191451350099384631177401797151228378546011603595540286440590249646693070776905548102885020808580087811577381719174177601733073855475800605601433774329901272867725304318251975791679296996504146070664571258883469797964293162296552016879730003564630457930884032748077181155533090988702550520768046303460865816539487695196004408482065967379473168086415645650530049881616490578831154345485052660069823093157776500378070466126470602145750579327096204782561524714591896522360839664562410519551052235723973951288181640597859142791481654263289200428160913693777372229998332708208296995573772737566761552711392258805520189887620114168005468736558063347160373429170390798639652296131280178267971728982293607028806908776866059325274637840539769184
80820410219447197138692560841624511239806201131845412447820501107987607171556831540788654390412108730324020106853419472304766667217498698685470767812051247367924791931508564447753798537997322344561227858432968466475133365736923872014647236794278700425032555899268843495928761240075587569464137056251400117971331662071537154360068764773186755871487839890810742953094106059694431584775397009439883949144323536685392099468796450665339857388878661476294434140104988899316005120767810358861166020296119363968213496075011164983278563531614516845769568710900299976984126326650234771672865737857908574664607722834154031144152941880478254387617707904300015669867767957609099669360755949651527363498118964130433116627747123388174060373174397054067031096767657486953587896700319258662594105105335843846560233917967492678447637084749783336555790073841914731988627135259546251816043422537299628632674968240580602964211463864368642247248872834341704415734824818333016405669596688667695634914163284264149
74533349999480002669987588815935073578151958899005395120853510357261373640343675347141048360175464883004078464167452167371904831096767113443494819262681110739948250607394950735031690197318521195526356325843390998224986240670310768318446607291248747540316179699411397387765899868554170318847788675929026070043212666179192235209382278788809886335991160819235355570464634911320859189796132791319756490976000139962344455350143464268604644958624769094347048293294140411146540923988344435159133201077394411184074107684981066347241048239358274019449356651610884631256785297769734684303061462418035852933159734583038455410337010916767763742762102137013548544509263071901147318485749233181672072137279355679528443925481560913728128406333039373562420016045664557414588166052166608738748047243391212955877763906969037078828527753894052460758496231574369171131761347838827194168606625721036851321566478001476752310393578606896111259960281839309548709059073861351914591819510297327875571049729011487171
89718004696169777001791391961379141716270701895846921434369676292745910994006008498356842520191559370370101104974733949387788598941743303178534870760322198297057975119144051099423588303454635349234982688362404332726741554030161950568065418093940998202060999414021689090070821330723089662119775530665918814119157783627292746156185710372172471009521423696483086410259288745799932237495519122195190342445230753513380685680735446499512720317448719540397610730806026990625807602029273145525207807991418429063884437349968145827337207266391767020118300464819000241308350884658415214899127610651374153943565721139032857491876909441370209051703148777346165287984823533829726013611098451484182380812054099612527458088109948697221612852489742555551607637167505489617301680961380381191436114399210638005083214098760459930932485102516829446726066613815174571255975495358023998314698220361338082849935670557552471290274539776214049318201465800802156653606776550878380430413431059180460680083459113664083
48874080057412725867047922583191274157390809143831384564241509408491339180968402511639919368532255573389669537490266209232613188558915808324555719484538756287861288590041060060737465014026278240273469625282171749415823317492396835301361786536737606421667781377399510065895288774276626368418306801908046098498094697636673356622829151323527888061577682781595886691802389403330764419124034120223163685778603572769415417788264352381319050280870185750470463129333537572853866058889045831114507739429352019943219711716422350056440429798920815943071670198574692738486538334361457946341759225738985880016980147574205429958012429581054565108310462972829375841611625325625165724980784920998979906200359365099347215829651741357984910471116607915874369865412223483418877229294463351786538567319625598520260729476740726167671455736498121056777168934849176607717052771876011999081441130586455779105256843048114402619384023224709392498029335507318458903553971330884461741079591625117148648744686112476054
28673436709046678468670274091881014249711149657817724279347070216688295610877794405048437528443375108828264771978540006509704033021862556147332117771174413350281608840351781452541964320309576018694649088681545285621346988355444560249556668436602922195124830910605377201980218310103270417838665447181260397190688462370857518080035327047185659499476124248110999288679158969049563947624608424065930948621507690314987020673533848349550836366017848771060809804269247132410009464014373603265645184566792456669551001502298330798496079949882497061723674493612262229617908143114146609412341593593095854079139087208322733549572080757165171876599449856937956238755516175754380917805280294642004472153962807463602113294255916002570735628126387331060058910652457080244749375431841494014821199962764531068006631183823761639663180931444671298615527598201451410275600689297502463040173514891945763607893528555053173314164570504996443890936308438744847839616840518452732884032345202470568516465716477139323
77551729479512613239822960239454857975458651745878771331813875295980941217422730035229650808917770506825924882232215493804837145478164721397682096332050830564792048208592047549985732038887639160199524091893894557676874973085695595801065952650303626615975066222508406742889826590751063756356996821151094966974458054728869363102036782325018232370845979011154847208761821247781326633041207621658731297081123075815982124863980721240786887811450165582513617890307086087019897588980745664395515741536319319198107057533663373803827215279884935039748001589051942087971130805123393322190346624991716915094854140187106035460379464337900589095772118080446574396280618671786101715674096766208029576657705129120990794430463289294730615951043090222143937184956063405618934251305726829146578329334052463502892917547087256484260034962961165413823007731332729830500160256724014185152041890701154288579920812198449315699905918201181973350012618772803681248199587707020753240636125931343859554254778196114293
51635612234966615226147353996740515849986035529533292457523888101362023476246690558164389678630976273655047243486430712184943734853006063876445662721866617012381277156213797461498613287441177145524447089971445228856629424402301847912054784985745216346964489738920624019435183100882834802492490854030778638751659113028739587870981007727182718745290139728366148421428717055317965430765045343246005363614726181809699769334862640774351999286863238350887566835950972655748154319401955768504372480010204137498318722596773871549583997184449072791419658459300839426370208756353982169620553248032122674989114026785285996734052420310917978999057188219493913207534317079800237365909853755202389116434671855829068537118979526262344924833924963424497146568465912489185566295893299090352392333336474352037077010108438800329075983421701855422838616172104176030116459187805393674474720599850235828918336929223373239994804371084196594731626548257480994825099918330069765693671596893644933488647442135008407
00660883597235039532340179582557036016936990988671132109798897070517280755855191269930673099250704070245568507786790694766126298082251633136399521170984528092630375922426742575599892892783704744452189363203489415521044597261883800300677617931381399162058062701651024458869247649246891924612125310275731390840470007143561362316992371694848132554200914530410371354532966206392105479824392125172540132314902740585892063217589494345489068463993137570910346332714153162232805522972979538018801628590735729554162788676498274186164218789885741071649069191851162815285486794173638906653885764229158342500673612453849160674137340173572779956341043326883569507814931378007362354180070619180267328551191942676091221035987469241172837493126163395001239599240508454375698507957046222664619000103500490183034153545842833764378111988556318777792537201166718539541835984438305203762819440761594106820716970302285152250573126093046898423433152732131361216582808075212631547730604423774753505952287174402666
38914881717308643611138906942027908814311944879941715404210341219084709408025402393294294549387864023051292711909751353600092197110541209668311151632870542302847007312065803262641711616595761327235156666253667271899853419989523688483099930275741991646384142707798870887422927705389122717248632202889842512528721782603050099451082478357290569198855546788607946280537122704246654319214528176074148240382783582971930101788834567416781139895475044833931468963076339665722672704339321674542182455706252479721997866854279897799233957905758189062252547358220523642485078340711014498047872669199018643882293230538231855973286978092225352959101734140733488476100556401824239219269506208318381454698392366461363989101210217709597670490830508185470419466437131229969235889538493013635657618610606222870559942337163102127845744646398973818856674626087948201864748767272722206267646533809980196688368099415907577685263986514625333631245053640261056960551318381317426118442018908885319635698696279503673
84243130113317533053298020166888174813429886815855778103432317530647849832106297184251843855344276201282345707169885305183261796411785796088881503296022907056144762209150947390359466469162353968092013945781758910889319921122600739281491694816152738427362642980982340632002440244958944561291670495082358124873917996486411334803247577752197089327722623494860150466526814398770516153170266969297049283162855042128981467061953319702695072143782304768752802873541261663917082459251700107141808548006369232594620190022780874098597719218051585321473926532515590354102092846659252999143537918253145452905984158176370589279069098969111643811878094353715213322614436253144901274547726957393934815469163116249288735747188240715039950094467319543161938554852076657388251396391635767231510055560372633948672082078086537349424401157996675073607111593513319591971209489647175530245313647709420946356969822266737752099451684506436238242118535348879893956731878066061078854400055082765703055874485418057788
91719207881423351138662929667179643468760077047999537883387870348718021842437342112273940255717690819603092018240188427057046092622564178375265263358324240661253311529423457965569502506810018310900411245379015332966156970522379210325706937051090830789479999004999395322153622748476603613677697978567386584670936679588583788795625946464891376652199588286933801836011932368578558558195556042156250883650203322024513762158204618106705195330653060606501054887167245377942831338871631395596905832083416898476065607118347136218123246227258841990286142087284956879639325464285343075301105285713829643709990356948885285190402956047346131138263878897551788560424998748316382804046848618938189590542039889872650697620201995548412650005394428203930127481638158530396439925470201672759328574366661644110962566337305409219519675148328734808957477775278344221091073111351828046036347198185655572957144747682552857863349342858423118749440003229690697758315903858039353521358860079600342097547392296733310
64939560181223781285458431760556173386112673478074585067606304822940965304111830667108189303110887172816751957967534718853722930961614320400638132246584111115775835858113501856904781536893813771847281475199835050478129771859908470762197460588742325699582889253504193795826061621184236876851141831606831586799460165205774052942305360178031335726326705479033840125730591233960188013782542192709476733719198728738524805742124892118347087662966720727232565056512933312605950577772754247124164831283298207236175057467387012820957554430596839555568686118839713552208445285264008125202766555767749596962661260456524568408613923826576858338469849977872670655519185446869846947849573462260629421962455708537127277652309895545019303773216664918257815467729200521266714346320963789185232321501897612603437368406719419303774688099929687758244104787812326625318184596045385354383911449677531286426092521153767325886672260404252349108702695809964759580579466397341906401003636190404203311357933654242630
35614570090112448008900208014780566037101541223288914657223931450760716706435568274377439657890679726874384730763464516775621030986040927170909512808630902973850445271828927496892121066700816485833955377359191369501531620189088874842107987068991148046692706509407620465027725286507289053285485614331608126930056937854178610969692025388650345771831766868859236814884752764984688219497397297077371871884004143231276365048145311228509900207424092558592529261030210673681543470152523487863516439762358604191941296976904052648323470099111542426012734380220893310966863678986949779940012601642276092608234930411806438291383473546797253992623387915829984864592717340592256207491053085315371829116816372193951887009577881815868504645076993439409874335144316263303172477474868979182092394808331439708406730840795893581089665647758599055637695252326536144247802308268118310377358870892406130313364773710116282146146616794040905186152603600925219472188909181073358719641421444786548995285823439470500
79830388538860831035719306002771194558021911942899922722353458707566246926177663178855144350218287026685610665003531050216318206017609217984684936863161293727951873078972637353717150256378733579771808184878458866504335824377004147710414934927438457587107159731559439426412570270965125108115548247939403597681188117282472158250109496096625393395380922195591918188552678062149923172763163218339896938075616855911752998450132067129392404144593862398809381240452191484831646210147389182510109096773869066404158973610476436500068077105656718486281496371118832192445663945814491486165500495676982690308911185687986929470513524816091743243015383684707292898982846022237301452655679898627767968091469798378268764311598832109043715611299766521539635464420869197567370005738764978437686287681792497469438427465256316323005551304174227341646455127812784577772457520386543754282825671412885834544435132562054464241011037955464190581168623059644769587054072141985212106734332410756767575818456990693046
04752277016700568454396923404171108988899341635058515788735343081552081177207188037910404698306957868547393765643363197978680367187307969392423632144845035477631567025539006542311792015346497792906624150832885839529054263768766896880503331722780018588506973623240389470047189761934734430843744375992503417880797223585913424581314404984770173236169471976571535319775499716278566311904691260918259124989036765417697990362375528652637573376352696934435440047306719886890196814742876779086697968852250163694985673021752313252926537589641517147955953878427849986645630287883196209983049451987439636907068276265748581043911223261879405994155406327013198989570376110532360629867480377915376751158304320849872092028092975264981256916342500052290887264692528466610466539217148208013050229805263783642695973370705392278915351056888393811324975707133102950443034671598944878684711643832805069250776627450012200352620370946602341464899839025258883014867816219677519458316771876275720050543979441245990
07711520515461993050983869825428464072555409274031325716326407929341833421470904125425335232480219322770753555467958716383587501815933871742360615511710131235256334858203651461418700492057043720182617331947157008675785393360786227395581857975872587441025420771054753612940474601000940954449596628814869159038990718659805636171376922272907641977551777201042764969496110562205925024202177042696221549587264539892276976603105249808557594716310758701332088614632664125911486338812202844406941694882615295776253250198703598706743804698219420563812558334364219492322759372212890564209430823525440841108645453694049692714940033197828613181861888111184082578659287574263844500599442295685864604810330153889114994869354360302218109434667640000223625505736312946262960961987605642599639461386923308371962659547392346241345977957485246478379807956931986508159776753505539189911513352522987361127791827485420086895396583594219633315028695611920122988898870060799927954111882690230789131076036176347794
89432032102773359416908650071932804017163840644987871753756781185321328408216571107549528294974936214608215583205687232185574065161096274874375098092230211609982633033915469494644491004515280925089745074896760324090768983652940657920198315265410658136823791984090645712468948470209357761193139980246813405200394781949866202624008902150166163813538381515037735022966074627952910384068685569070157516624192987244482719429331004854824454580718897633003232525821581280327467962002814762431828622171054352898348208273451680186131719593324711074662228508710666117703465352839577625997744672185715816126411143271794347885990892808486694914139097716736900277758502686646540565950394867841110790116104008572744562938425494167594605487117235946429105850909950214958793112196135908315882620682332156153086833730838173279328196983875087083483880463884784418840031847126974543709373298362402875197920802321878744882872843727378017827008058782410749357514889978911739746129320351081432703251409030487462
26294234432757126008664250833318768865075642927160552528954492153765175149219636718104943531785838345386525565664065725136357506435323650893679043170259787817719031486796384082881020946149007971513771709906195496964007086766710233004867263147551053723175711432231741141168062286420638890621019235522354671166213749969326932173704310598722503945657492461697826097025335947502091383667377289443869640002811034402608471289900074680776484408871134135250336787731679770937277868216611786534423173226463784769787514433209534000165069213054647689098505020301504488083426184520873053097318949291642532293361243151430657826407028389840984160295030924189712097160164926561341343342229882790992178604267981245728534580133826099587717811310216734025656274400729683406619848067661580502169183372368039902793160642043681207990031626444914619021945822969099212278855394878353830564686488165556229431567312827439082645061162894280350166133669782405177015521962652272545585073864058529983037918035043287670
38092521679075712040612375963276856748450791511473134400018325703449209097124358094479004624943134550289006806487042935340374360326258205357901183956490893543451013429696175452495739606214902887289327925206965353863964432253883275224996059869747598823299162635459733244451637553343774929289905811757863555556269374269109471170021654117182197505198317871371060510637955585889055688528879890847509157646390746936198815078146852621332524738376511929901561091897779220087057933964638274906806987691681974923656242260871541761004306089043779766785196618914041449252704808819714988015420577870065215940092897776013307568479669929554336561398477380603943688958876460549838714789684828053847017308711177611596635050399793438693391197898871091565417091330826076474063057114110988393880954814378284745288383680794188843426662220704387228874139478010177213922819119923654055163958934742639538248296090369002883593277458550608013179884071624465639979482757836501955142215513392819782269842786383916797
15091262410548725700924070045488485692950448110738087996547481568913935380943474556972128919827177020766613602489581468119133614121258783895577357194986317210844398901423948496659251731388171602663261931065366535041473070804414939169363262373767777095850313255990095762731957308648042467701212327020533742667053142448208168130306397378736642483672539837487690980602182785786216512738563513290148903509883270617258932575363993979055729175160097615459044771692265806315111028038436017374742152476085152099016158582312571590733421736576267142390478279587281505095633092802668458937649649770232973641319060982740633531089792464242134583740901169391964250459128813403498810635400887596820054408364386516617880557608956896727531538081942077332597917278437625661184319891025007491829086475149794003160703845549465385946027452447466812314687943441610993338908992638411847425257044572517459325738989565185716575961481266020310797628254165590506042479114016957900338356574869252800743025623419498286
46791447632277400552946090394017753633565547193100017543004750471914489984104001586794617924161001645471655133707407395026044276953855383439755054887109978520540117516974758134492607943368954378322117245068734423198987884412854206474280973562580706698310697993526069339213568588139121480735472846322778490808700246777630360555123238665629517885371967303463470122293958160679250915321748903084088651606111901149844341235012464692802880599613428351188471544977127847336176628506216977871774382436256571177945006447771837022199910669502165675764404499794076503799995484500271066598781360380231412683690578319046079276529727769404361302305178708054651154246939526512710105292707030667302444712597393995051462840476743136373997825918454117641332790646063658415292701903027601733947486696034869497654175242930604072700505903950314852292139257559484507886797792525393176515641619716844352436979444735596426063339105512682606159572621703669850647328126672452198906054988028078288142979633669674412
48059821921463395657457221022986775997467381260693670691340815594120161159601902377535255563006062479832612498812881929373434768626892192397778339107331065882568137771723283153290825250927330478507249771394483338925520811756084529665905539409655685417060011798572938139982583192936791003918440992865756059935989100029698644609747147184701015312837626311467742091455740418159088000649432378558393085308283054760767995243573916312218860575496738322431956506554608528812019023636447127037486344217272578795034284863129449163184753475314350413920961087960577309872013524840750576371992536504709085825139368634638633680428917671076021111598288755399401200760139470336617937153963061398636554922137415979051190835882900976566473007338793146789131814651093167615758213514248604422924453041131606527009743300884990346754055186406773426035834096086055337473627609356588531097609942383473822220872924644976845605795625167655740884103217313456277358560523582363895320385340248422733716391239732159954
40828421666636023296545694703577184873442034227706653837387506169212768015766181095420097708363604361110592409117889540338021426523948929686439808926114635414571535194342850721353453018315875628275733898268898523557799295727645229391567477566676051087887648453493636068278050564622813598885879259940946446041705204470046315137975431737187756039815962647501410906658866162180038266989961965580587208639721176995219466789857011798332440601811575658074284182910615193917630059194314434605154047710570054339000182453117733718955857603607182860506356479979004139761808955363669603162193113250223851791672055180659263518036251214575926238369348222665895576994660491938112486609099798128571823494006615552196112207203092277646200999315244273589488710576623894693889446495093960330454340842102462401048723328750081749179875543879387381439894238011762700837196053094383940063756116458560943129517597713935396074322792489221267045808183313764165818269562105872892447740035947009268662659651422050630
07859200248829186083974373235384908396432614700053242354064704208949921025040472678105908364400746638002087012666420945718170294675227854007450855237772089058168391844659282941701828823301497155423523591177481862859296760504820386434310877956289292540563894662194826871104282816389397571175778691543016505860296521745958198887868040811032843273986719862130620555985526603640504628215230615459447448990883908199973874745296981077620148713400012253552224669540931521311533791579802697955571050850747387475075806876537644578252443263804614304288923593485296105826938210349800040524840708440356116781717051281337880570564345061611933042444079826037795119854869455915205196009304127100727784930155503889536033826192934379708187432094991415959339636811062755729527800425486306005452383915106899891357882001941178653568214911852820785213012551851849371150342215954224451190020739353962740020811046553020793286725474054365271759589350071633607632161472581540764205302004534018357233829266191530835
40951202263291650544261236191970516138393573266937601569144299449437448568097756963031295887191611292946818849363386473927476012269641588489009657170861605981472044674286642087653347998582220906198021732116142304194777549907387385679411898246609130916917722742072333676350326783405863019301932429963972044451792881228544782119535308989101253429755247276357302262813820918074397486714535907786335301608215599113141442050914472935350222308171936635093468658586563148555758624478186201087118897606529698992693281787055764351433820601410773292610634315253371822433852635202177354407152818981376987551575745469397271504884697936195004777209705617939138289898453274262272886471088832701737232588182446584362495805925603381052156062061557132991560848920643403033952622634514542836786982880742514225674518061841495646861116354049718976821542277224794740335715274368194098920501136534001238467142965518673441537416150425632567134302476551252192180357801692403266995417460875924092070046693403965101
78134857835694440760470232540755557764728450751826890418293966113310160131119077398632462778219023650660374041606724962490137433217246454097412995570529142438208076098364823465973886691349919784013108015581343979194852830436739012482082444814128095443773898320059864909159505322857914576884962578665885999179867520554558099004556461178755249370124553217170194282884617402736649978475508294228020232901221630102309772151569446427909802190826689868834263071609207914085197695235553488657743425277531197247430873043619511396119080030255878387644206085044730631299277888942729189727169890575925244679660189707482960949190648764693702750773866432391919042254290235318923377293166736086996228032557185308919284403805071030064776847863243191000223929785255372375566213644740096760539439838235764606992465260089090624105904215453927904411529580345334500256244101006359530039598864466169595626351878060688513723462707997327233134693971456285542615467650632465676620279245208581347717608521691340946
52030767339184114750414016892412131982688156866456148538028753933116023229255561894104299533564009578649534093511526645402441877594931693056044868642086275720117231952640502309977456764783848897346431721598062678767183800524769688408498918508614900343240347674268624595239589035858213500645099817824463608731775437885967767291952611121385919472545140030118050343787527766440276261894101757687268042817662386068047788524288743025914524707395054652513533945959878961977891104189029294381856720507096460626354173294464957661265195349570186001541262396228641389779673332907056737696215649818450684226369036784955597002607986799626101903933126376855696876702929537116252800554310078640872893922571451248113577862766490242516199027747109033593330930494838059785662884478744146984149906712376478958226329490467981208998485716357108783119184863025450162092980582920833481363840542172005612198935366937133673339246441612522319694347120641737549121635700857369439730597970971972666664226743111776217
64030686813103518991122713397240368870009968629225464650063852886203938005047782769128356033725482557939129852515068299691077542576474883253414121328006267170940090982235296579579978030182824284902214707481111240186076134151503875698309186527806588966823625239378452726345304204188025084423631903833183845505223679923577529291069250432614469501098610888999146585518818735825281643025209392852580779697376208456374821144339881627100317031513344023095263519295886806908213558536801610002137408511544849126858412686958991741491338205784928006982551957402018181056412972508360703568510553317878408290000415525118657794539633175385320921497205266078312602819611648580986845875251299974040927976831766399146553861089375879522149717317281315179329044311218158710235187407572221001237687219447472093493123241070650806185623725267325407333248757544829675734500193219021991199607979893733836732425761039389853492787774739805080800155447640610535222023254094435677187945654304067358964910176107759483
64540823486130254718476485189575836674399791508512858020607820554462991723202028222914886959399729974297471155371858924238493855858595407438104882624648788053304271463011941589896328792678327322456103852197011130466587100500083285177311776489735230926661234588873102883515626446023671996644554727608310118788389151149340939344750073025855814756190881398752357812331342279866503522725367171230756861045004548970360079569827626392344107146584895780241408158405229536937499710665594894459246286619963556350652623405339439142111271810691052290024657423604130093691889255865784668461215679554256605416005071276641766056874274200329577160643448606201239821698271723197826816628249938714995449137302051843669076723577400053932662622760323659751718925901801104290384274185507894887438832703063283279963007200698012244365116394086922220745320244624121155804354542064215121585056896157356414313068883443185280853975927734433655384188340303517822946253702015782157373265523185763554098954033236382319
21989217117744946940367829618592080340386757583411151882417743914507736638407188048935825686854201164503135763335550944031923672034865101056104987272647213198654343545040913185951314518127643731043897250700498198705217627249406521461995923214231443977654670835171474936798618655279171582408065106379950018429593879915835017158075988378496225739851212981032637937621832245659423668537679911314010804313973233544909082491049914332584329882103398469814171575601082970658306521134707680368069532297199059990445120908727577622535104090239288877942463048328031913271049547859918019696783532146444118926063152661816744319355081708187547705080265402529410921826485821385752668815558411319856002213515888721036569608751506318753300294211868222189377554602722729129050429225978771066787384000061677215463844129237119352182849982435092089180168557279815642185819119749098573057033266764646072875743056537260276898237325974508447964954564803077159815395582777913937360171742299602735310276871944944491
79397851446315973144353518504914139415573293820485421235081739125497498193087143966151329420459193801062314217741991840601803479498876910515579055548069538785400664533759818628464199052204528033062636956264909108276271159038569950512465299960628554438383303276385998007929228466595035512112452840875162290602620118577753137479493620554964010730013488531507354873539056029089335264007132747326219603117734339436733857591245081493357369116645412817881714540230547506671365182582848980995121391939956332413365567770980030819102720409971486874181346670060940510214626902804491596465453301077546954130887141653125448130611924078211886900560277818242350226961893443525476335735364856193632544177566139817039306328721669057222597452091929172621998444096461582694563802395028371216864465617852355651641277128269186886155727162014749340522769465957121983149433816221140069363074304441732847861017777438379770372317952554341072234455125555899986461838767649039724611679590181000350989286412041951635
51108763204267612979826529425882951141275841262732790798807559751851576841264742209479721843309352972665210015662514552994745127631550917636730259462132930190402837954246323258550301096706922720227074863419005438302650681214142135057154175057508639907673946335146209082888934938376439399256900604067311422093312195936202982972351163259386772241477911629572780752395056251581603133359382311500518626890530658368129988108663263271980611271548858798093487912913707498230575929091862939195014721197586067270092547718025750337730799397134539532646195269996596385654917590458333585799102012713204583903200853878881633637685182083727885131175227769609787962142372162545214591281831798216044111311671406914827170981015457781939202311563871950805024679725792497605772625913328559726371211201905720771409148645074094926718035815157571514050397610963846755569298970383547314100223802583468767350129775413279532060971154506484212185936490997917766874774481882870632315515865032898164228288232746866106
59273219790716238464215348985247621678905026099804526648392954235728734397768049577409144953839157556548545905897649519851380100795801078375994577529919670054760225255203445398871253878017196071816407812484784725791240782454436168234523957068951427226975043187363326301110305342333582160933319121880660826834142891041517324721605335584999322454873077882290525232423486153152097693846104258284971496347534183756200301491570327968530186863157248840152663983568956363465743532178349319982554211730846774529708583950761645822963032442432823773745051702856069806788952176819815671078163340526675953942492628075696832610749532339053622309080708145591983735537774874202903901814293731152933464446815121294509759653430628421531944572711861490001765055817709530246887526325011970520947615941676872778447200019278913725184162285778379228443908430118112149636642465903363419454065718354477191244662125939265662030688852005559912123536371822692253178145879259375044144893398160865790087616502463519704
58288954817937566810464746141051424988702521399368705093723054477341126413548928068410591077166778212383328102621855877513127211793444482014404257450830639447383637939062830089733062413806145894142276947479316657176231824721683506780764875734204915576282175839729751344789906965895325489403356156131674032764724692125057591162515296545685446334981143176702572956618447754874693784642337372389819206620485118943788682248072793520225017965453437572741639107919729529508129429222053477173041844779156739917384183117103625243957161527146690058147000026330104526435478659032907332054683388720787354447626479252976901709120078741837367350877133769776834963442524199499513883150748775374338494582597655609965559543180409201784971846854973706962120885243770138537576814166327224126344239821529416453780004925072627651507890850712659970367087266927643083772296859851691223050374627443108529343052730788652839773352460174635277032059381791253969156210636376258829375713738407544064689647831007045806
13446731271591194608435935825987782835266531151065041623295329047772174083559349723758552138048305090009646676088301540612824308740645594431853413755220166305812111033453120745086824339432159043594430312431227471385842030390106070940315235556172767994160020393975099897629335325855575624808996691829864222677502360193257974726742578211119734709402357457222271212526852384295874273501563660093188045493338989741571490544182559738080871565281430102670460284316819230392535297795765862414392701549740879273131051636119137577008929564823323648298263024607975875767745377160102490804624301856524161756655600160859121534556267602192689982855377872583145144082654583484409478463178777374794653580169960779405568701192328608041130904629350871827125934668712766694873899824598527786499569165464029458935064964335809824765965165142090986755203808309203230487342703468288751604071546653834619611223013759451579252696743642531927390036038608236450762698827497618723575476762889950752114804852527950845
03395857083813047693788132112367428131948795022806632017002246033198967197064916374117585485187848401205484467258885140156272501982171906696081262778548596481836962141072171421498636191877475450965030895709947093433785698167446582826791194061195603784539785583924076127634410576675102430755981455278616781594965706255975507430652108530159790807334373607943286675789053348366955548680391343372015649883422089339997164147974693869690548008919306713805717150585730714881564992071408675825960287605645978242377024246980532805663278704192676846711626687946348695046450742021937394525926266861355294062478136120620263649819999949840514386828525895634226432870766329930489172340072547176418868535137233266787792173834754148002280339299735793615241275582956927683723123479898944627433045456679006203242051639628258844308543830720149567210646053323853720314324211260742448584509458049408182092763914000854042202355626021856434899414543995041098059181794888262805206644108631900168856815516922948620
30107388971810077092905904807490924271410189335428184299959881696609938369616443815288772140852680887574882932587358099056707558170179491619061140019085537448827262009366856044755965574764856740081773817033073803054769736097865438593821872205839023444435088674998665060406458743460053318274362961778625180818931443632512051070946908135864405192295129324500788333987884293393424351263433652043858129128343452973086529097833006712617981303167943855357262969987403595704584522308563900989131794759487521263970783759448611394519602867512105616389760088800927461158608002078033415914517970730368351969777660763737853330120241201120469886092093390853657732223924124490515327809509558664594776344822699860748132973026309750288121035177231244650953496536930900186377640940943498373132513218620802148099226855029484546618147155574447096695301776904342720318927706047177845279391604722815343798035396798614243709566832214914654380145938292773933960327540480095522318166673803571839327570771420467238
38624617803976292377131209580789363841447929802588065522129262093623930637313496640186619510811583471173312025805866727639992763579078063818813069156366274125431259589936119647626101405563503399523140323113819656236327198961837254845333702062563464223952766943568376761368711962921818754576081617053031590728828700712313666308722754918661395773730546065997437810987649802414011242142773668082751390959313404155826266789510846776118665957660165998178089414985754976284387856100263796543178313634025135814161151902096499133548733131115022700681930135929595971640197196053625033558479980963488718039111612813595968565478868325856437896173159762002419621552896297904819822199462269487137462444729093456470028537694958859591606789282491054412515996300781368367490209374915732896270028656829344431342347351239298259166739503425995868970697267332582735903121288746660451461487850346142827765991608090398652575717263081833494441820193533385071292345774375579344062178711330063106003324053991693682
60374617663856575887758020122936635327026710068126182517291460820254189288593524449107013820621155382779356529691457650204864328286555793470720963480737269214118689546732276775133569019015372366903686538916129168888787640752549349424973342718117889275993159671935475898809792452526236365903632007085444078454479734829180208204492667063442043755532505052752283377888704080403353192340768563010934777212563908864041310107381785333831603813528082811904083256440184205374679299262203769871801806112262449090924264198582086175117711378905160914038157500336642415609521632819712233502316742260056794128140621721964184270578432895980288233505982820819666624903585778994033315227481777695284368163008853176969478369058067106482808359804669884109813515865490693331952239436328792399053481098783027450017206543369906611778455436468772363184446476806914282800455107468664539280539940910875493916609573161971503316696830992946634914279878084225722069714887558063748030886299511847318712477729191007022
75888934869394562895158029653721504096031077612898312635899648934102470360366450586872875890514068412381242473863854279082827338279733268855049358743031602747490631295723497426112215174171531336186224109138695006888358989623492763173164783400774608866555987333821138299287769114954921841920877716060684728746736818861675072210172611038306717878566948129487850489430630861699487987031605158841082823512741535385133658953329486294944950618685147791058046960390693726626703865129052011378108586161888869479576074135855345851517680519733344334952301203957707396237713160302428872005373209982530089776189731298178819446717311606472314762484575519287327828251271824468078242152164695678192940982389262849437602488522790036202193866964822156280936053731780408637272684266964219299468192149087017075333610947913818040632873875938482695355830773957614479972700034728801827852813895032179863452161110666088393140532269449054555278678944175792024400214507801920998044613825478058580484424164047750315
36054906591430078158372430123137511562284015838644270890718284816757527123846782459534334449622010096071051370608461801187543120725491334994247617115633321408934609156561550600317384218701570226103101916603887064661438897736318780940711527528174689576401581047016965247557740891644568677717158500583269943401677202156767724068128366565264122982439465133197359199709403275938502669557470231813203243716420586141033606524536939160050644953060161267822648942437397166717661231048975031885732165554988342121802846912529086101485527815277625623750456375769497734336846015607727035509629049392487088406281067943622418704747008368842671022558302403599841645951122485272633632645114017395248086194635840783753556885622317115520947223065437092606797351000565549381224575483728545711797393615756167641692895805257297522338558611388322171107362265816218842443178857488798109026653793426664216990914056536432249301334867988154886628665052346997235574738424830590423677143278792316422403877764330192600
19228477831383763253612102533693581262408686669973827597736568222790721583247888864236934639616436330873013981421143030600873066616480367898409133592629340230432497492688783164360268101130957071614191283068657732353263965367739031766136131596555358499939860056515592193675997771793301974468814837110320650369319289452140265091546518430993655349333718342529843367991593941746622390038952767381333061774762957494386871697845376721949350659087571191772087547710718993796089477451265475750187119487073873678589020061737332107569330221632062843206567119209695058576117396163232621770894542621460985841023781321581772760222273813349541048100307327510779994899197796388353073444345753297591426376840544226478421606312276964696715647399904371590332390656072664411643860540483884716191210900870101913072607104411414324197679682854788552477947648180295973604943970047959604029274629920357209976195014034831538094771460105633344699882082212058728151072918297121191787642488035467231691654185225672923
44291871281632325969654135485895771332083399112887759172261152733790103413620856145779923987783250835507301998184590259583559892605532996737704917224549353296833000022301815172265757875240588322490858212800897479093261007625787704286560069961762121768454789964407050662417102133274867962374302291553582007801411653480656474882306150033920689837947662550365498228053296628621179306284301704924023019857199789488368971830438051821744191476604297524372516834354112170386313794114220952958857980601529387527537990309388716835720957607152219002793792927863036372687658226812419933848081660216037221547101430073775377926990695871212892880190520316012858618254944133538207848834653116326504076424283908701210151942319616522684220037112304643006734420647477180213530701240988603533991526679238711017062218658835737812109351797756044256346949997872511254408545222748109148743072598696020402759411789425812818821599523596589791811440776533543217575952555361581280011638467203193465072968079907939637
14961774312119402021297573125165253768017359101557338153772001952444543620071848475663415407442328621060997613243487548847434539665981338717466093020535070271952983943271425371155766600025784423031073429551533945060486222764966687624079324353192992639253731076892135352572321080889819339168668278948281170472624501948409700975760920983724090074717973340788141825195842598096241747610138252643955135259311885045636264188300338539652435997416931322894719878308427600401368074703904097238473945834896186539790594118599310356168436869219485382055780395773881360679549900085123259442529724486666766834641402189915944565309423440650667851948417766779470472041958822043295380326310537494883122180391279678446100139726753892195119117836587662528083690053249004597410947068772912328214304635337283519953648274325833119144459017809607782883583730111857543659958982724531925310588115026307542571493943024453931870179923608166611305426253995833897942971602070338767815033010280120095997252222280801423
57109476035192554443492998676781789104555906301595380976187592035893734197896235893112598390259831026719330418921510968915622506965911982832345550305908173073519550372166587028805399213857603703537710517802128012956684198414036287272562321442875430221090947272107347413497551419073704331827662617727599688882602722524713368335345281669277959132886138176634985772893690096574956228710302436259077241221909430087175569262575806570991201665962243608024287002454736203639484125595488172727247365346778364720191830399871762703751572464992228946793232269361917764161461879561395669956778306829031658969943076733350823499079062410020250613405734430069574547468217569044165154063658468046369262127421107539904218871612761778701425886482577522388918459952337629237791558574454947736129552595222657863646211837759847370034797140820699414558071908021359073226923310083175951065901912129479540860364075735875020589020870457967000705526250581142066390745921527330940682364944159089100922029668052332526
61989113118420162916310768940847235643668081821686572196882683584027855007828040434537101836510969517823357430305048526537380735310741859177056103973950626403554422751561011072617793706347238049906669221619711942591204450846417463835899382399465173955090008594799901360266742614942900664671150671754221770387745076735637421547829059110126191575558702389570014051178226469899449179083017954758767601680941001358376135785913569244556477644641786671153919513576961048649224900834467154863830544779143300976804868783481846727337584368927243104474068076852786255851650920882638132336231487333367147645204508766276149503899495048095604609896043291233583488599902945264002849942808786240398118148847673012167541611066299955536681931232874257020637383520200868636913117334697317412191536332467453256308713473027921749562270146873258678917345583799643513588009593508775563562488104938529990076751355135277924124292774885658885665132473025147102105753525165118148509027504768455182520963318990685276
14435138213662152368890578786699432288816028377482035506016029894009119713850179871683633744139275973644017007014763706655703504338121113576415018451821413619823495159601064752712575935185304332875537783057509567425442684712219618709178560783936144511383335649103256405733898667178123972237519316430617013859539474367843392670986712452211189690840236327411496601243483098929941738030588417166613073040067588380432111555379440605497721705942821514886165672771240903387727745629097110134885184374118695655449745736845218066982911045058004299887953899027804383596282409421860556287788428802127553884803728640019441614257499904272009595204654170598104989967504511936471172772220436102614079750809686975176600237187748348016120310234680567112644766123747627852190241202569943534716226660893675219833111813511146503854895025120655772636145473604426859498074396932331297127377157347099713952291182653485155587137336629120242714302503763269501350911612952993785864681307226486008270881333538193703
68259886789332123832705329762585738279009782646054559855513183668884462826513379849166783940976135376625179825824966345877195012438404035914084920973375464247448817618407002356958017741017769692507781489338667255789856458985105689196092439884156928069698335224022563457049731224526935419383700484318335719651662672157552419340193309901831930919658292096965624766768365964701959575473934551433741370876151732367720422738567427917069820454995309591887243493952409444167899884631984550485239366297207977745281439941825678945779571255242682608994086331737153889626288962940211210888442737656862452761213037101730078513571540453304150795944777614359743780374243664697324713841049212431413890357909241603640631403814983148190525172093710396402680899483257229795456404270175772290417323479607361878788991331830584306939482596131871381642346721873084513387721908697510494284376932502498165667381626061594176825250999374167288395174406693254965340310145222531618900923537648637848288134420987004809
62271712264074895719390029185733074601043607291909457679946149292904279816877294264877299528584346477753869069501489841339245403941446802636254021186143170312511175776428299146445334089209769616990983726523617687456058947049681701369749095230720826828878907301900182534258053434217059287139317379931424108526473909482845964180936141384758311361305761084623668372376959134926158245162215521348792441450417568480641206365201703863301295327776990231186480200675569056822950163549319923059142463962170253297475731140942201801993680350264956369558664259067626856873721103391567938398957655651931778830002416135395624377778408017488193730950206999008908993280883974303677365955248913001566332940779071396154645340887915103006513219344866732482759079468078798194250195826223203951312520141099605312606965554042486705499867869230217469890095478507256729787947698888310934874644264007181831603316555115342761556224054744733780492462149521332585276988473362691826491743389878247892784689188280546699
82303689939783413747587025805716349413568433929396068192061773331791738208562436433635359863494496890781064019674074436583667071586924521182997893804077137501290858646578905771426833582768978554717687184427726120509266486102051535642840632368481807287940717127966820060727559555904040233178749447346454760628189541512139162918444297651066947969354016866010055196077687335396511614930937570968554559381513789569039251014953265628147011998326992200066392875374713135236421589265126204072887716578358405219646054105435443642166562244565042999010256586927279142752931172082793937751326106052881235373451068372939893580871243869385934389175713376300720319760816604464683937725806909237297523486702916910426369262090199605204121024077648190316014085863558427609537086558164273995349346546314504040199528537252004957805254656251154109252437991326262713609099402902262062836752132305065183934057450112099341464918433323646569371725914489324159006242020612885732926133596808726500045628284557574596
59212053034131011182750130696150983551563200431078460190656549380654252522916199181995960275232770224985573882489988270746593635576858256051806896428537685077201222034792099393617926820659014216561592530673794456894907085326356819683186177226824991147261573203580764629811624401331673789278868922903259334986179702199498192573961767307583441709855922217017182571277753449150820527843090461946083521740200583867284970941102326695392144546106621500641067474020700918991195137646690448126725369153716229079138540393756007783515337416774794210038400230895185099454877903934612222086506016050035177626483161115332558770507354127924990985937347378708119425305512143697974991495186053592040383023571635272763087469321962219006426088618367610334600225547747781364101269190656968649501268837629690723396127628722304114181361006026404403003599698891994582739762411461374480405969706257676472376606554161857469052722923822827518679915698339074767114610302277660602006124687647772881909679161335401988
14027579921741676787992316039635694928515136336472195406111717673873725557285229400543617851765023075446938693078734991103521825329297260445532107978877114498988709115112372506042387537348412570860640690520584521227545338480082053024504565176695185769132000428167580549248117805198326460324457928297301291053183856368212062155312886685649565126138922613670640939533345705269869596923503530942245438652786776730275404027022463844835532399147513634410440500923303612714960813554905315390210022995957565837053812619656831442860579566966221547216956208700137277685369608407048333251327931122325071486302069512453950037357233468070946564830892098015348787056334910923660575540508641115214414814346304372732710450277686619531078583233348578402971609252153260925589326556006721243594642550659967717703884453961816328796144608177892721718369088801267782074301064225246348074543004764928855534090621851536543554741254761527697726677697727770583158014121856880117050283652755432148034880044429799980
62157904564161957212784508928489806426497427090579129069217807298769477975112447305991406050629946894280931034216416629935614828130998870745292716048433630818404126469637925843094185442216359084576146078558562473814931427078266215185541603870206876980461747400808324343665382354555109449498431093494759944672673665352517662706772194183191977196378015702169933675083760057163454643671776723387588643405644871566964321041282595645349841388412890420682047007615596916843038999348366793542549210328113363184722592305554383058206941675629992013373175489122037230349072681068534454035993561823576312837767640631013125335212141994611869350833176587852047112364331226765129964171325217513553261867681942338790365468908001827135283584888444111761234101179918709236507184857856221021104009776994453121795022479578069506532965940383987369907240797679040826794007618729547835963492793904576973661643405359792219285870574957481696694062334272619733518136626063735982575552496509807260123668283605928341
85584802695841377255897088378994291054980033111388460340193916612218669605849157148573356828614950001909759112521880039641976216355937574371801148055944229873041819680808564726571354761283162920044988031540210553059707666636274932830891688093235929008178741198573831719261672883491840242972129043496552694272640255964146352591434840067586769035038232057293413298159353304444649682944136732344215838076169483121933311981906109614295220153617029857510559432646146850545268497576480780800922133581137819774927176854507553832876887447459159373116247060109124460982942484128752022446259447763874949199784044682925736096853454984326653686284448936570411181779380644161653122360021491876876946739840751717630751684985635920148689294310594020245796962292456664488196757629434953532638217161339575779076637076456957025973880043841580589433613710655185998760075492418721171488929522173772114608115434498266547987258005667472405112200738345927157572771521858994694811794064446639943237004429114074721
81802248258377360173466853007449855647154200361235933973129144585915228874087195087086322188372882628228846318437172619033057771476515641438223067918473860391476831081413582757558536435977216500282778037134228696887873497950960311088991961433866640684506974207877002805093672033872326296378560386532164323488155575570184690890746478791224363755566686780676105449550172607911429308312857612544819444494732448190937953690082063846316782250648095318104065702543276043857035059228189198780658654121842992172737209551032422510797180778330426090867942734289557355592527238055114404380012390416877164451802264916816419274011064516224311017000566911217331894234005479596846698042980173625704067332821299621536848814041021944634246462207455756439604529853130714090846084996537678037932018991408658146621753193376659701143306086250098295669176388460567629729314649114937046244693519840395344491351411936679333019366176636525551491749823079870722808608596261126605042892969665356525166888855721122768
02772743708917389639772257564890533401038855931125679991516589025016486961427207005916056166159702451989051832969278935550303934681219761582183980483960562523091462638447386296039848924386187298507775928792722068554807210497817653286210187476766897248841139560349480376727036316921007350834073865261684507482496448597428134936480372426116704266870831925040997615319076855770327421785010006441984124207396400139603601583810565928413684574119102736420274163723488214524101347716529603128408658419787951116511529827814620379139855006399960326591248525308493690313130100799977191362230866011099929142871249388541612038020411340188887219693477904497527454288072803509305828754420755134816660927879353566521255620139988249628478726214432362853676502591450468377635282587652139156480972141929675549384375582600253168536356731379262475878049445944183429172756988376226261846365452743497662411138451305481449836311789784489732076719508784158618879692955819733250699951402601511675529750575437810242
23895792578656212843273120220071673057406928686936393018676595825132649914595026091706934751940897535746401683081179884645247361895605647942635807056256328118926966302647953595109712765913623318086692153578860781275991053717140220450618607537486630635059148391646765672320571451688617079098469593223672494673758309960704258922048155079913275208858378111768521426933478692189524062265792104362034885292626798401395321645879115157905046057971083898337186403802441751134722647254701079479399695355466961972676325522991465493349966323418595145036098034409221220671256769872342794070885707047429317332918852389672197135392449242617864118863779096281448691786946817759171715066911148002075943201206196963779510322708902956608556222545260261046073613136886900928172106819861855378098201847115416363032626569928342415502360097804641710852553761272890533504550613568414377585442967797701466029438768722511536380119175815402812081825560648541078793359892106442724489861896162941341800129513068363860
92941000831366733721530083526962357371753307386533382048421903081864491840937239440334052449095545580164064607615810103017674884750176619086929460987692016912021816882910408707095609514704169211470274133900522533408348128703530310239196999785974139085936054335996970756044601342424536824960987725813110247327985620721265724990034682938868723048955622532044636026398542252584164643242716114198178024825955635449072192265838636626637508359443148776351561457107455280161596770484427141944351832756984075526779264112617652506159652354571879566731709133193587616282559207830801852068901515047133403861003100559148178521103847545429333891884441205179439699701941126951195265649195941899754183932346474242907027188752235343936736336632003072327470374071239825620246626519740901997624520561985576257600087081730832883443818310700545144935458854226785785519153722923795554943334101744201696000906964156127322977702212179518683763590822551288164700219923488640439591530184640047143211863606225270115
41122283802778538911098490201342741014121559769965438877197485376431158229838533123071751132961904559007938064276695819014842627991221792947987348901868471676503827328552059082984529806259250352128451925927986593506132961946796252373972565584157853744567558998032405492186962888490332560851455344391660226257775512916200772796852629387937530454181080729285891989715381797343496187232927614747850192611450413274873242970583408471112333746274617274626582415324271059322506255302314738759251724787322881491455915605036334575424233779160374952502493022351481961381162563911415610326844958072508273431765944054098269765269344579863479709743124498271933113863873159636361218623497261409556079920628316999420072054811525353393946076850019909886553861433495781650089961649079678142901148387645682174914075623767618453775144031475411206760160726460556859257799322070337333398916369504346690694828436629980037414527627716547623825546170883189810868806847853705536480469350958818025360529740793538676
51119507937328208314626896007107517552061443378411454995013643244632819334638905093654571450690086448344018042836339051357815727397333453728426337217406577577107983051755572103679597690188995849413019599957301790124019390868135658553966194137179448763207986880037160730322054742357226689680188212342439188598416897227765219403249322731479366923400484897605903795809469604175427961378255378122394764614783292697654516229028170110043784603875654415173943396004891531881757665050095169740241564477129365661425394936888423051740012992055685428985389794266995677702708914651373689220610441548166215680421983847673087178759027920917590069527345668202651337311151800018143412096260165862982107666352336177400783778342370915264406305407180784335806107296110555002041513169637304684921335683726540030750982908936461204789111475303704989395283345782408281738644132271000296831194020332345642082647327623383029463937899837583655455991934086623509096796113400486702712317652666371077872511186035403755
44874186935197336566217723592293967764632515620234875701137957120962377234313702120310049651521119760131764194082034373485128526029133349151250831198028501778557107253731491392157091051309650598859999315608636554774035518981667335358800482146650997414337611827777233519107412175728415925808725913150746060256349037772633739144613770380213183474473011130326702969173350477016321066162278300272692833655840117914194478087482533607144032962522857750098085996090409363126356213281620714534061042241120830100085872642521122624801426475194261843258533867538740547434910727100497542811594660171361225904401589916002298278017960351940800465135347526987776095278399843680869089891978396935321799801391354425527179102253970108106321430485113782914985113819691430434975001899806816444121232733283071928243624067331965546926778511931525e0
+floating point operation: 1.60563e+08 op.
+exit 0
More information about the llvm-commits
mailing list